Journal of Bioscience and BioengineeringVOL. 109 No. 4, 411–417, 2010

www.elsevier.com/locate/jbiosc

Directed evolution of angiotensin II-inhibiting peptides using a microbead display

Rui Gan,1 Seiji Furuzawa,1 Takaaki Kojima,1 Kei Kanie,2 Ryuji Kato,2

Mina Okochi,2 Hiroyuki Honda,2 and Hideo Nakano1,⁎

⁎ CorrespondE-mail add

1389-1723/$doi:10.1016/

Laboratory of Molecular Biotechnology, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan1

and Department of Biotechnology, School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603, Japan2

Received 25 March 2009; accepted 13 October 2009Available online 14 November 2009

Angiotensin II (ang II), an octapeptide (DRVYVHPF), can regulate blood pressure by binding specifically to its receptor, AT1.A peptide (VVIVIY) in the first transmembrane of AT1 has been found, via peptide array technology, to have an affinity for angII. In this study, the peptide P2, which contained the VVIVIY sequence, was mutated and screened using microbead displaytechnology that utilized emulsion PCR and cell-free protein synthesis. After one round of screening, the binding activities ofcollected mutants were estimated using flow cytometry and a peptide array. Two of these exhibited improved association rateconstants to ang II, compared to the P2 peptide.

© 2009, The Society for Biotechnology, Japan. All rights reserved.

[Key words: Single-molecule PCR; Microbead display; Cell-free protein synthesis; Directed evolution; Angiotensin II]

Angiotensin II (ang II) is considered to be substantially involved inregulating the cardiovascular system. It is part of the renin–angiotensin system, which is a major target for drugs designed tolower blood pressure (1). Angiotensin-specific receptors can beactivated by ang II. The activated receptor further inhibits adenylatecyclase and activates various tyrosine kinases. The high-affinityreceptors for ang II belong to the seven-transmembrane G proteincoupled receptor superfamily and are comprised of at least twodistinct receptor subtypes: type 1 (AT1) and type 2 (AT2). Three-dimensional models of AT1 in a complex with its ligand have beenreported (2). Site-directed mutagenesis studies and pharmacologicalexperiments have suggested that more than 40 residues in AT1 areinvolved in either ligand binding or signal transduction (3, 4). Using apeptide array, Kato et al. demonstrated that the peptide fragment(VVIVIY) in the first transmembrane region exhibited the highestaffinity to ang II, compared to other fragments. The inhibitory effect onang II was confirmed in this prior work using a rat aorta contractileassay (5). Therefore, the VVIVIY peptide can be considered a drugcandidate for hypertension.

Increasing numbers of biological macromolecules have beenutilized and modified as therapeutic drugs using in vitro directedevolution methods. In recent decades, monoclonal antibodies orsingle-chain antibodies (6–8) were successfully engineered to acquirehigher affinities and specificities using display technologies, such asphage (9, 10) and ribosome displays (11, 12). Some biomedicalproteins, such as DNA- and RNA-binding factors, have also beenevolved using in vitro compartmentalization (IVC) methods (13–15).

ing author. Tel.: +81 52 789 4143; fax: +81 52 789 4145.ress: hnakano@agr.nagoya-u.ac.jp (H. Nakano).

- see front matter © 2009, The Society for Biotechnology, Japan. Allj.jbiosc.2009.10.009

In our laboratory, using single-molecular polymerase chainreaction (PCR) (16) and IVC methods (13), a population of DNAmolecules can be displayed on microbeads. Such microbead–DNAlibraries were successfully applied toward the identification oftranscription factor-recognizing sequences over the entire microbialgenome of Paracoccus denitrificans (17) and from random mutationlibraries (18). Combined with cell-free protein synthesis (19), single-molecule PCR products could be converted into a protein library usingSIMPLEX (20). Based on the methods mentioned above, a DNA–protein specific coupling library has been displayed on microbeadsand, in our previous work, this method has proven effective towardthe directed evolution of a mutated His6 tag library (21). To obtainpeptides with much higher affinities toward ang II, the peptide P2,consisting of the core sequence VVIVIY and another 8 amino acids(FYMKLKTV) at the C terminus, was mutated and subjected to high-throughput screening. Two mutation libraries were constructed atdifferent regions of P2 using oligonucleotide-directed mutagenesis.Another peptide, N1 (VDTAMPITICIAYF), which has no detectableaffinity to ang II, was used as a negative control. Both libraries wereevolved using the microbeads display with some modifications. Theseallowed more convenient and low-cost manipulations for displayingpeptides on microbeads via the binding between a Strep II tag andstreptavidin (Fig. 1). After one round of screening using flowcytometry, some mutants were selected from the collection andtheir affinities toward ang II were analyzed using a peptide array.

MATERIALS AND METHODS

Plasmid construction Full-length plasmids (pRSETH and pRSETF) that wereconstructed previously (21) were amplified by inverse PCR using the oligonucleotidesStrept-GSTF and Strept-GSTR (Table 1), which introduced an N-terminal fused Strep IItag (WSHPQFEK) into the GST encoding region. Therefore, the two plasmids having a

rights reserved.

FIG. 1. Schematic representation of a microbeads display showing a DNAmolecule and DNA–protein coupling inW/O emulsion and fluorescence-activated cell sorting (FACS). 1, Full-length templates were constructed, containing the T7 promoter (T7P), ribosome binding site (RBS), glutathione S-transferase (GST) encoding region, His6 tag (positive control) orFLAG tag (negative control), and a T7 terminator (T7T); 2, the biotinylated reverse primer was linked to streptavidin-coated beads and the biotinylated forward primer was used as afree primer; 3, the templates were amplified with bead-linked reverse primer and biotinylated forward primer in emulsion; 4, after amplification, the templates were displayed onthe surface of beads via bead-linked reverse primers; 5, bead–DNA complexes were labeled with streptavidin at the other end of the template; 6, proteins were synthesized inemulsion and linked to their coding DNA via the fused StrepII tag which binds to streptavidin; 7, bead–DNA–protein complexes were labeled with FITC-labeled anti-His6 (C-term)antibody and subjected to FACS; 8, beads with signals were collected and the genes were amplified for the next round of screening and analysis.

412 GAN ET AL. J. BIOSCI. BIOENG.,

Strep II tag were designated as pRSETH-strep and pRSETF-strep, respectively.Subsequently, the GST-His6 encoding region in pRSETH-strept was displaced with aP2 peptide-coding region, using Strept-P2R/Strept-P2F primers, and an N1 peptide-coding region, using Strept-N1R/Strept-N1F primers. The two newly constructedplasmids were designated pRP2-strept and pRN1-strept, respectively. The P2 peptideshowed a high affinity toward ang II (5), while the N1 peptide showed no detectableaffinity toward ang II. All the expression cassettes were verified by DNA sequencing(ABI 310, Applied Biosystems, CA, USA).

Coupling oligonucleotides to microbeads Streptavidin-coated magneticbeads (Dynal Biotech, Invitrogen) (50 μl) were washed three times with 2× B&Wbuffer (10 mM Tris–HCl, pH 7.5; 1 mM EDTA; 2.0 M NaCl) and recovered using amagnetic particle concentrator (Dynal Biotech). Beads were suspended in 100 μl 1×B&W buffer containing 5 μM dual biotinylated primer Rv1-T8-db (Table 1) andincubated at room temperature with rotation for 30 min. Thereafter, the bead–primercomplex was washed twice with TE buffer (10 mM Tris–HCl, pH 8.0; 1 mM EDTA),suspended in 30 μl TE buffer, and stored at 4 °C. The dual biotinylated primer Rv1-T8-dbcan saturate streptavidin on the surface of beads. Therefore, no other molecules thatcarry biotins can bind directly to the surface of beads in the following manipulation.

Solid-phase single-molecule PCR in W/O emulsion The entire expressioncassette was amplified from pRSETH-strept and pRSETF-strept and the products wereused as templates. Templates were quantified by measuring the absorbance at 260 nmwith a spectrophotometer (Nanodrop™ N-1000, Nanodrop Technologies) and diluted

TABLE 1. Oligon

Strept-GSTF CC

Strept-GSTR GTFw1Rv1Fw1-bioRv1-T8-dbO-R1O-F1His-rFLAG-rStrept-P2F TATATGAStrept-P2R AAAATAStrept-N1F ACTATTStrept-N1R AATGGGMu-F1 GAGCCACCCGCAGTTCGAAAAAGTTGMu-F2 GAGCCACCCGCAGTTCGAAAAANNSNNSMu-F3Mu-R1Mu-R2

to 1 pg/μl (approximately 106molecules/μl; molecular weight≈ 6×105). We prepareda 20-μl PCR mixture containing 0.5 pg template, 250 μM of each dNTP, 0.5 μM Fw1-bio(biotinylated forward primer), 2×106 bead-Rv1-T8-db, 0.5 mg/ml BSA, 5 nM Rv1primer, 5 U ExTaq DNA polymerase (Takara), and 1× ExTaq buffer on ice. The oil phasewas prepared by mixing 400 μl mineral oil (Sigma Aldrich), 16 μl Sun Soft No. 818SK(Taiyo Kagaku, Yokkaichi, Japan), and 4 μl Span 80 at room temperature for 15min. Thiswas incubated at 50 °C for 10 min, followed by incubation on ice for 10 min. The PCRmixture was added to the oil phase and vortexed for 10 s. The obtained emulsion wasdispensed into 50 μl aliquots in PCR tubes. Solid-phase emulsion PCR was thenperformed using the following conditions: preheating at 94 °C for 5 min; 60 cyclesconsisting of 94 °C for 15 s, 50 °C for 9 min, and 72 °C for 1 min; with an additionalextension at 72 °C for 7 min. After PCR, the emulsion was disrupted by the addition of600 μl hexane and vortexed gently for 10 s. Beads were recovered by centrifugation at17,400×g for 3 min, and the oil phase was decanted. Subsequently, beads were washedwith hexane 3–4 times, until the white surfactant layer disappeared. Beads were thenwashed with 20 μl 2× B&W buffer and 600 μl hexane, and then recovered bycentrifugation at 17,400×g for 3 min. Finally, the beads were washed 3 times with200 μl TE buffer, suspended in 10 μl TE buffer, and stored at 4 °C.

Detection of biotinylated proteins Protein samples extracted from E. coliweresubjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE;12.5 %). The gel was then washed with transfer buffer [0.31% Tris, 1.44% glycine, 20(v/v)% methanol] and the proteins were transferred to a polyvinylidene fluoride (PVDF)

ucleotides.

GCAGTTCGAAAAAATGTCCCCTATACTAGGTTATTGG

GGCTCCAGCTAGCCATATGTATATCTCCTTCTTAAAGCGATCCCGCGAAATTAATACTCTTCGCTATTACGCCAGA

Biotin-CGATCCCGCGAAATTAATACDual biotin-TTTTTTTTCTTCGCTATTACGCCAGA

GCCTCTTCGCTATTACGCCAGAGCGTTGGCCGATTCATTAATGCAGCCATGGTACCATTAATGATGATGAT

CTTGTCGTCATCGTCCTTGTAAATTGAAAACTGTTTAATGGTACCATGGAATTCGAAGCTTGAATAACAATAACAACTTTTTCGAACTGCGGGTGGCTCCAG

TGTATTGCTTATTTTTAATGGTACCATGGAATTCGAAGCTTGCATAGCAGTATCAACTTTTTCGAACTGCGGGTGGCTCCAGTTATTGTTATTTATTTTTATATGAAATTGAAAACTGTTTAATGGTACCATGGAATTCGAAGCTTGNNSGTTATTTATTTTTATATGAAATTGNNSNNSNNSTAATGGTACCATGGAATTCGAAGCTTG

TAATGGTACCATGGAATTCGAAGCTTTTTCGAACTGCGGGTGGCTCCTTCGAATTCCATGGTACCATTA

MICROBEAD DISPLAY FOR DIRECTED EVOLUTION OF PEPTIDE 413VOL. 109, 2010

membrane electrophoretically (15 V, 40 min). The membrane was then incubated inblocking buffer (4% Block Ace; Dainippon Sumitomo Pharma Co., Ltd.) overnight.Afterward, the membrane was washed with TS buffer (PBS pH 7.4, 0.05% Tween20)three times. Subsequently, biotinylated proteins were detected using the ABC-PO kit(Vector Laboratories).

Cell-free protein synthesis in W/O emulsion Bead–DNA complexes (about2×106 beads) were incubated in 100 μl PBS buffer with 40 μg/ml streptavidin (VectorLaboratories). After incubation, the complexes were washed three times with 200 μlPBS buffer (pH 7.4). We prepared 20 μl of a cell-free protein synthesis mixture on ice,which was comprised of: 56.4 mM Tris–acetate (pH 7.4); 1.22 mM ATP (pH 7.0);0.85 mM each of GTP, UTP, and CTP; 50 mM creatine phosphate; 0.5 mM each of 20amino acids; 4% PEG 6000; 34.6 μg/ml folinic acid; 35.9 mM ammonium acetate;0.17 mg/ml E. coli tRNA; 0.15 mg/ml creatine kinase; 10.5 μg/ml T7 RNA polymerase;10 μg/ml rifampicin; 6.7 mM magnesium acetate; 28.4% S30 extract; and approximate106 bead–DNA complexes as the template. The cell-free extract was prepared asdescribed previously (22, 23). The oil phase was prepared according to the method ofTawfik and Griffiths, with some modifications (13). We added 380 μl mineral oil, 18 μlSpan 80, and 2 μl TritonX-100 to a 2 ml vial, with stirring (700 r.p.m), at roomtemperature for 30min. This was followed by incubation on ice for 10min. The cell-freemixture was gradually added to the oil phase on ice, with stirring at 700 r.p.m. Theemulsion was incubated at 37 °C for 1.5 h, for protein synthesis. Thereafter, theemulsion was disrupted by adding 600 μl hexane, with gentle vortexing for 10 s. Beadswere recovered by centrifugation at 17,400×g for 3min. This process was repeated 2–3times until the white surfactant layer disappeared. In addition, the beads were washedtwice with 200 μl PBS buffer, suspended in 10 μl PBS buffer, and stored at 4 °C.

Construction of P2 mutation libraries Two oligonucleotides, Mu-F1 and Mu-F2 (Table 1), were synthesized, covering the full length of P2 and carrying overlapregions to the flanking sequences of P2. In Mu-F1, the nucleotides (Italic characters)were mutated with 5% possibility into the other three nucleotides. In Mu-F2, threeamino acids at both ends of P2 were randomized using NNS codons (N: A, T, G, or C; S: Gor C). Complementary strands were synthesized using a Klenow extension (Fig. 2).Upstream and downstream fragments flanking P2 were amplified from the plasmidpRP2-strept. The amplification was performed in a 50 μl PCR mixture containing250 μM each of dNTP, 1.25 U Pyrobest DNA polymerase (Takara), and 1× Pyrobest bufferII. The amplification was performed under the following conditions: preheating at 94 °Cfor 5 min; 25 cycles, consisting of 94 °C for 15 s, 50 °C for 30 s, and 72 °C for 1 min; withan additional extension at 72 °C for 7 min. All three fragments were purified using a gelextraction column (Qiagen) and were subjected to an overlapping extension to restorethe full-length DNA fragments. The overlap PCR was performed on a 50 μl PCR mixturecontaining a total of 30 ng of the three DNA fragments (molecular ratio=1:1:1),250 μMof each dNTP, 1.25 U Pyrobest DNA polymerase (Takara), and 1× Pyrobest bufferII. The amplification was performed under the following conditions: preheating at 94 °Cfor 5 min; 10 cycles, consisting of 94 °C for 15 s, 50 °C for 30 s, and 72 °C for 1 min; withan additional extension at 72 °C for 7 min. Finally, the full-length template wasamplified with O-F1 and O-R1 using the following conditions: preheating at 94 °C for5 min; 20 cycles, consisting of 94 °C for 15 s, 50 °C for 15 s, and 72 °C for 1 min; with anadditional extension at 72 °C for 7 min.

High-throughput screening of bead–DNA–protein complexes using flowcytometry The bead–DNA–protein complexes, as purified from the cell-freesynthesis emulsion, were suspended in 20 μl PBS containing 20 μg/ml fluoresceinisothiocyanate (FITC)-labeled anti-His6 (C-term) antibody (Invitrogen). This was

FIG. 2. The construction of P2mutation libraries. 1, The upstream and downstream fragmentsthe two fragments had an overlapping region with the P2 sequence; 2, two oligonuclecomplementary strands were synthesized using a Klenow extension; 3, the three fragmentamplified using O-F1/O-R1 primers.

subsequently incubated, with rotation, at room temperature for 20 min. For beadsdisplaying P2, N1, and P2 mutants, bead–DNA-peptides purified from the cell-freesynthesis emulsion were suspended in 20 μl PBS that contained 5 μg/ml angiotensin IIconjugate fluorescein (Invitrogen). This was then incubated, with rotation, at roomtemperature for 30 min. Thereafter, the complexes were diluted with 500 μl PBS bufferand analyzed using an EPICS ELITE ESP (Beckman Coulter). DNA fragments on collectedbeads were amplified in a 50 μl PCR mixture containing 250 μM of dNTP, 0.5 μM each ofFw1 and Rv1 primers, 1.25 U Pyrobest DNA polymerase, and 1× Pyrobest buffer II. Theamplification was performed under the following conditions: preheating at 94 °C for5min; 25 cycles, consisting of 94 °C for 15 s, 50 °C for 15 s, and 72 °C for 1min; followedby an additional extension at 72 °C for 7 min. Products were purified using a MinElutePCR Purification Kit (Qiagen) and stored at –20 °C.

Identification of gene types by one-bead PCR Beads collected from flowcytometry were dispersed at an average of one bead per 10 μl of PCR mixture, whichcontained 250 μM of dNTP, 0.5 μM each of Fw1 and Rv1 primers, 0.5 U ExTaq (Takara),and 1× ExTaq buffer. PCR was performed under the following conditions: preheating at94 °C for 5 min; 25 cycles, consisting of 94 °C for 15 s, 50 °C for 15 s, and 72 °C for 1 min;with an additional extension at 72 °C for 7 min. Products that showed the correct bandswere selected, diluted 200 times, and used as templates for the second PCR. In thesecond PCR, His-r and FLAG-r primers were used to separately amplify the templatefrom each sample, to verify the gene type. The second PCR was performed using thesame conditions as in the first PCR.

Analysis of the binding activities of P2 mutants using flow cytometry TheDNA template of each mutant was amplified by PCR and quantified by its absorbanceat 260 nm using a spectrophotometer (Nanodrop™ N-1000, Nanodrop Technolo-gies). For each mutant, 200 ng of DNA template was used for the cell-free proteinsynthesis. About 106 streptavidin-coated magnetic beads (Dynal Biotech, Invitrogen)were added to each cell-free protein synthesis reaction in the presence of 0.5% (w/v)TritonX-100. After incubation for 2 h at 37 °C, beads were recovered on a magnet.This was followed by two washings with 400 μl PBS buffer. Afterwards, the beadswere incubated in 20 μl of PBS buffer with 5 μg/ml angiotensin II conjugatefluorescein at room temperature for 30 min. Finally, the incubation mixture wasdiluted to 500 μl with PBS buffer and fluorescence measurements were performedvia flow cytometry. The mean value of fluorescence for each mutant was comparedto that of the P2 fragment.

Peptide affinity measurement Triplicate peptide spots (6 mm diameter) ofselected candidate peptides (P2, N1, M1L1, and M1L3) were synthesized on eightblocks of peptide arrays, following a previously reported method (5). Peptide arrayswere washed with PBS for 12 h and then blocked with 1% bovine serum albumin (BSA)in PBS for 1 h at room temperature. The probe, angiotensin II, fluorescein conjugate(Cat. No. A13438, Invitrogen), was dissolved in DMSO and added to 1% BSA in PBS toproduce a final concentration of 0 (control), 0.1, 0.4, 0.9, 1.8, 4.4, 8.9, and 17.8 μM in6 mm plastic dishes. Blocked peptide arrays were individually soaked in the probe-containing solution and hybridized with slow agitation at 27 °C. At every time point,arrays were removed from the hybridization dishes and the fluorescence intensities ofeach spot were scanned using a fluorescence scanner (FLA-7000; Fujifilm, Japan), toproduce a time course accumulation curve. The average intensity of triplicate controlspots was subtracted from each spot as a background. This was then averaged as theintensity of each peptide. Tangent lines to each accumulation curve were obtained bylinear regression using data from the 0, 5, and 15min time courses and these were usedto obtain the gradient (Kobs). According to the equation Kobs=Kd×C+Ka (C:

were amplified with O-F1/Mu-R1 andMu-F3/O-R1 primers respectively, where each ofotides, Mu-F1 and Mu-F2, were synthesized with a mutated region of P2 and thes were overlapped to restore the full-length template; 4, the full-length template was

FIG. 3. (A) Amounts of biotin in various biotin deficient E. coli strains, including JW0758 (bioΔB) (lane 2), JW0757(bioΔA) (lane 3), JW0761(bioΔD) (lane 4), JW0759(bioΔF) (lane 5),and A19(ΔRNaseI) used as the control (lane 1). (B) Growth curves of JW0758(bioΔB) cultured in LB media with normal (open square), 1/10 (closed triangle), and 1/100 amount(closed square) of yeast extract typically used. The A19 strain was also cultured in LB media with a normal amount of yeast extract, as the control (open circle). (C) Amounts of biotindetected in the A19 strain (lane 1) and the JW0758(bioΔB) strain (lane 2) cultured with a normal amount of yeast extract, as well as JW0758(bioΔB) cultured with 1/10 the amountof yeast extract (lane 3).

414 GAN ET AL. J. BIOSCI. BIOENG.,

concentration of angiotensin II fluorescein conjugate), a scatter plot was generated toobtain Kd and Ka. KD was obtained by the equation KD=Kd/Ka.

RESULTS

Preparation of cell-free extract from biotin biosynthesisdeficient strains of E. coli According to the design of themicrobeads display, nascent peptides should bind to the streptavidinmolecules via an N-terminal fused Strep II tag. This showed a modestaffinity toward streptavidin, with an association constant of 13,818 M-1

(24). In the experiments, we found that cognate biotinylated proteinsin E. coli extract impacted binding of the Strep II tag dramatically.Amounts of biotinylated proteins were measured in the A19(ΔRNaseA) strain, which was used in previous experiments, and several biotinsynthesis deficient strains, including JW0757(ΔbioA), JW0758(ΔbioB),JW0759(ΔbioF), and JW0761(ΔbioD). All biotin deficient strainsshowed significantly lower levels of biotinylated proteins than A19.Among these, JW0758(ΔbioB) showed the lowest level (Fig. 3A).However, the linkage between DNA and protein had not yet formed.

FIG. 4. (A) Typical FACS histograms of microbeads carrying the GST-His6 genes (positive cogenes (horizontal axis: intensity of fluorescence; vertical axis: count of beads). The beads inbeads recovered by FACS were amplified using His6-specific (designated as H) and FLAG-specgene, while two beads carried both of the two genes.

We reason that the yeast extract used for the E. coli culture containedbiotins or biotinylated proteins, which could inhibit the binding ofStrep II tag. The amount of yeast extract in the LB medium wasdecreased to 1/10, 1/100, and 1/1000 of that typically used (25). A19and JW0758 (ΔbioB) strains grew well in LB media with 1/10 yeastextract (Fig. 3B). Amounts of biotinylated proteins were againdetected using the ABC-PO kit. Consequently, biotinylated proteinscould not be detected in the extract prepared from the JW0758(ΔbioB) strain (Fig. 3C).

Enrichment of the GST-His6 coding template from a mixedmodel library The average diameter of emulsion was estimated tobe around 25–35 μm. Therefore, it was reasonable that 20 μl of PCRmixture could form approximately 1.5×106 droplets. Two templateswere prepared by amplifying pRSETH-strept and pRSETF-strept withFw1 and Rv1. Model libraries were constructed by mixing the twokinds of PCR products at a ratio of 1:1000 (His6:FLAG).We used 0.5 pgPCR product (approximately 0.5×106 molecules) as the template in a20 μl PCR mixture, resulting in an average of about 0.3 molecules perdroplet. The proportion of droplets containing one molecule was

ntrol), GST-FLAG genes (negative control), and a 1:1000 mixed population of the tworegion C were collected for one-bead PCR identification. (B) PCR products of 14 singleific (designated as F) primers, respectively. Eleven of 14 beads carried only the GST-His6

TABLE 2. The sequences and copy numbers of mutants recovered by FACS.

Library 1 Library 2

V V I V I Y F Y M K L K T V (WT) 4 V V I V I Y F Y M K L K T V (WT) 0V V I V I Y F C M K L K T V 3 P E K V I Y F Y M K L G A L 18V V I A I Y F Y M K L K T V 1 R Q Q V I Y F Y M K L A F R 1V V I V I Y F Y M K V K T V 1 E T G V I Y F Y M K L R F L 1L V I V I Y F Y M K L K T V 1V V I V I Y F Y M K Stop 1V V I V I Y F Y M K S K T V 1V V I V I Y F Y M K S R T V 1V V L V I Y F C M K L K T V 1

TABLE 3. The mutants with improved affinities for angiotensin II.

Name Sequences

L1M1 V V I V I Y F C M K L K T VL1M2 V V I A I Y F Y M K L K T VL1M3 V V I V I Y F Y M K V K T VL1M4 V V I V I Y F Y M K S R T VL1M5 V V L V I Y F C M K L K T VP2 V V I V I Y F Y M K L K T VN1 V D T A M P I T I S I A Y F

MICROBEAD DISPLAY FOR DIRECTED EVOLUTION OF PEPTIDE 415VOL. 109, 2010

estimated to be approximately 22%, according to a Poisson distribu-tion. During screening, beads were collected at a ratio of 0.1% (Fig. 4A)and analyzed using one-bead PCR. We further analyzed 14 samplesthat exhibited sharp bands by PCR, using His6-specific and FLAG-specific primers. Of these samples, 11 exhibited only GST-His6 bands,while the other three samples showed both GST-His6 and GST-FLAGbands (Fig. 4B). This might have been caused by two gene types in onedroplet in the emulsion PCR, or by the presence of more than one beadwith different templates in the same well during one-bead PCR. Theratio of the GST-His6 template in the mixed library increased from0.1% (1:1000) to 78.5% (11:14). Based on these results, an approx-imately 800-fold enrichment was obtained by single-round screening.

Construction and screening of the mutation libraries ofangiotensin II-binding peptide P2 Two libraries were constructedand screened independently (Fig. 2). In Library 1, each nucleotide ofP2 was changed with 5% possibility into the other three nucleotideswith equal probability. Therefore, there were about 2.1 mutations onaverage in one DNA molecule (total of 42 nucleotides). In Library 2,three codons at both ends of P2 were randomized completely. This isbecause, as in previous work, the flanking amino acids in thehydrophobic peptide contributed largely to binding (R. Kato,unpublished data). The pool of mutated DNAmolecules was dispersedinto the emulsion at an average of 0.3 molecules per droplet. Thisallowed 22% of the droplets to contain only one type of template. P2and N1 templates were used as positive and negative controls. ForLibrary 1, about 1.8×105 beads were analyzed and 300 beads were

FIG. 5. The relative affinities of five mutants to angiotensin II, compared to the P2peptide. For each mutant, 200 ng of DNA template was used for cell-free proteinsynthesis and the synthesized peptides were linked to microbeads via a fused Strep IItag. Subsequently, the beads were incubated in 20 ml of PBS buffer with 2.5 μg/mlangiotensin II conjugate fluorescein. Finally, the incubation mixture was diluted to500 μl with PBS buffer and fluorescence measurements were performed using flowcytometry. The fluorescence intensity of P2 was calculated as 1. Mean fluorescencevalues of the other mutants were compared to that of the P2 fragment. The N1 fragmentwas used as a negative control.

collected using a 0.16% gating region. For Library 2, 1.5×105 beadswere analyzed and 0.33% of them, approximately 500 beads, werecollected. The DNA on beads was amplified with PCR and cloned intoE. coli DH5α. Fourteen mutants of Library 1 and 20 mutants of Library2 were sequenced (Table 2). Mutants with unique sequence wereexpressed using cell-free protein synthesis, with 200 ng DNA as thetemplate. Synthesized peptides were linked to streptavidin-coatedmicrobeads via a Strep II tag. After incubation with fluorescein-conjugated angiotensin II, the bead fluorescence was measured usingflow cytometry. The mean value of the fluorescence peak indicatedthe affinity toward ang II. We found that five mutants from Library 1seemed to have higher affinities to ang II (Fig. 5), as compared with P2(Table 3). On the other hand, no improved mutants were found fromLibrary 2 (data not shown).

Affinity measurement of P2, N1, and mutated peptides by useof a peptide array Uponmeasurement using flow cytometry, somemutants demonstrated higher affinities toward ang II. However, it wasdifficult to quantify the affinities of mutant peptides, mainly becausethe amounts of peptides expressed by the cell-free reaction weredifficult to determine. The association rate constant (Ka) of eachpeptide was measured using a peptide array. Toward this end, eachpeptide, having equal amounts, was synthesized on the surface of thepeptide array and hybridized with Fluorescein-conjugated angioten-sin at a series of concentrations (0–17.8 μM; Fig. 6). The Ka values of P2and N1 were 6.60×105 and 1.20×105, respectively. On the otherhand, the Ka values of M1L1 and M1L3 were 7.08×105 and 6.93×105,which is slightly higher than that of P2 (Table 4).

DISCUSSION

Compared to other display technologies applied to in vitro directedevolution, such as phage display and ribosome display, microbeadsdisplay has several advantages. First, it has been estimated thatapproximately 3000–4000 copies of DNA molecules could bedisplayed on a single microbead (21). Moreover, it is possible thatthe DNA copy number may be adjusted by controlling the PCR cycles.Such a multivalent display is critical to successful screening. In phagedisplay, typically the target protein is fused with pIII, with five copieson the phage. It was found that selection often failed if the targetprotein had low affinity (26). However, fusing target proteins to pVIIIwith 2700 copies sometimes leads to poor phage assembly (27). As anin vitro display method, the microbeads display can overcome somedefects of in vivo display technologies, such as protein translocationand host toxicity (28). Moreover, because the shape and size are verysimilar to bacteria cells, the microbeads can be quantitativelyscreened using flow cytometry, as has been done in bacterial displayand yeast display (6, 29). In addition, the microbeads display has avery high enrichment rate. From the results presented here, theenrichment rate was approximately 800–900 folds per round ofscreening. Previously, a 1000-fold enrichment was reported byanother research group (30).

The enrichment rate in this modified microbeads display systemwas slightly lower than in our previous method (21). This is probablydue to the interference of cognate biotins or biotinylated proteins inthe cell-free extract. In the modified method, the synthesized protein

FIG. 6. Association constants of peptides M1L1 (A), M1L3 (B), N1 (C), and P2 (D). The association rate constants were measured using a peptide array, on which the peptides weresynthesized. The fluorescence on the array was detected at different time points after hybridization of the peptide array with Fluorescein-conjugated ang II solutions of differentconcentrations (μM): 0.0 (dotted line), 0.1 (solid line), 0.4 (open circles), 0.9 (open rectangles), 1.8 (open triangles), 4.4 (closed circles), 8.9 (closed rectangles), and 17.8 (closedtriangles).

416 GAN ET AL. J. BIOSCI. BIOENG.,

was bound to its encoding gene via a fused Strep II tag, which shouldbind to the streptavidin molecule directly (24, 31). It is known thatthe natural binding partner of streptavidin is biotin, which, to date, isthe most tightly binding partner. Therefore the presence of biotinswill inhibit the conjugation of the Strep II tag to streptavidin. This willlead to a partial linkage failure between DNA and its encodingproteins. Biotin (vitamin H) is one of the cofactors that are involved incentral pathways in prokaryotic and eukaryotic cell metabolism.Research has led to the discovery of complete biotin biosynthesispathways in E. coli. Much work has been done on the highly intriguingand complex biochemistry of biotin biosynthesis. In E. coli, most genesinvolved in biotin synthesis are organized as a bi-directional operon.The rightward transcription unit includes the bioB, bioF, bioC andbioD genes. The leftward transcription unit includes the bioA gene (32,33). Using the cell-free extract prepared from the JW0758 (bioΔB)strain, cultured with low biotin content media, even in vitro-expressed Strep II tag-fused proteins could link to streptavidinmolecules successfully. Therefore, this method can be appliedextensively to many cases, where the Strep II tag is used to purify

Table 4. Association constants of mutated peptides and controls.

Peptides Ka (×105)

M1L1 7.08M1L3 6.93P2 6.60N1 1.20

heterologous proteins in E. coli and other cells (34, 35), to achieve ahigh purity.

Compared with previous microbeads display methods, theadvantages of these modifications are as follows: (i) the omission ofantibodies makes this method more convenient and less costly; and(ii) proteins or peptides can be displayed even though no specificantibodies are available.

Compared to P2, L1M1 and L1M3 increased in Ka, which wasverified by both flow cytometry (Fig. 5) and peptide array (Fig. 6)methods after one-round enrichment. However, these two methodsshowed a different increment inmagnitude of affinities. In the peptidearray, the Ka of M1L1 increased only approximately 7%, compared toP2. On the other hand, in the flow cytometry method, L1M1 and L1M3showed about a 1.5–2.0 fold improvement. This was mainly becauseof the different expression levels or solubility of these peptides, eventhough equal amounts of DNA templates were used. The Kd values ofthese peptides were also determined via peptide array. However, theKd of N1 showed an unreasonably small value (data not shown). Wereason that the dissociation of Fluorescein-conjugated ang II could notbe detected precisely, as nearly no Fluorescein-conjugated ang II couldbind to N1 at the onset of dissociation. Therefore, in this experiment,Kd was less meaningful than Ka for peptides in this analysis. The Kd

values of L1M1 and L1M3 were 2.77×106 and 3.15×106, respectively,which is slightly lower than that of P2 (3.51×106). Twenty sequenceswere aligned to observe the convergence of mutations from Library 2.Eighteen clones showed consensus sequence; however, in thefollowing assay, we found that they had no obvious affinity to ang

MICROBEAD DISPLAY FOR DIRECTED EVOLUTION OF PEPTIDE 417VOL. 109, 2010

II. One reason for this is that the N and C termini are not as importantfor affinity as was previously assumed. Another reason is that thelibrary size screened (105) could not cover the sample diversity (109).In other words, we might have missed some beneficial mutants.

Small peptide molecules are more suitable for use as drugs thanmacromolecules, mainly owing to their high diffusion rates, increasedease of delivery, and low immunogenicity. Moreover, small moleculesare less susceptible to attack by endogenous enzymes than macro-molecules. Technically, a peptide can be engineered muchmore easilythan its membrane-located receptors by in vitro directed evolutionmethods. This is primarily due to high expression efficiency andsimple conformation. In the present research, tight binding wasobserved between two small peptides, which contained only 14 and8 amino acids. The mechanisms of affinities and conformations formacromolecule–macromolecule and macromolecule–micromoleculehave been elucidated and analyzed based on crystal structures.However, the mechanisms of affinities between peptides have seldombeen reported. In our study, we found that it was difficult to measurethe dissociation constant accurately between two peptides usingsurface plasmon resonance (SPR), mainly owing to their lowmolecular weights. Therefore, the development of accurate measure-ment of affinities, as well as the determination of peptide spatialconformations, will be very helpful in the directed evolution ofpeptides and design of peptide drugs.

ACKNOWLEDGMENTS

This work was financially supported in part by a Grant-in Aid (No.16360411 and 19360373) from the Ministry of Education, Culture,Sports, Science and Technology of Japan (MEXT). Funding to pay theOpen Access publication charges for this article was provided byMEXT.

References

1. Higuchi, S., Ohtsu, H., Suzuki, H., Shirai, H., Frank, G. D., and Eguchi, S.:Angiotensin II signal transduction through the AT1 receptor: novel insights intomechanisms and pathophysiology, Clin. Sci., 112, 417–428 (2007).

2. Nikiforovich, G. V. and Marshall, G. R.: 3D model for TM region of the AT-1receptor in complex with angiotensin II independently validated by site-directedmutagenesis data, Biochem. Biophys. Res. Commun., 286, 1204–1211 (2001).

3. Hunyady, L., Balla, T., and Catt, K. J.: The ligand binding site of the angiotensin AT1receptor, Trends Pharmacol. Sci., 17, 135–140 (1996).

4. Inoue, Y., Nakamura, N., and Inagami, T.: A review of mutagenesis studies ofangiotensin II type 1 receptor, the three-dimensional receptor model in search ofthe agonist and antagonist binding site and the hypothesis of a receptor activationmechanism, J. Hypertens., 15, 703–714 (1997).

5. Kato, R., Kunimatsu, M., Fujimoto, S., Kobayashi, T., and Honda, H.: AngiotensinII inhibitory peptide found in the receptor sequence using peptide array, Biochem.Biophys. Res. Commun., 315, 22–29 (2004).

6. Mazor, Y., Van Blarcom, T., Mabry, R., Iverson, B. L., and Georgiou, G.: Isolation ofengineered, full-length antibodies from libraries expressed in Escherichia coli, Nat.Biotechnol., 25, 563–565 (2007).

7. Dufner, P., Jermutus, L., andMinter, R. R.:Harnessing phage and ribosome displayfor antibody optimization, Trends Biotechnol., 24, 523–529 (2006).

8. Razai, A., Garcia-Rodriguez, C., Lou, J., Geren, I. N., Forsyth, C. M., Robles, Y., Tsai,R., Smith, T. J., Smith, L. A., Siegel, R. W., Feldhaus, M., andMarks, J. D.:Molecularevolution of antibody affinity for sensitive detection of botulinum neurotoxin typeA, J. Mol. Biol., 351, 158–169 (2005).

9. Smith, G. P.: Filamentous fusion phage: novel expression vectors that displaycloned antigens on the virion surface, Science, 228, 1315–1317 (1985).

10. Vaughan, T. J., Williams, A. J., Pritchard, K., Osbourn, J. K., Pope, A. R., Earnshaw,J. C., McCafferty, J., Hodits, R. A., Wilton, J., and Johnson, K. S.: Human antibodies

with sub-nanomolar affinities isolated from a large non-immunized phage displaylibrary, Nat. Biotechnol., 14, 309–314 (1996).

11. Mattheakis, L. C., Bhatt, R. R., and Dower, W. J.: An in vitro polysome displaysystem for identifying ligands from very large peptide libraries, Proc. Natl. Acad.Sci., 91, 9022–9026 (1994).

12. Fukuda, I., Kojoh, K., Tabata, N., Doi, N., Takashima, H., Miyamoto-Sato, E., andYanagawa, H.: In vitro evolution of single-chain antibodies using mRNA display,Nucleic Acids Res., 34, e127 (2006).

13. Tawfik, D. S. and Griffiths, A. D.:Man-made cell-like compartments for molecularevolution, Nat. Biotechnol., 16, 652–656 (1998).

14. Sepp, A. and Choo, Y.: Cell-free selection of zinc finger DNA-binding proteins usingin vitro compartmentalization, J. Mol. Biol., 354, 212–219 (2005).

15. Chen, Y., Mandic, J., and Varani, G.: Cell-free selection of RNA-binding proteinsusing in vitro compartmentalization, Nucleic Acids Res., 36, e128 (2008).

16. Ohuchi, S., Nakano, H., and Yamane, T.: In vitro method for the generation ofprotein libraries using PCR amplification of a single DNA molecule and coupledtranscription/translation, Nucleic Acids Res., 26, 4339–4346 (1998).

17. Kojima, T., Takei, Y., Ohtsuka, M., Kawarasaki, Y., Yamane, T., and Nakano, H.:PCR amplification from single DNA molecules on magnetic beads in emulsion:application for high-throughput screening of transcription factor targets, NucleicAcids Res., 33, e150 (2005).

18. Kojima, T., Yamane, T., and Nakano, H.: In vitro selection of DNA binding sites fortranscription factor, PhaR, from Paracoccus denitrificans using genetic library onmicrobeads and flow cytometry, J. Biosci. Bioeng., 101, 440–444 (2006).

19. Calhoun, K. A. and Swartz, J. R.: Energy systems for ATP regeneration in cell-freeprotein synthesis reactions, Methods Mol. Biol., 375, 3–17 (2007).

20. Rungpragayphan, S., Yamane, T., and Nakano, H.: SIMPLEX: single-molecule PCR-linked in vitro expression: a novel method for high-throughput construction andscreening of protein libraries, Methods Mol. Biol., 375, 79–94 (2007).

21. Gan, R., Yamanaka, Y., Kojima, T., and Nakano, H.:Microbeads display of proteinsusing emulsion PCR and cell-free protein synthesis, Biotechnol. Prog., 24,1107–1114 (2008).

22. Ali, M., Suzuki, H., Fukuba, T., Jiang, X., Nakano, H., and Yamane, T.:Improvements in the cell-free production of functional antibodies using cellextract from protease-deficient Escherichia coli mutant, J. Biosci. Bioeng., 99,181–186 (2005).

23 Nakano, H., Kawarasaki, Y., and Yamane, T.: Cell-free protein synthesis systems:Increasing their performance and applications, Adv. Biochem. Eng. Biotechnol., 90,135–149 (2004).

24. Schmidt, T. G., Koepke, J., Frank, R., and Skerra, A.: Molecular interactionbetween the Strep-tag affinity peptide and its cognate target, streptavidin, J. Mol.Biol., 255, 753–766 (1996).

25. Sambrook, J. and Russell, D. W.: Molecular Cloning: a Laboratory Manual3rd ed,Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001.

26. Folgori, A., Tafi, R., Meola, A., Felici, F., Galfré, G., Cortese, R., Monaci, P., andNicosia, A.: A general strategy to identify mimotopes of pathological antigens usingonly random peptide libraries and human sera, EMBO J., 13, 2236–2243 (1994).

27. Iannolo, G., Minenkova, O., Petruzzelli, R., and Cesareni, G.: Modifyingfilamentous phage capsid: limits in the size of the major capsid protein, J. Mol.Biol., 248, 835–844 (1995).

28. Steiner, D., Forrer, P., Stumpp, M. T., and Plückthun, A.: Signal sequencesdirecting cotranslational translocation expand the range of proteins amenable tophage display, Nat. Biotechnol., 24, 823–831 (2006).

29. Boder, E. T. and Wittrup, K. D.: Yeast surface display for screening combinatorialpeptide libraries, Nat. Biotechnol., 15, 553–557 (1997).

30. Sepp, A., Tawfik, D. S., and Griffiths, A. D.: Microbead display by in vitrocompartmentalisation: selection for binding using flow cytometry, FEBS Lett., 532,455–458 (2002).

31. Korndörfer, I. P. and Skerra, A.: Improved affinity of engineered streptavidin forthe Strep-tag II peptide is due to a fixed open conformation of the lid-like loop atthe binding site, Protein Sci., 11, 883–893 (2002).

32. Rolfe, B. and Eisenberg, M. A.: Genetic and biochemical analysis of the biotin lociof Escherichia coli K-12, J. Bacteriol., 96, 515–524 (1968).

33. Otsuka, A. J., Buoncristiani, M. R., Howard, P. K., Flamm, J., Johnson, C.,Yamamoto, R., Uchida, K., Cook, C., Ruppert, J., and Matsuzaki, J.: The Escherichiacoli biotin biosynthetic enzyme sequences predicted from the nucleotide sequenceof the bio operon, J. Biol. Chem., 263, 19577–19585 (1988).

34. Junttila, M. R., Saarinen, S., Schmidt, T., Kast, J., andWestermarck, J.: Single-stepStrep-tag purification for the isolation and identification of protein complexes frommammalian cells, Proteomics, 5, 1199–1203 (2005).

35. Schmidt, T. G. and Skerra, A.: The Strep-tag system for one-step purification andhigh-affinity detection or capturing of proteins, Nat. Protoc., 2, 1528–1535 (2007).