disclaimer - seoul national...
TRANSCRIPT
![Page 1: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/1.jpg)
저 시-비 리- 경 지 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.
l 저 터 허가를 면 러한 조건들 적 되지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 목적 할 수 없습니다.
경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.
![Page 2: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/2.jpg)
이 사 논
상 포-신경 포간 상 작용과
소포체 스트 스가 알 이 병
병인 에 미 는 향 연구
Studies on the mechanism of
astrocyte-neuron interactions and ER
stress in Alzheimer’s disease
pathogenesis
2014 8 월
울 자연과 원
공 동과 공
![Page 3: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/3.jpg)
i
상 포-신경 포간 상 작용과
소포체 스트 스가 알 이 병
병인 에 미 는 향 연구
지도 인 희
이 논 이 사 논 출함
2014 08 월
울 자연과 원
공 동과 공
이 사 논 인 함
2014 08 월
원 장 (인)
부 원장 (인)
원 (인)
원 (인)
원 (인)
![Page 4: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/4.jpg)
ii
Studies on the mechanism of
astrocyte-neuron interactions and ER
stress in Alzheimer’s disease
pathogenesis
Interdisciplinary Graduate Program
in Genetic Engineering
In Seoul National University
By Eun Sun Jung
August, 2014
Doctor’s Committee:
Professor Chairman
Professor Vice chairman
Professor
Professor
Professor
![Page 5: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/5.jpg)
iii
미 아 포 재 상 포는 알 이 병
(Alzheimer’s disease, AD) 병리 특징 나인
노인 (senile plaque) 주변에 공통 견 다.
상 포는 주변에 존재 는 신경 포 상 작용 면 ATP를
포함 여러 가지 신경아 달 질 분 다고 알 있지만
어떻게 신경 포 를 조 는지에 과
병인과 연 잘 알 있지 않다. 본 연구에 는
알 이 병에 신경아 달 질 나인 ATP 분 변
ATP가 신경 포에 어떻게 향 주고 그 인해 시냅스 가소 이
조 는지에 해 인 고자 다. 그 불어 신경아
달 질 분 시냅스 에 주요 역 담당 는 칼슘이
알 이 병에 소포체 스트 스를 도 다는 것이 알 있
에 소포체 스트 스가 알 이 병 원인 단 질인 베타
아 이드 (Aβ) 구 단 질 알 진 APP에 어떠 향
주는지 규명해 보고자 다. 알 이 병 원인 독
단 질인 Aβ에 해 신경아 달 질인 ATP 분 가
양 상 포에 증가 는 것 인 다. 이 게
분 ATP가 놀랍게도 Aβ처리에 해 해 시냅스
가소 과 이 있는 시냅스 신 달 구조
![Page 6: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/6.jpg)
iv
단 질들 , Field EPSPs (Field excitatory postsynaptic
potentials; fEPSPs), 신경 포 상돌 가시 (dendritic spine)
도에 해 purinergic 용체를 통해 보 는 효과를
나타냄 양 해마 신경 포에 규명 다. Aβ는
포 내 칼슘 항상 해 다고 알 있고 이런 칼슘
스트 스를 롯 여 여러 종 소포체 스트 스를 도했
APP가 ubiquitin-proteasome system 통해 격 게 분해
인 다. 그리고 알 이 병에 처럼 proteasome 이
망가 있는 상황에 는 APP가 소포체 스트 스를 았
소포체에 상 축 는 것 찰 다. 라
상 포 신경 포 사이 상 작용과 신경아 달 질
분 포 내 스트 스 상황에 proteasome
조 다면 알 이 병 료를 약 개 새 운
목 있 것 다.
----------------------------------------------------------------------------------------------
주요어: 알 이 병, 베타 아 이드, 시냅스가소 , ATP, APP,
ER stress, 칼슘, UPS
번: 2009-30843
![Page 7: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/7.jpg)
v
도 약어 목
3MA : 3-methyladenine
aCSF : artificial cerebrospinal fluid
Aβ : amyloid beta peptide
AD : Alzheimer’s disease
AMC : 7-amino-4-methylcoumarin
APP : amyloid precursor protein
ATPγS : adenosine 5’-[γ-thio] triphosphate
Baf : Bafilomycin
BACE : beta site APP-cleavage enzyme
DMEM : Dulbesco’s modifiec Eagle’s medium
EC50 : half maximal effective concentration
ECL : Enhanced chemiluminescence
ER : endoplasmic reticulum
ERAD : ER-associated degradation
fEPSPs : Field excitatory postsynaptic potentials
FBS : fetal bovine serum
HBSS : Hank’s Balanced Salt Solution
HRP : horse radish peroxidase
LTP : Long-term potentiation
NFT : neurofibrillary tangle
PFA : paraformaldehyde
PPADS : pyridoxal phosphate-6-azophenyl-2, 4’-disulphonic acid
sAPPα: soluble APP-alpha
TBS : theta burst stimulation
UPR : unfolded protein response,
UPS : ubiquitin-proteasome system
Veh : vehicle
![Page 8: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/8.jpg)
vi
목 차
.............................................................................. i
도 약어 목 ....................................................... iii
목차............................................................................ iv
그림 목 ........................................................... v
.............................................................................1
실험재료 법 .......................................................13
결과...........................................................................24
고찰...........................................................................54
결 ...........................................................................67
참고 헌 ....................................................................68
( ) ...............................................................84
![Page 9: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/9.jpg)
vii
그림 목
그림 1. Amyloid precursor protein 사과 ......................... 5
그림 2. 건강 추신경계에 상아 포 능.................. 6
그림 3. 상아 포 부 래 신 에 시냅스 과
시냅스후 시냅스 달 조 ......................................... 7
그림 4. 퇴행 신경질 과 UPS ................................................ 11
그림 5. 소포체에 일어나는 단 질 힘, 품질검사
신 달 ...................................................................... 12
그림 6. Primary astrocyte U373 포주에 Aβ42 처리
시 분 는 ATP ................................................ 30
그림 7. primary rat hippocampal neuron 에 Aβ42에
상돌 가시 도 감소에 ATP 효과
규명 ............................................................................. 31
그림 8. 해마 편에 Aβ42에 LTP 에
ATP 효과 규명 ........................................................ 32
그림 9. Primary hippocampal neurons에 Aβ42에 해
감소 시냅스 단 질에 ATP 효과 인 ............. 35
그림 10. Aβ42에 해 감소 는 시냅스 단 질에
![Page 10: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/10.jpg)
viii
ATP 효과가 P2 purinergic 용체를 통함
PPADS를 이용 여 규명 ............................................. 37
그림 11. 포 내 칼슘증가가 APP 사과 에 미 는 향
인 ............................................................................. 45
그림 12. 소포체 스트 스가 APP 분해를 도함 인 ...... 47
그림 13. APP가 소포체 스트 스 상황에 APP가
아좀에 특이 인 경 를 통해 분해 인 .. 49
그림 14. 포 내 칼슘 증가에 APP 퀴틴 인 ... 50
그림 15. 소포체 스트 스가 소포체 연 단 분해과
통해 APP 안 조 함 규명........................... 51
그림 16. 소포체 스트 스 상황에 아좀 해 시
APP가 소포체에 축 인 ................................... 53
![Page 11: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/11.jpg)
1
알 이 병 (Alzheimer’s disease; AD) 장 간에 걸
시냅스 신경 포 능 사멸에 인 는 인
퇴행 신경질 매 자 50~60%가 이에 해당 다.
임상 인 특징 는 억과 단, 언어능 등과 같 지 능
진 인 감퇴 일상생 능 , 인격, 행동양상 장애 등이 알
있다. 달과 불어 근 평균 명이 증가 에 라
부분 노인 에 병 게 는 특징과 맞 알 이 병
앓고 있는 자 는 계속 증가 고 있는 추 이다 (1).
알 이 병 가장 인 병리 특징 상
과다생 과 불충분 거 포 에 베타 아 이드 (amyloid
beta peptide; Aβ)가 축 어 나타나는 노인 (senile
plaque)과 포 내 tau 단 질 과인산 인 신경 덩어리
(neurofibrillary tangle; NFT)가 있다 (2). Aβ는 베타-
시크리 아 (β-secretase, BACE1) 감마-시크리 아 (γ-
secretase complex)에 해 아 이드 구 단 질 (amyloid
precursor protein; APP)이 차 잘리면 생 다
(3)(그림 1).
Part 1. 신경아 달 질인 ATP가 Aβ에 시냅스
![Page 12: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/12.jpg)
2
가소 변 에 미 는 향 연구
알 이 병 주요 병리 특징인 노인 주변에 는
미 아 포 재 상 포, 그리고 퇴행
신경 포들이 찰 다고 보고 었다 (4, 5). 상 포는
추신경계를 구 는 포 에 가장 많 존재는
주요 신경 포 종 이다 (6). 상 포는 주변에
존재 는 신경 포, 뇌 포 그리고 다른 신경 포들 요
트 포 신경 포 구조 사를 돕는 능뿐만 아니라
뇌에 신경 조 주도 있다. 상 포
주요 능 나는 신경 포 시냅스 간극에 신경 달 질
는 신경아 달 질들 거나 분 는 것이다 (그림 2)
(7). 신경아 달 질 신경 포 부 분 는 질
상 포는 직 glutamate, D-serine, ATP 같
신경아 달 질들 분 여 신경 포 용체를
있다 (8). 상 포에 분 는 glutamate는 신경 포
분 에 많 효과를 가함이 알 있는 면에 D-serine
NMDA 용체가 매개 는 시냅스 가소 조 에 여 다는
보고가 있다 (그림 3) (9, 10). 그리고 상 포 부 분
ATP는 요 포 신 달 질이면 직 는
사산 인 adenosine 통해 시냅스 달 조 는 purinergic
용체 내 리간드 작용 다고 알 있다 (그림 3) (11,
![Page 13: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/13.jpg)
3
12). 상 포 래 ATP는 시냅스 후 purinergic 용체
통해 mEPSCs (miniature EPSPs) 진폭 증가시키는
면에 편 는 해마부 에 GABAergic 뉴런이 매개 는
이종 시냅스 에 여 다는 보고가 있다 (13, 14). 이는
상 포가 여러 종 상아 달 질 분 여 신경
를 여러 법 조 있 것 상 있고
상아 달 질 신경 포 는 시냅스에 라 다른
역 있 것 사료 다.
상 포는 알 이 병 모델 마우스 뇌 Aβ가
축 어있는 노인 주변에 견 고 이는 상 포
노인 사이에 요 상 작용이 존재 다는 것 미 다 (15,
16). 그러나 상아 달 질, 그 에 도 ATP가
알 이 병 병인 에 어떤 향 미 는 지에 해 는
명 게 지지 않았다. 라 본 연구에 는 ATP가 시냅스
에 향 미 는 지에 해 알아보고자 다.
본 연구에 는 Aβ 있는 시냅스 변 가 상아
달 질인 ATP에 해 보 다는 것 인 다.
구체 살펴보면, Aβ1-42 에 해 도 시냅스 단 질들
양, 상돌 가시 (dendritic spine) 도 그리고 장 상승 작용
(Long-term potentiation; LTP) 포함 시냅스 가소 해
변 가 ATP에 해 복구 는 것 실험 증명 다.
![Page 14: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/14.jpg)
4
나아가 본 연구에 는 ATP 이 같 보 인 역 이 P2
purinergic 용체 신 달 경 를 통해 매개 추가
인 다. 이 같 여러가지 결과들 종합해 보았 상아
달 질 나인 ATP가 신경독 는 Aβ가 원인이 는
여러 시냅스 능 장애들에 여 보 인 역 다는 것
규명 다. 라 상아 달 질인 ATP를 통
상 포 신경 포 사이 상 작용이 시냅스 조 에 매우
요 역 것 는 이다.
![Page 15: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/15.jpg)
5
(Vingtdeux et al. Front. Physiol., 05 July 2012)
그림 1. Amyloid precursor protein 사과
![Page 16: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/16.jpg)
6
(Acta Neuropathol (2010) 119:7–35)
그림 2. 건강 추신경계에 상아 포 능
![Page 17: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/17.jpg)
7
(Philip G. Haydon et al, Physiological Reviews, 1 July 2006)
그림 3. 상아 포 부 래 신 에 시냅스 과
시냅스후 시냅스 달 조
![Page 18: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/18.jpg)
8
Part 2. 소포체 스트 스가 베타 아 이드 구 단 질
조 는 연구
칼슘 뇌에 일어나는 다양 일들에 해 매우 요 역
다는 것 잘 알 있다. 이런 칼슘이 알 이 병 자
뇌에 보이는 퇴행 신경 포에 그 양이 증가 어 있다는
보고가 있다 (17). 베타 아 이드 구 단 질 (amyloid
precursor protein; APP) 내재 막 단 질 알 이 병
병인 에 요 역 다. 여러 보고들 통해 칼슘
항상 불균 이 APP 사과 에 향 다는 것이
알 있다 (18, 19). 이런 칼슘과 APP 사과 간 요 에도
불구 고 이 부 인 작 많이 알 있지 않다.
퀴틴- 아좀 시스 (ubiquitin-proteasome system;
UPS)는 진핵 포에 단 질 포 내 주요
경 이면 (20) 알 이 병 뿐만 아니라 헌 병, 킨슨병,
리 병 그리고 루게릭병 포함 여러 종 퇴행
신경질 과도 이 있다는 것이 보고를 통해 알 진
있다 (그림 4) (21). 근 규명 증거들 상 인 단 질
힘과 집이 다양 퇴행 신경질 공통 인 원인인 것과
동시에 병리 인 변 를 보인다고 시 고 있다. 퀴틴
알 이 병 가지 주요 병리 특징인 노인 과
신경 덩어리 모 에 축 어 있 이 보고 었다 (22, 23).
![Page 19: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/19.jpg)
9
몇몇 연구자들 아좀 이 알 이 병 자 뇌에
변질 어있 인 고 이 결과를 통해 아좀
시스 상 인 조 이 알 이 병 생에 게
계 어 있 시 다 (24, 25). 퀴틴- 아좀
시스 (UPS) 소포체 스트 스에 해 매개 는 잘못
진 단 질들 분해에 매우 요 역 다 (26). 이
같 상 인 소포체 단 질들 증가는 매우 신속히 ‘ 히지
않 단 질 ’ (unfolded protein response, UPR)과 소포체
연 단 분해 과 (ER-associated degradation; ERAD)
시킨다고 알 있다 (27, 28) (그림 5). 상 인 칼슘
항상 소포체 스트 스 능 를 도 는 요인
나이다 (29).
APP 는 소포체에 만들어 진 뒤 분 경 를 통해 원 질막
이동 뒤 알 -시크리 아 에 해 잘 지면 신경보 질
가진 sAPPα (soluble APP-alpha)를 는 면, 신경독
는 Aβ는 소포체 골지/후 골지망에 베타-시크리 아
감마-시크리 아 차 인 단에 해 생 다 (30, 31).
그러므 APP 사과 과 포 내 에 연구는
알 이 병 병인 히는데 있어 요 다. 근
연구들 상 인 칼슘 항상 포함 소포체 스트 스가
APP 사과 에 향 미 뿐만 아니라 알 이 병
![Page 20: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/20.jpg)
10
심 인 병리 상임 시사 다 (32). 그 지만 소포체
스트 스 상황에 APP 사과 과 UPS 경 사이 계는
진 가 미 다. 본 연구에 는 이러 상 인 포 내
칼슘 양 증가 같 소포체 스트 스 상황에 APP 가 APP
퀴틴 를 조 는 효소 상 작용에 해 UPS 를 통 여
매우 극 인 분해를 겪게 인 다.
![Page 21: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/21.jpg)
11
Neuron, Vol. 40, 427–446, October 9, 2003
그림 4. 퇴행 신경질 과 UPS
![Page 22: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/22.jpg)
12
Kidney International (2010) 77, 187–193
그림 5. 소포체에 일어나는 단 질 힘, 품질검사 신 달
![Page 23: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/23.jpg)
13
실험 재료 법
Part 1. 신경아 달 질인 ATP 가 Aβ에 시냅스
가소 변 에 미 는 향 연구
1. 실험에 이용 실험동
Primary hippocampal neuronal culture를 해 암컷 Sprague-
Dawley rats (KOATECH, Korea) 18일 아 (embryos;
E18) 임신 ICR mice 부 출생 날 (postnatal day 1;
P1) 새끼 를 이용 여 primary hippocampal neuronal
culture astrocyte culture를 다. field EPSPs
(fEPSPs)를 여 3~4개월 컷 C57BL/6 mice를
사용 다.
2. 포주 (Cell lines) 포 양
포는 human astrocyte 포주인 U373 사용 고 0.1 mg/ml
penicillin/streptomycin (P/S; Sigma, MO, USA)과 10% fetal
bovine serum (FBS; Hyclone, UT, USA)이 포함 Dulbesco’s
modifiec Eagle’s medium (DMEM; Hyclone, UT, USA)에
37℃, 5% CO2 조건에 양 다. P1 ICR mice
hippocampus cortex 부분 분리 여 잘게 자른 다 Hank’s
![Page 24: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/24.jpg)
14
Balanced Salt Solution (HBSS; WelGENE, Korea)에 후
0.5% trypsin (2.5% trypsin; Sigma, MO, USA) 나
포 분리시키는 과 거 다. 분리 포는 포 를
후에 poly-D-lysine (Sigma, MO, USA) 해 plate에
아 다. Astrocyte culture는 cortex 부 분리 포를 U373
포 동일 조건에 양 고 hippocampal neuron
0.1mg/ml PS, L-glutamine (0.5 mM), B27 (Invitrogen,
California, USA)이 포함 neurobasal medium (Invitrogen,
California, USA)에 양 다.
3. 시약 시약처리
ATP, adenosine 5’-[γ-thio] triphosphate (ATPγS), PPADS
(pyridoxal phosphate-6-azophenyl-2, 4’-disulphonic acid; a
P2X purinergic receptor antagonist)는 Sigma에 구입 고
Aβ1-42는 American Peptide (Sunnyvale, CA, USA)에
구입 다. Aβ1-42는 U373 포 astrocyte에 각각 2 는 10,
2 는 4 μM 농도 3시간 처리 고 primary hippocampal
neuron에는 2 μM 48시간 동안 처리 다. ATP ATPγS
그리고 PPADS는 Aβ1-42 처리 30분 에 미리 처리 다.
![Page 25: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/25.jpg)
15
Primary neuron에 시약 처리 에는 존 양 미 어
거 고 새 양 미 어 에 종 처리 농도 시약 희
다 추가 는 법 사용 다.
4. 생리
(본 실험 포항공 훈 님 실험실에 진행 다)
Field EPSPs (fEPSPs)를 3~4개월 컷 C57BL/6 부
얻 해마 편 (400 μm 께)에 다. 해마 조직
37℃ 산소 (95% O2, 5% CO2) 인공 뇌척 액 (artificial
cerebrospinal fluid ; aCSF)에 1시간 이상 고 계속해 산소
aCSF를 시 주었다. fEPSPs는 해마 CA1 striatum
radiatum 부 에 microelectrode를 이용 여 다. LTP는
5번 0.1Hz theta burst stimulation (TBS) 도 다.
데이 는 Axopatch 200A amplifer Digidata 1200 (Axon
Instrument)를 통해 얻었다.
5. Western Blot
단 질 양 해 시약 처리가 난 포에 RIPA
buffer를 이용 여 단 질 추출 고 BCA 법 량
![Page 26: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/26.jpg)
16
다. 량 후 20~30 μg 단 질 8% SDS-PAGE gel에
동 고 PVDF membrane (millipore, MA, USA)에 4℃에
90분간 transfer 후 1시간 동안 5% skim milk 실 에
blocking 다. 이 후 보고자 는 단 질에 특이 인 1차
항체를 4℃에 루 동안 시킨 후 horse radish peroxidase
(HRP)가 결합 2차 항체를 상 에 1시간 동안 처리 다.
단 질에 결합 항체는 Enhanced chemiluminescence (ECL)
solution (GE Healthcare) 이용 여 LAS-3000 (Fugi photo
Film, Japan) 분 다. 사용 1차 항체는 다 과 같다.
Anti-NMDAR2A antibody (1:2000; Millipore, MA, USA), anti-
NMDAR1 antibody (1:2000; Cell Signaling Technology, MA,
USA), anti-PSD-95 antibody (1:2000; Abcam), anti-β-actin
(1:2000; Sigma-Aldrich, MO, USA), and anti-tubulin antibody
(1:2000; Applied Biological Materials).
6. ATP
U373 포 astrocyte에 분 는 ATP를 해 ATP
determination kit (A22066; Invitrogen)를 사용 다.
Luciferase가 substrate인 luciferin 자르 해 ATP가
![Page 27: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/27.jpg)
17
사용 는 원리를 이용 여 ATP를 는 법 시약 처리가
난 후 양 포 지 100 ㎕를 kit에 공 는 용액과
시킨 다 luminometer (Infinite M200, Tecan)
분 다.
7. Phalloidin 염색
신경 포 상돌 가시 (dendritic spine) 도 도를
인 해 phalloidin 염색 다. 시약 처리 후 PBS
번 척 고 4% paraformaldehyde (PFA) 실 에 10분간
고 뒤 0.1% Trioton X-100 3~5분간 실 에
permeabilization시킨다. 그 다 PBS 다시 척 고
는 Alexa Fluor 488-phalloidin fluorescent Phallotoxin
(Invitrogen) 상 에 20분간 염색 다. 염색 포는
공 이 미경 (LSCM; Olympus Fluoview 300)
분 다.
8. 상돌 가시 (Dendritic Spine) 도 분
공 이 미경 찍 신경 포 Phalloidin 염색
사진에 신경 포 상돌 부 일 이 내에 존재 는
![Page 28: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/28.jpg)
18
spine 개 를 어 평균값 계산 여 조군과 실험군 차이를
다.
9. 통계처리
모든 결과는 mean ± SEM 값 나타내었다. 모든 통계
분 GraphPad Prizm 5를 사용 고 그룹 간 는 one-way
ANOVA Tukey’s multiple-comparisons test를 이용 여
분 다. 통계 인 분 p값이 0.05 이 일 경우
미 다고 다.
![Page 29: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/29.jpg)
19
Part 2. 소포체 스트 스가 베타 아 이드 구 단 질
조 는 연구
1. 포주 (Cell lines) 포 양
포는 CHO, 7w-PSML, HEK293 포주를 사용 고 0.1
mg/ml penicillin/streptomycin (P/S; Sigma, MO, USA)과 10%
fetal bovine serum (FBS; Hyclone, UT, USA)이 포함
Dulbesco’s modifiec Eagle’s medium (DMEM; Hyclone, UT,
USA)에 37℃, 5% CO2 조건에 양 다. 7w-PSML 포는
wild type APP mutant PS (M146L)이 과 어있는 CHO
포 UC San Diego David Kang 부 공 았다.
2. 시약 시약 처리
A23187, thapsigargin, tunicamycin, MG132, lactacystin,
bafilomycin, NH4Cl, 3-methyladenine (3MA)는 sigma 부
구입 다. A23187, thapsigagin, tunicamycin 12시간
동안 처리 고 MG132, lactacytin, bafilomycin, NH4Cl,
3MA는 다른 시약 처리 30분 에 미리 처리 다.
3. Western Blot
실험 법 Part 1 것과 동일 고 사용 1차 항체는 다 과
같다.
APP sAPPα를 인 해 각각 Anti-22C11 antibody
![Page 30: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/30.jpg)
20
(Millipore), anti-6E10 antibody (Signet)를 사용 다. 그
이외에 anti-sAPPβ antibody (Covance), anti-HA antibody
(Cell signaling), anti-USP25 antibody (Santa Cruz), anti-HRD1
antibody (Abgent), anti-Calnexin antibody (Enzo), anti-β-
actin antibody 그리고 anti-tubulin antibody (Sigma-Aldrich)를
사용 다.
4. 포 생존도
포 생존도는 MTT 분 통해 다. 시약 처리가 난
96well plate에 2.5 μg/mL MTT가 포함 phenol red가
없는 양액 50 ㎕ 꾸어 뒤 37℃에 2시간 동안
양 다. 이 후 140 ㎕ isopropanol 첨가 여 37℃에
30분간 양 고 실 에 30분간 뒤 plate reader
(POWER-XS; Bio-TEK)를 이용 여 540nm에 도를
여 분 다.
5. Transfection
CHO 포는 60 mm 양 시에 24시간 동안 키운 다
lipofectamin LTX (Invitrogen)를 이용 여 HA-ubiquitin cDNA
![Page 31: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/31.jpg)
21
벡 를 transfection 다. Opti-MEM (Invitrogen)에
cDNA transfection 용액 상 에 30분간 합 뒤 Opti-
mem 양액 갈아 CHO 포에 첨가 다. 이 후 4시간
지난 다 serum이 포함 양액 존 양액 양만큼 첨가 고
다시 2시간 뒤에는 원래 포 양액 꿔 다.
6. 면역침강법 (Immunoprecipitaion)
Ubiquitination이 APP를 인 해 면역침강법 이용
다. 시약 처리가 난 포를 1% CHAPS buffer 단 질 추출
다 BCA 량 여 400 μg 단 질과 Flag antibody
함께 4℃에 루 동안 시킨 후 protein A/G bead를 첨가
여 4℃에 시간 동안 추가 시킨다. 원심 분리 여
protein A/G bead를 가라앉힌 다 bead만 남 고 조심스럽게 상
액 버리고 4~5회 1% CHAPS 척 고 2xSB를 후
인 다 western blot 행 다.
7. 면역 포염색 (Immunocytochemistry)
CHO 포를 염색용 plate에 키운 후 시약 처리 고 PBS 척
후, 4% PFA 실 에 20분간 고 다. 그리고 0.1% Triton
X-100 permeabilization 고 5% BSA가 들어간 PBST
blocking 다. 이 후 1차 항체 함께 4℃에 overnight 고
![Page 32: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/32.jpg)
22
척 다 Alexa-fluorescent가 붙 2차 항체를 실 에 시
간 동안 시 다. 다 척 고 4-6-diamidino-2-
phenylindole (DAPI) 핵 염색 고, 공 미경 분
다.
8. 20S proteasome
20S proteasome 는 20S proteasome activity assay kit
(APT280, Millipore) 사용 를 참고 여 다. 간략 게,
Proteasome에 해 kit에 공 는 질인 LLVY-AMC가
뛰는 7-amino-4-methylcoumarin (AMC)잘 지게 면 그
는 원리이다. Protein sample (20 μM) 37°C에
proteasome substrate, LLVY-AMC, 시킨 이후
fluorometer (POWER-XS; BIO-TEK)를 이용 여 360/460nm
에 도를 다.
9. Aβ ELISA
7w-PSML 포 양 양액 부 분 Aβ40과 Aβ42
양 sandwich ELISA kit (Human Aβ immunoassay kit ;
IBL)를 사용 여 다. 시약 처리가 난 후 양 양액
거 뒤 1500g 5분간 4℃에 원심분리 여 포 찌꺼 들
거 고 100㎕를 에 사용 다. 이 난 뒤에 ELISA
plate reader (POWER-XS; Bio-TEK)를 이용 여 450nm에
![Page 33: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/33.jpg)
23
도를 여 분 다.
10. RNA 분리 Real-time PCR
HEK293 포 부 체 RNA 분리는 Qiagen RNeasy kit
(Qiagen) 이용 다. 분리 RNA는 량 후 동일 양 (2 μ
g) Maxtime RT Premix_Oligo dT primer kit (intron
biotechnology, Seoul, Korea)를 사용 여 역 사 다 cDNA
변 다. 변 cDNA는 mRNA 양 인 해
ABI stepone 2.1 (Applied Biosystems, Foster City, CA, USA)
이용 여 Real-Time PCR 행 다. Real-time PCR에 사용
primer는 APP (forward : GCAGTGAGAAGAGTACCAAC /
reverse : ACCTCATCACCATCCTCATC), actin (forward :
AGCCTCGCCTTTGCCGA / reverse : CTGGTGCCTGGGGCG)이
다. Actin gene endogenous 조군 RNA 양
는데 사용 다.
11. 통계처리
모든 결과는 mean ± SEM 값 나타내었다. 모든 통계 분
GraphPad Prizm 5를 사용 고 그룹 간 는 one-way
ANOVA Tukey’s multiple-comparisons test를 이용 여 분
다. 통계 인 분 p값이 0.05 이 일 경우 통계
미 다고 다.
![Page 34: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/34.jpg)
24
결 과
Part 1. 신경아 달 질인 ATP가 Aβ에
시냅스 가소 변 에 미 는 향 연구
1. primary astroctye U373 cell line에 Aβ42에
ATP 분 증가
상 포에 자연히 생 는 칼슘 진동 상아 달 질인
glutamate 분 를 도 다는 것이 알 있고 Aβ
양 상 포 칼슘 신 달 동 해 다는 보고가
있다 (33, 34). 라 , Aβ42 처리가 1차 양
상 포 상 포 포주인 U373 포에 ATP 분 에
향 주는지 인해 본 결과, U373 포 1차 양
상 포에 모 Aβ42 처리 시 분 는 ATP 양이
증가 는 것 인 다 (그림 6A,B). 이를 통해 Aβ42에 해
상 포 부 상아 달 질인 ATP 분 가
증가 다는 것 규명 다.
2. Aβ42에 상돌 도 감소에 ATP 보
![Page 35: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/35.jpg)
25
효과
상돌 도는 시냅스 가소 , 습 그리고 억과
이 있 에 (35) 1차 양 해마 신경 포에 상돌
도에 ATP 효과를 알아보았다. 이 보고에 다양
포주 조직에 포 ATP 양이 nM에 μM 지
다는 것이 알 진 있다 (36). ATP 효과 인
농도 (EC50 ; half maximal effective concentration)가 10μM ~
100μM 보고 있어 본 실험에 는 10μM ATP를 처리해
주었다 (37-39). 양 해마 신경 포에 Aβ42 (2μM)를
48시간 동안 처리 뒤 상돌 를 찰 해 phalloidin
염색 뒤 분 결과, Aβ42에 해 상돌 도가
군과 했 격히 감소 는 것 인 다 (그림 7).
면 미롭게도 ATP (10 μM)를 Aβ42 처리 30분 에
처리해 그룹에 는 Aβ42에 해 감소 었 상돌 도가
군 회복 는 것 찰 다. 이를 통해 ATP가
Aβ42에 상돌 도 감소에 보 인 효과를 보임
알 있었다.
3. Aβ42에 해 도 장 상승 작용 (Long-term
![Page 36: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/36.jpg)
26
potentiation; LTP) 감소에 ATP 회복 효과
LTP 상돌 도는 시냅스 가소 과 있다는 것이 알
있다 (40-42). 이 연구들에 합 Aβ 처리가 in vitro
in vivo 경에 해마 LTP를 해 다는 것이 보고 었다 (43,
44). ATP가 Aβ42에 해 도 LTP 해에 해 보 인
효과를 보이는지 알아보 해 해마 편 이용 여 Aβ42 (200
nM)를 처리 여 LTP를 다. 해마 편에 TBS (theta
burst stimulation) LTP를 도 Aβ42가 처리
조건에 는 이 보고 동일 게 LTP가 크게 것
인 다 (그림 8). 그러나 Aβ42 ATP를 함께 처리해 주었
경우에는 Aβ42에 LTP감소를 있었고, 이
군 LTP가 회복 는 것 인 다. 라 이
결과를 통해 ATP가 Aβ42에 여 보 인 효과를
있 알 있었다. 이런 ATP 보 인 역 TBS 처리 후
(10분) 그리고 후 (60분) 단계에 모 찰 다 (그림
8B, C). 다 농도 Aβ42 (200 nM)에 LTP가 가
찰 것 탕 앞 인했 상돌 도에 효과를
농도 Aβ42에 도 일어나는지 인해본 결과, 상했
농도 Aβ42 처리에 해 도 매우 격 게 해마 상돌
![Page 37: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/37.jpg)
27
도가 감소 는 것 인 고, 불어 ATP 보 인 역
재 인 다 (그림 8D-F). 이 결과를 통해 ATP
인 효과 함께 Aβ42가 농도에 도 시냅스 를
조 있 규명 다. 본 실험 포항공 훈 님
연구실에 행 다.
4. Aβ42에 시냅스 단 질들 감소에 ATP 회복
효과를 해마 신경 포에 규명
ATP가 Aβ42에 해 감소 LTP에 여 보 인 능
다는 것 인 에 시냅스 가소 조 다고
알 진 NMDA 용체 (45, 46) 뇌 특이 구조단 질
(scaffolding protein)인 PSD-95 같 시냅스 단 질들 양이
변 는지를 알아보고자 다. PSD-95 단 질 NMDA
용체 닛인 NR2A NR2B 상 작용 여 시냅스
신 달과 가소 조 다고 알 있다 (47, 48). NMDA
용체 2A (NR2A) PSD-95 양 해마 신경 포 (21 DIV)에
Aβ42 (2 μM)를 48시간동안 처리했 게 감소 는
것 인 다 (그림 9A-C). 지만 NMDA 용체 1
(NR1) 양 변 지 않았다. 그 다면 ATP가 Aβ42에 해
![Page 38: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/38.jpg)
28
시냅스 단 질이 감소 신경 포를 보 있는지 알아보고자
Aβ42를 처리 30분 이 에 ATP (10 μM) 처리 여
인해 보았다. 그 결과 ATP를 Aβ42 처리 이 에 처리
그룹에 는 Aβ42 처리시에 찰 NR2A PSD-95
단 질 감소가 보이지 않 인 다 (그림 9). ATP는 생체
내에 가 분해 어 adenosine과 같 사산 만들어 내
에 앞 인 ATP 효과가 ATP 효과인지 아니면
ATP 사산 에 효과인지를 명 게 규명 해
가 분해가 지 않는 상사 ATP (ATP analog)인 ATPγS를
가지고 동일 실험 행 다. 실험결과, 해마 신경 포에
ATPγS (20μM)를 Aβ42처리 30분 에 처리 ATP가
보여주었 Aβ42에 NR2A PSD-95 단 질 감소에
보 효과가 동일 게 찰 인 다 (그림 9E, F).
라 이 결과를 토 ATP가 그것 사산 이 아닌 ATP
자체 Aβ42에 해 감소 신경 포 시냅스 단 질에
보 능 함 욱 실 게 증명 있었다.
5. P2 purinergic 용체를 통 여 ATP가 Aβ42에
시냅스 단 질들 감소에 여 보 능 나타냄 규명
![Page 39: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/39.jpg)
29
포 ATP는 P2 purinergic 용체를 통 여 포 내
신 달에 요 역 다 (49). P2 purinergic 용체는
다시 이 P2X 리간드 개폐 이 채 (ligand-gated ion
channel)과 사 P2Y G단 질 결합 용체 (G-protein coupled
receptor) 나 어진다 (50, 51). 해마 신경 포는 P2X P2Y
purinergic 용체 모 를 다. PPADS는 택 이지는
않 나 범 지도 않 P2 용체 항 P1 용체를
억 지는 않는다 (52, 53). ATP가 Aβ42에 해 매개 는
시냅스 단 질들 감소에 보 작이 purinergic 용체를
통 신 달에 해 일어나는지 알아보고자 해마 신경 포에
ATP를 처리 에 PPADS (50 μM)를 처리 다. 그 결과
ATP가 Aβ42에 해 도 NR2A PSD-95 같 시냅스
단 질 감소를 보 라도 (그림 9A) PPADS를 처리 는
조건에 는 ATP NR2A PSD-95 단 질에 보 인
효과가 억 는 것 인 다 (그림 10A, lane 4). 이 결과를
통해 ATP가 P2 purinergic 용체 신 달 통해
Aβ42에 해 감소 시냅스 단 질들 보 함 좀 명 게
증명 있었다.
![Page 40: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/40.jpg)
30
그림 6. Primary astrocyte U373 포주에 Aβ42 처리 시
분 는 ATP
(A) Primary astrocyte 에 Aβ42 (2 는 4 μM)를 3 시간
처리 후 분 ATP 를 했 4μM Aβ42 처리 시
게 ATP 분 량이 증가함 인
(B)U373 포주에 Aβ42 (2 는 10 μM) 를 3 시간 동안 처리
시 분 는 ATP 양이 증가함 인 양 양액에
존재 는 포 분 ATP luciferin-luciferase
assay 를 통해 다. 3 번 독립 인 실험 분 함
**p<0.01 versus vehicle (control) group. Vcl, Vehicle
![Page 41: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/41.jpg)
31
그림 7. primary rat hippocampal neuron 에 Aβ42에
상돌 가시 도 감소에 ATP 효과 규명
Primary rat hippocampal neurons (21 DIV) 에 Aβ42 (2μM,
48시간)를 처리 30분 에 ATP (10 μM)를 처리 는
미처리 다.
(A) 상돌 가시를 찰 해 phalloidin Alexa-488
(녹색) 이용 여 염색함
(B) 그림 7(A)에 흰색 시 역 이미지
(C) 상돌 분 내 상돌 가시 를 량
**p<0.01 versus vehicle (control) group; #p<0.05 versus
Aβ42 처리군. Scale bar, 10μm.
![Page 42: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/42.jpg)
32
![Page 43: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/43.jpg)
33
그림 8. 해마 편에 Aβ42에 LTP 에 ATP 효과
규명
(A) fEPSPs는 해마 CA1 부 에
Aβ42 (200 nM)는 TBS 도 LTP를 해 는 면 ATP
(5 μM) 함께 처리시에는 Aβ42에 LTP 해를 보 함.
각각 fEPSP slope (상) fEPSP 그래 (상)에 검 과 빨강색
살 시 시간 LTP 평균 값 나타내는 trace ( )
회색막 는 TBS처리 20분 동안 aCSF (control) 는 시약 (A
β42, Aβ42+ATP, ATP)를 주입 시간 나타냄
(B, C) TBS 처리 후 각각 10분 (B)과 60분 (C) fEPSP
. *p<0.01 or ***p< 0.001 versus control group; #p<0.05
![Page 44: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/44.jpg)
34
versus Aβ42처리군
(D) 농도 Aβ42 (200 nM)가 상돌 가시 도에 미 는 향
인
Primary rat hippocampal neurons (21 DIV)에 Aβ42를 48시간
동안 처리 30분 에 ATP를 처리 는 미처리함 Phalloidin
Alexa-488 (녹색) 상돌 가시 염색함
(E) D에 시 지역 이미지. ***p <0.001
versus vehicle (control) group; ###p<0.001 versus Aβ42
처리군. Scale bar, 10 μm.
![Page 45: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/45.jpg)
35
그림 9. Primary hippocampal neurons에 Aβ42에 해 감소
시냅스 단 질에 ATP 효과 인
Primary hippocampal neurons (21 DIV)에 Aβ42를 48시간동안
처리 30분 에 ATP를 처리 는 미처리함
(A) Western blotting 통해 NR2A, PSD-95, NR1 양
인함 β-actin loading control 사용. 살 PSD-95를
나타내고 별 는 특이 인 드를 나타냄
![Page 46: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/46.jpg)
36
(B–D) NR2A (B), PSD-95 (C), 그리고 NR1 (D) 량
Aβ42에 해 감소 NR2A PSD-95 양이 ATP 처리에
해 보 는 면 NR1 변 없 인 **p<0.01,
***p<0.001 versus vehicle (Veh; control) group (n=6);
#p<0.05, ##p<0.01 versus Aβ42 처리군 (n=6).
(E)Aβ42에 시냅스 단 질 감소에 ATPγS (20
μM) 효과 **p<0.01, ***p<0.001 versus vehicle (control)
group; #p<0.05 versus Aβ42 처리군
![Page 47: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/47.jpg)
37
그림 10. Aβ42 에 해 감소 는 시냅스 단 질에 ATP
효과가 P2 purinergic 용체를 통함 PPADS 를 이용 여 규명
(A) Primary hippocampal neurons 에 Aβ42 (2 μM) 처리
30 분 에 ATP 를 PPADS (50 μM ; P2 purinergic 용체
항 ) 함께 처리 거나 단독 처리함 Western Blot
행 여 NR2A, PSD-95, NR1 양 인함. 살 는 PSD-
95 특이 인 드를 나타냄. Tubulin loading control
사용함
(B, C) NR2A (B) PSD-95 (C) western blot 결과 부
량 *p< 0.05 versus vehicle (Veh) group; #p<0.05 versus Aβ
42 처리군; &p<0.05 versus Aβ42 ATP를 함께 처리 군
![Page 48: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/48.jpg)
38
Part 2. 소포체 스트 스가 베타 아 이드 구
단 질 조 는 연구
1. 포 내 칼슘 증가가 APP 단 질 사과 에 미 는
효과
A23187 잘 알 진 칼슘 ionophore 포 내 칼슘
증가시키 목 실험에 리 사용 는 시약이다. 칼슘
스트 스가 APP 사과 에 향 주는지 알아보고자 7w-PSML
포에 A23187 (1μM) 12 시간동안 처리 다. 7w-PSML
포는 야생 (wild type) APP 돌연변이 (mutant)
presenilin-1 (M146L) 안 고 있는 Chinese
hamster ovary (CHO) 포이다. 그러므 이 포는 APP 함께
APP 사 산 인 Aβ40 과 Aβ42 를 찰 에 효과 인
포이다. A23187 처리 7w-PSML 포는 APP 를 포함 여
sAPPα, sAPPβ가 50% 이상 군과 여 감소 것
인 다 (그림 11A, B). Aβ40 과 Aβ42 양도
A23187 처리시 매우 크게 감소 는 것 찰 다 (그림 11C).
게다가 낮 농도 A23187 (500 nM)과 시약 처리 후 짧 시간
이내에 APP 가 매우 격히 감소함 인 다 (그림 11D).
A23187 포 독 효과를 인 해 MTT 분 해본
결과, A23187 포 생존 에 향 주지 않 며 앞 실험
![Page 49: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/49.jpg)
39
조건 에 는 포 독 나타내지 않 인 있었다
(그림 11E). 이는 A23187 에 APP 감소가 포 죽 에
결과는 아님 증명 있다. 그 다면 APP 감소가
사단계에 조 는지를 알아보고자 A23187 처리 다
real-time RT-PCR 행 여 APP mRNA 양 인 다.
그 결과 A23187 처리 그룹과 군 사이에 APP mRNA
양 차이가 나이지 않 찰함 써 A23187 처리에
포 내 칼슘증가는 APP mRNA 가 아닌 단 질 양
감소시킬 있 인 다. 이 결과는 APP 가 포 내 칼슘
증가에 해 사 후 단계에 향조 시사 다.
2. 소포체 스트 스 인 퀴틴- 아좀 경 를 통
APP 분해 인
APP mRNA 가 A23187 처리시에 변 지 않았 에 APP
단 질 감소 원인이 아좀에 분해 결과인지를
인해보 여 A23187 처리 30 분 에 아좀 해 인
MG132 (10μM) 처리 다 APP 단 질 양 찰 다.
그 결과, A23187 처리에 해 격히 어들었 APP 가
MG132 가 처리 조건에 는 군과 사 APP 가
감소 지 않았 인 다 (그림 12A). 이런 찰 좀
명 히 인 해 MG132 보다 좀 특이 26S
![Page 50: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/50.jpg)
40
아좀 해 있는 lactacystin (10μM)
처리 여 APP 양 해보았다. Lactacystin 처리에
해 도 마찬가지 A23187 처리시에 감소했 APP 양이
보 인함 써 포 내 칼슘증가 인 소포체
스트 스가 아좀 통 APP 분해를 야 함 알
있었다. 포 내 칼슘증가 인 소포체 스트 스가 APP
분해를 도 다는 것 증명 다른 실험 소포체
스트 스를 생시킨다고 알 진 소포에 칼슘 펌 해 인
thapsigargin 과 단 질 실 해 인 tunicamycin
이용 다. 이 thapsigargin 과 tunicamycin 처리시
A23187 처리시 동일 게 APP 가 감소 는 것 보았고 이런
감소는 아좀 해시 회복 인 다 (그림 12B, C).
A23187 과 thapsigargin 모 포 내 칼슘 증가시키고 그
인해 소포체 스트 스를 에 포 내 증가 칼슘이
APP 감소에 향 끼 는 지 인 고자 칼슘 킬 이 인
BAPTA/AM 이용 다. 칼슘 킬 이 처리 시 ionophore 에
APP 감소에 보 효과를 인 고 (그림 12D), 이
결과들 망가진 칼슘 항상 포함 소포체 스트 스가
아좀 통해 APP 분해를 도함 인 다.
![Page 51: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/51.jpg)
41
3. 소포체 스트 스에 APP 분해가 아좀 특이
경 를 통함 인
포 동 포에 토 지 퀴틴- 아좀 시스
(UPS) 포 내 단 질 분해를 인 경 잘 알
있다 (54). APP 분해가 소포체 스트 스 상황에 UPS 를 통
것인지를 인 해 포 내 여러 가지 단 질 분해 경
해 들 이용 다. 7w-PSML 포에 토 지 해 인
3MA (3-methyladenine) 리소좀 능 해 인 bafilomycin
A1 과 ammonium chloride (NH4Cl)를 처리 이후 30 분
뒤에 A23187 처리 뒤 APP 양 인 해 보았다.
미롭게도 칼슘 ionophre 에 해 야 APP 분해가
직 아좀 해 인 MG132 처리 조건에 만 보 는
것 찰 다 (그림 13).
4. 칼슘 과부 에 APP 폴리 퀴틴 인
UPS 를 통 APP 분해를 인 고 실 칼슘 ionophore
처리 시 아좀 가 변 는지를 해보았다. 칼슘
ionophore 처리시 군에 해 20% 가량 20S 아좀
이 게 증가 인 다 (그림 14A).
아좀 통 단 질 분해는 드시 분해 단 질
![Page 52: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/52.jpg)
42
폴리 퀴틴 (poly-ubiquitination)가 동 어야 에
APP 도 이런 규 르는지를 알아 보 해 CHO 포에
HA 태그가 붙어있는 퀴틴 트 스펙 (transfection) 다
아좀 해 인 MG132 를 ionophore 를 처리 30 분 에
처리 뒤 ionophore 는 12 시간동안 처리 다. 이후
면역침강법 인 결과, 아좀 해 를 사 처리
조건에 폴리 퀴틴 가 APP 를 찰 다 (그림 14B).
라 실 APP 가 칼슘 과부 인 소포체 스트 스 인해
폴리 퀴틴 어 아좀 통해 분해 규명 다.
4. 소포체 스트 스 인 APP 분해 소포체 연 단 분해
과 (ER-associated degradation; ERAD) 인
소포체 스트 스 상황 동안 포 내에 작동 는 주요 보 인
는 보충 알 진 것 ‘ 히지 않 단 질 ’
(unfolded protein response, UPR)이다 (55, 56). UPR 소포체
연과 단 분해 과 (ER-associated degradation; ERAD)과
있는 단 질들 증가를 통해 ‘잘 못 힌 단 질’ (misfolded
protein) 분해를 증가시키는 것 알 있다. 다
소포체 스트 스가 ERAD 단 질들 양에 향
주는지 인 결과 APP USP25 (ubiquitin-specific protease
25)는 ionophore 는 tunicamycin 처리시 감소 면에 HRD1
![Page 53: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/53.jpg)
43
(human homolog of yeast Hrd1p/Der3p)과 BiP (binding
immunoglobulin protein) 증가 다 (그림 15A). USP25 는
탈 퀴틴 효소이고 HRD1 ERAD E3 퀴틴 합 효소
(E3 ubiquitin ligase)이다. 이 보고에 APP 는 HRD1 질
나임이 진 있다 (57). 라 탈 퀴틴 효소인
USP25 APP 사이 상 작용 인해보 해
면역침강법 이용 결과, APP 가 USP25 결합 는 것과 함께
ionophore 처리 이후에 단 질 사이 결합이 감소
인 다 (그림 15B). USP25 가 과 조건에
A23187 처리에 APP 감소가 회복 는 경향
인 고 (그림 15C) 이 같 결과들 통해 소포체 스트 스
인 ERAD 가 APP 분해를 야 고 USP25 는
proteasome 통 APP 분해를 보 있 인 다.
5. 소포체 스트 스 상황에 아좀 해는 소포체에
APP 축 래함 인
APP 는 소포체에 생 뒤 골지 이동 에 소포체
스트 스를 도 상황에 APP 가 소포체에 축 는지를
면역 포염색법 사용 여 인 다. 소포체를 찰 해
![Page 54: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/54.jpg)
44
소포체 지 단 질인 calnexin 염색 다. A23187 처리
CHO 포는 앞에 인 결과 동일 게 APP 염색강도가
군과 했 감소해 있 인 고 lactacystin
처리 여 아좀 해 조건에 는 A23187
처리 게 면 clanexin 과 APP 염색 신 가 겹 는 강도가
증가 는 것 인 다 (그림 16). 이 실험결과는 아좀
해 인 lactacystin 에 해 소포체 스트 스 인 APP
분해가 해 면 소포체에 APP 가 축 보여주고 있다.
소포체는 포 내 Aβ 생 장소 역 고 있 므 이
결과를 탕 소포체에 상 인 APP 축 Aβ
생 원인이 있 시사 다.
![Page 55: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/55.jpg)
45
그림 11. 포 내 칼슘증가가 APP 사과 에 미 는 향 인
7w-PSML 포주에 A23187 (1 μM) 12시간동안 처리함
(A) 체 단 질 얻 뒤 각각 항체를 이용 여 western
blot 행 여 단 질 양 인함
(B) Western blot 결과를 통 sAPPα (6E10 항체) sAPPβ
량
(C) 시약 처리 후 양 양액 이용 여 ELISA Aβ40과 A
β42 양 함
(D) 7w-PSML 포주에 A23187 처리 시 다양 시간과 농도를
![Page 56: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/56.jpg)
46
사용 뒤 western blot 통해 APP 양 인
(E) 포 생존 (Cell viability) MTT 분 법 통해 인
결과 A23187 처리 시 포 생존 에는 향이 없 인함
(F) 체 APP mRNA양 A23187 처리시 변 없 RT-PCR
통해 인함 (N=4, ***P < 0.001 versus 조군)
![Page 57: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/57.jpg)
47
그림 12. 소포체 스트 스가 APP 분해를 도함 인
(A) 7w-PSML 포주에 A23187 (1 μM 12 h) 처리 30분
에 10 μM MG132 (proteasome 해 )를 처리 는
미처리 다. 시약 처리 후 체 단 질 얻어 western blot
행 여 APP (22C11) 양 인함 아래 역 western blot
이미지 쪽 역 이미지상 농도계를 이용 여 APP 양
량 그래
(B, C) MG132 (proteasome 해 ) 처리가 소포체 스트
스에 APP 분해를 보 함 7w-PSML 포주에
![Page 58: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/58.jpg)
48
thapsigargin (B) 는 tunicamycin (C) 12시간 동안 처리
30분 에 MG132를 처리 고 시약 처리가 난 뒤 western blot
행 여 APP (22C11) 양 인함
(D) 7w-PSML 포주에 A23187 (1 μM) 12시간 동안 처리
시간 에 BAPTA/AM (5 μM) 처리 고 western blot
이용 여 APP 양 인 BAPTA를 통해 포 내 칼슘 킬 이
했 APP 분해가 보 인 (N=4, ***P < 0.001 and
**P < 0.05)
![Page 59: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/59.jpg)
49
그림 13. APP 가 소포체 스트 스 상황에 APP 가 아좀에
특이 인 경 를 통해 분해 인
(A) 7w-PSML 포주에 A23187 (1 μM_12 h) 처리
30 분 에 10 μM MG132 (proteasome 해 ), 1 mM 3MA
( 포자식작용, autophagy, 해 ), 20 mM NH4Cl 는 10 nM
Bafilomycin (Baf) (Lysosome 해 )를 처리함 Western blot
행 여 APP 양 인함 β-actin loading control
사용함
(B) Western blot 결과에 APP 단 질양 량 (N=4; *P <
0.05, ***P < 0.001)
![Page 60: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/60.jpg)
50
그림 14. 포 내 칼슘 증가에 APP 퀴틴 인
(A) CHO 포주에 A23187 (1 μM) 12 시간 동안 처리 후,
20S proteasome activity kit (APT280; Millipore)를 사용 여
proteasome activity 를 함 (N=4. *P < 0.05 versus 조군)
(B) CHO 포주에 HA-tagged ubiquitin (Ub-HA)과 Flag-
tagged APP 를 co-transfection 고 24 시간이 지난 후,
12 시간동안 A23187 처리 30 분 에 MG132 를 처리
미처리 다. 체 단 질 얻 후에 Flag 항체를
이용 여 면역침강 고 HA 항체 western blot 함
![Page 61: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/61.jpg)
51
그림 15. 소포체 스트 스가 소포체 연 단 분해과 통해
APP 안 조 함 규명
(A) CHO 포주에 A23187 는 tunicamycin 12 시간 처리
뒤 체 단 질 얻어 22C11 (APP), USP25, HRD1, BiP, β-
actin 항체를 이용 여 western blot 행함
(B) CHO 포주에 A23187 12 시간동안 처리 30 분 에
MG132 (proteasome 해 )를 처리 는 미처리함 시약
처리 후 체 단 질 얻어 USP25 항체를 사용 여
면역침강 고 22C11 (APP), USP25, HRD1, β-actin 항체를
이용 여 western blot 행함
![Page 62: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/62.jpg)
52
(C) CHO 포주에 USP25 transfection 거나 지 않
조건에 A23187 12 시간 동안 처리 다 체 단 질
얻 뒤 western blot 행 여 APP 양 량함 (N=2. *P
< 0.05 versus 조군)
![Page 63: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/63.jpg)
53
그림 16. 소포체 스트 스 상황에 아좀 해 시 APP 가
소포체에 축 인
CHO 포주에 A23187 12 시간동안 처리 30 분 에
lactacystin (proteasome 해 ) 처리 는 미처리함 시약
처리가 난 뒤 22C11 (APP)과 calnexin 항체 각각 APP
소포체를 염색 고 Alexa 594 Alexa 488 이 결합 이차
항체를 이용 뒤 공 미경 찰함 Scale bar; 20 μm
![Page 64: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/64.jpg)
54
고 찰
Part 1. 신경아 달 질인 ATP가 Aβ에 시냅스
가소 변 에 미 는 향 연구
본 연구는 신경아 달 질 나인 ATP가 Aβ에 해
도 시냅스 가소 해에 는 역 행 있다는
여러 요 증거를 공 다. 첫째 , Aβ42가 1차 양
상 포 U373 포주에 ATP 분 를 증가시킴
인 다. 째, ATP는 1차 양 해마 신경 포에 Aβ42
인 상돌 가시 도 감소에 보 능 다. 째,
ATP는 해마 편에 Aβ42에 LTP 붕 를 회복시킨다.
째, ATP는 Aβ42 인 시냅스 단 질들 감소를 P2
purinergic 용체를 통 여 회복시킨다. 이런 여러 가지 결과들
Aβ42에 해 도 시냅스 가소 장애에 여 ATP가 보
능 갖는다는 사실 뒷 침 있는 다양 증거들
공 다. Aβ 독 과 연 신경 포 죽 과 이
연구들 일 신경 포에만 연구 었다. 우리
뇌 추신경계를 구 고 있는 가장 많 신경 포는
상 포이다. 상 포는 원래 신경 포를 구조
![Page 65: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/65.jpg)
55
지지 는 동 인 역 만이 알 있었지만 지난 10 간 여러
연구들 통해 상 포가 시냅스 가소 포함 신경 포
능에 능동 이고 직 인 역 있다는 다 견해들이
보고 었다. 지만 추신경계에 상 포 요 에도
불구 고 신경 포 상 포간 상 작용에 분자
에 것 많이 알 지지 않았다. 상 포에 칼슘
신 달 뇌에 상 포 신경 포 사이 상 통신에 있어
요 역 행 다 (58). 신경 포 망가진 칼슘 항상
알 이 병 드러진 특징 Aβ는 신경 포 포 내
칼슘 항상 크게 망가 릴 있다. 몇몇 근 연구들에
Aβ가 상 포 칼슘 신 달 상아 달 질 분 를
변 시키는 것이 보고 었다. 2009 Kuchibhotla 그룹 Aβ
라크를 포함 고 있는 APP/PS1 질 알 이 병 모델
마우스 뇌 상 포에 칼슘 동이 찰 보고 다
(59). Aβ25-35를 처리 미 아 포 상 포에
glutamate ATP 분 가 증가 는 것 찰 보고도
있다 (60). 그러므 Aβ42에 해 도 상 포
ATP분 는 잘 못 변 상 포 칼슘 진동 일 가능 이
있다 (그림 6). 본 연구에 인 Aβ42에 해 도 LTP
![Page 66: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/66.jpg)
56
는 이 여러 연구들에 보고 었다 (61-63). 그래 본
연구에 는 ATP가 Aβ42 처리 조건에 LTP를 보
있는지를 인해보았고 그림 8에 보는 것처럼 Aβ42 처리에
해 감소 LTP가 ATP 인해 회복 는 것 찰 다.
상돌 가시 신경 포 시냅스 가소 과 LTP 매우
게 어 있 에 상돌 가시 도에
ATP 효과를 인해보고자 다. 지만 상 포를 양
양액에는 ATP를 포함 glutamate, 조 면역 cytokine
chemokine들과 같 매우 다양 질 포함 고 있 에
상아 달 질인 ATP 신경 포에 독립 인 효과를
연구 는 것 실험 인 에 어 움이 있다. 라 본
연구에 는 glutamate 여러 면역 질들 포함 여러 가지
상 포 부 래 다른 인자들 효과들 고
ATP만 효과를 연구 해 1차 양 신경 포에 포 에
합 ATP를 처리 는 법 사용 다. 이 같 법
Aβ42에 해 감소 상돌 가시 도 게 ATP
처리 회복 는 것 인 다. 라 이 같 결과들
탕 Aβ42에 해 망가진 시냅스 가소 에 ATP
보 인 능 규명 있다. NMDA 용체는 시냅스 가소 과
![Page 67: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/67.jpg)
57
억에 능 조 는 주요 질 잘 알 있다.
NMDA 용체는 각각 개 NR1과 NR2 닛 구
heterotetramer 복합체 (64-66) 알 이 병
병리생리 인 면에 요 역 다 (67). NR2A
NR2B는 NMDA 용체 닛 주 이다. 시냅스 후 구조
단 질인 PSD-95는 PSD-95/discs large/zona occludens-
1이라는 도 인 통해 NMDA 용체 닛 나인
NR2A 결합 다고 알 있 에 (68) NR2A PSD-
95 변 는 사 태 찰 것 상 다. 상
것처럼 Aβ42 처리시 동시에 감소 NR2A PSD-95는 ATP에
해 다시 회복 는 것 인 다 (그림 9). 본 연구에 는
시냅스 신 달에 요 시냅스 소낭 당단 질인 synaptophysin
Aβ42에 해 감소 었다가 ATP에 해 보 는
결과를 1차 양 해마 신경 포에 찰 다. 포 ATP는
P2 purinergic 용체 결합 통해 다양 포 내 과 들
조 있는 신 작용 다 (69). P2 purinergic 용체는
7개 리간드 개폐 이 채 인 P2X 용체 닛 (P2X1-7)
(70)과 8개 사 G단 질 결합 용체인 P2Y 용체
(P2Y1,2,4,6,11,12,13,14) 구 어있다 (36). P2X 용체 닛
![Page 68: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/68.jpg)
58
신경 포뿐만 아니라 신경 포 지 루 다 (70, 71). P2X
용체는 ATP에 른 시냅스 매개 는 면에 P2Y
용체는 신경 포 막 느린 변 를 가 다 (69, 72-
74). 1차 양 해마 신경 포에 PPADS를 처리했 , ATP는
Aβ42에 시냅스 단 질들 감소를 보 지 못 다 (그림
10). 이 결과는 신경 포에 ATP 보 능이 P2 용체를
통해 일어나는 것임 시사 다. In vitro상에 PPADS는
heteromeric P2X2/3 과 P2X1/5 용체뿐만 아니라 homomeric
P2X1, P2X2, P2X3, P2X5, P2Y1 용체에 해효과를
나타낸다. 지만 PPADS는 homomeric P2X4, P2X6, P2X7,
P2Y2, P2Y4, P2Y6, or P2Y11 용체에 해 는 해 지
못 다는 것이 보고 었다 (51). 라 이후 후속 연구에 는
ATP 보 인 신 달에 여 는 P2 용체
아 에 해 분명 게 힐 요가 있 시사 다. 포
ATP는 에 ectonucleotidase에 해 ADP 는 AMP
변 고 AMP는 adenosine 가 분해 다 (75). Adenosine
추신경계에 P1 purinergic 용체를 통해 포
조 는 신 달 질 알 있다 (76, 77). Adenosine
효과를 여 본 연구에 는 가 분해 지 않는 ATP
![Page 69: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/69.jpg)
59
analog인 ATPγS를 사용 다. 그 결과 ATP처리시 찰
결과 동일 게 Aβ42 처리 인해 감소했 시냅스 단 질들이
ATPγS에 해 보 는 것 인 고 (그림 9E,F) 본
연구에 사용 PPADS는 P2 용체는 해 지만 adenosine이
결합 는 P1 용체는 해 지 않는다는 보고 (52)를 탕
ATP 사산 효과가 아닌 ATP 자체 보 능임
규명 다. 이런 결과들 근거 후속 연구에 는 알 이 병
동 마우스에 ATP 다양 아 에 특이 인 작용 질
(agonist) 항 (antagonist)들 주입 는 in vivo 실험
계획 있고 마우스 행동실험 롯 여 여러 가지 실험들
통해 시냅스 능 인 다면 in vitro에 규명 결과를 욱
강 게 뒷 침 해 있 것 는 이다.
본 연구 종합 결과들 상 포 부 분 ATP는
신경 포 P2 purinergic 용체를 시킴 써 시냅스
가소 조 다는 것 안 다. 게다가 이러 ATP가
주요 게 NR2A PSD-95 단 질 양, 해마 상돌 가시
도, LTP를 조 있 다. 라 본 연구에 규명
상 포에 래 ATP 신경 포 시냅스 가소 사이
결 탕 상아 달 질 분 를 조 는
![Page 70: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/70.jpg)
60
질과 이 알 이 병 새 운 료 이 있다고
생각 는 이다.
Part 1 연구 결과는 Journal of neuroscience, February 29,
32(9):3081–3087 (2012)에 논 있다.
![Page 71: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/71.jpg)
61
Part 2. 소포체 스트 스가 베타 아 이드 구 단 질
조 는 연구
본 연구에 는 소포체 스트 스에 해 도 APP 사과 이
퀴틴- 아좀 시스 에 해 일어남 규명 다.
그림11에 본 것과 같이 칼슘 ionophore 처리 시 APP APP
사 질인 souble APP들 그리고 Aβ 지 격히 감소 는 것
인 고 이러 감소가 아좀 해 인 MG132에 해
회복 는 것 알아내었다. 일 APP 단 질
(maturated APP) Aβ 생 증가시킨다고 알 있다 (78).
게다가 몇몇 연구들 Aβ가 후 골지망 뿐만 아니라 소포체에 도
생 이 다고 보고 있다 (31, 79). 상 인 APP
사과 Aβ 생 증가시킬 있다. 그러므 APP
사과 조 는 연구는 요 다고 있다. 소포체는
칼슘 항상 조 에 있어 요 역 행 는 포 내
칼슘 항상 불균 일 소포체 스트 스
어있다. 본 연구에 는 소포체 스트 스에 해 APP가
격 게 분해 는 것 찰했 뿐만 아니라 이런 상이
일어나는 에 해 도 규명 다. 칼슘 ionophore 인
APP 감소가 벽 게 아좀 해 에 해 보 는 것
인함 써 소포체 스트 스에 APP 분해가 UPS
![Page 72: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/72.jpg)
62
이 있 상 다. 그러나 UPS는 포 내 단 질
분해를 담당 는 일 아니다. 토 지는 다른 포
내 단 질 분해를 조 는 주요 경 알 있다 (80).
라 본 연구에 는 UPS 이외 다른 포 내 단 질
분해경 를 통 APP 감소 가능 에 실험 행 해
토 지 리소좀 능 해 를 처리 뒤 A23187에
APP 감소를 해본 결과 직 아좀 해 만이
회복효과가 있 인 다 (그림 13). 이 결과는 소포체
스트 스에 APP 분해가 UPS 특이 인 역 임
안 다. 아좀 통 분해 경 달리 토 지는 주
래 단 질과 포질내 다른 질들 거에 여 다 (81,
82). 토 지는 량 분해에 여 는 일 양이
결 조건에 는 포 내 알 있다 (80).
그에 해 UPS는 부분 짧게 존재 는 단 질들 특이 인
분해 시스 이다 (20). 본 연구에 는 APP가 A23187처리 1시간
이후, 즉 매우 이른 시 에 부 격히 분해 는 것 찰 다
(그림 11D). 칼슘 ionophore인 A23187 포 내 칼슘 증가를
목 매우 리 사용 시약이나 몇몇 연구에 는
A23187 처리 시 포사멸 도 다고 보고 있 에
![Page 73: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/73.jpg)
63
(83, 84) 본 연구에 는 포사멸에 APP 분해 가능
인 해 coomassie blue 염색과 포 생존도 실험 행
결과 체 단 질 양에는 군과 A23187 처리 군 간 차이가
없 인 고 포 생존도도 사 결과를 얻 있었다.
라 이 결과는 A23187처리 시 감소 APP가 UPS를 통
분해 결과임 보충 있다. 칼슘 ionophore 뿐만 아니라
tunicamycin 는 thapsigargin과 같 질들 소포체
스트 스를 도 있다고 알 있다. A23187 처리시
인했 결과 동일 게 tunicamycin과 thapsigargin 처리에
해 도 APP가 감소 고 감소 APP는 아좀 해 에
해 회복 는 것 인 다 (그림 12B,C). A23187과
tunicamycin 처리 시 ERAD 단 질들이 조 는 것
찰함 써 본 연구에 는 APP 감소가 단지 칼슘 항상
불균 에 결과가 아니라 소포체 스트 스 인 것임
상 있었다. 근 APP가 ERAD 단 질인 E3
합효소인 HRD1과 탈 퀴틴 효소인 USP25 질이라는
보고가 있다 (57, 85). 본 연구 결과에 소포체
스트 스를 도했 USP25는 감소 면 HRD1과 BiP
증가 것 인 다. 라 소포체 스트 스 상황에
![Page 74: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/74.jpg)
64
탈 퀴틴 능 가진 USP25 감소 퀴틴 E3
합효소인 HRD1 증가는 APP 퀴틴 를
증가시키는데 있어 시 지 효과를 공함 써 격 APP
분해를 야 했 것 생각 다. 는 가벼운 소포체
스트 스는 포 생존과 해 일 소포체에
존재 는 샤페 (chaperone)과 ERAD 구 단 질
도 는 면 지속 이고 과도 소포체 스트 스는
포사멸 는 포 능 를 래 는 것 알 있다
(86, 87).
칼슘 항상 불균 과 같 소포체 스트 스는 단 질 힘
해 고 결과 잘 못 힌 는 히지 않 단 질
소포체에 축 야 함 써 UPR 시킨다. 이 게
UPR 포에 해 운 잘 못 힌 단 질들 증가를
차단 다는 것이 알 있다 (88, 89). 알 이 병 잘 못
히거나 집 단 질들이 특징 견 며 병 진행에
APP는 소포체 내에 잘 못 힐 가능 이 높고 ERAD
타겟이 있다 (90). 본 연구에 는 소포체 스트 스가
아좀 증가시키는 것 인 다 (그림 14A).
아좀 ERAD를 통 잘 못 힌 APP 단 질
![Page 75: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/75.jpg)
65
분해 여 것 상 다. 아좀 상 는
소포체 스트 스 상황에 포를 보 지만 알 이 병에 는
그 능이 망가 있 이 보고 었다 (24). 알 이 병에 Aβ
축 만 인 소포체 스트 스를 도 다 (91, 92). 본
연구에 아좀 해 를 처리 상태에 A23187
처리 APP가 소포체 지 단 질인 calnexin과 동일
에 염색 는 것 인함 써 아좀 능이
상태에 소포체 스트 스가 생 면 APP가 상
소포체에 축 알 있었다 (그림 16). BACE1 에
소포체에 합 고 일부 BACE1에 단이 계속 소포체에
생 다고 보고 있 며 감마 시크리 아 는 소포체에
드러지게 존재 는 것이 알 있다 (93, 94). 라 본 연구를
통해 아좀 능 에 소포체에 상 인
APP 축 이 지속 인 소포체 스트 스 같 알 이 병
생리 경에 포 내 Aβ 생 증가 시킬 있 것
생각 다.
본 연구 종합 결과들 소포체 스트 스는 ERAD 연
단 질과 샤페 도 여 잘못 히거나 히지 않
APP 단 질 거를 해 퀴틴- 아좀 경 를 이용 여
![Page 76: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/76.jpg)
66
APP를 른 시간 내에 분해함 써 종 Aβ 생
있 안 고 있다. 결 본 연구는 는
만 소포체 스트 스에 APP 사과 연구 요
공 뿐만 아니라 아좀이 알 이 병 료를
요 이 있 시사 고 있다.
본 연구 결과는 재 논 고 에 있다.
![Page 77: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/77.jpg)
67
결
알 이 병 칼슘 항상 불균 과 같 다양 스트 스
상황 롯 여 뇌 속에 존재 는 신경 포 상 포간
트워크 등 인 여 병 는 병 진행
가속 있는 매우 복잡 병인 갖고 있다. 본
연구에 는 알 이 병 원인 단 질 알 진 Aβ에 해
상 포 부 분 는 상아 달 질인 ATP가 증가 는
것 찰 다. 이 게 분 ATP는 Aβ에 해 해
LTP를 롯 여 시냅스 가소 과 이 있는 시냅스
단 질과 신경 포 상돌 가시 도 감소에 해 보
효과를 나타냄 인 다. Aβ 구 단 질인 APP가
Aβ에 해 야 있는 소포체 스트 스 상황에 UPS에
특이 분해 찰 다. 이러 결과를 통해 Aβ에
해 야 있는 포 내 스트 스 상황에 신경 포
상 포 사이 트워크 APP 사과 이 료 요
이 있 시사 는 이다.
![Page 78: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/78.jpg)
68
참 고 헌
1. Roberson ED, Mucke L. 100 years and counting:
prospects for defeating Alzheimer's disease. Science.
2006;314(5800):781-4.
2. Hardy J, Selkoe DJ. The amyloid hypothesis of
Alzheimer's disease: progress and problems on the road to
therapeutics. Science. 2002;297(5580):353-6.
3. Vingtdeux V, Sergeant N, Buee L. Potential contribution
of exosomes to the prion-like propagation of lesions in
Alzheimer's disease. Frontiers in physiology. 2012;3:229.
4. Wisniewski HM, Robe A, Zigman W, Silverman W.
Neuropathological diagnosis of Alzheimer disease. Journal of
neuropathology and experimental neurology. 1989;48(6):606-
9.
5. Selkoe DJ. The origins of Alzheimer disease: a is for
amyloid. JAMA : the journal of the American Medical
Association. 2000;283(12):1615-7.
6. Raff MC, Abney ER, Cohen J, Lindsay R, Noble M. Two
types of astrocytes in cultures of developing rat white matter:
differences in morphology, surface gangliosides, and growth
characteristics. The Journal of neuroscience : the official
![Page 79: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/79.jpg)
69
journal of the Society for Neuroscience. 1983;3(6):1289-300.
7. Kimelberg HK, Cai Z, Rastogi P, Charniga CJ, Goderie S,
Dave V, et al. Transmitter-induced calcium responses differ in
astrocytes acutely isolated from rat brain and in culture. Journal
of neurochemistry. 1997;68(3):1088-98.
8. Halassa MM, Fellin T, Haydon PG. The tripartite
synapse: roles for gliotransmission in health and disease.
Trends in molecular medicine. 2007;13(2):54-63.
9. Angulo MC, Kozlov AS, Charpak S, Audinat E. Glutamate
released from glial cells synchronizes neuronal activity in the
hippocampus. The Journal of neuroscience : the official journal
of the Society for Neuroscience. 2004;24(31):6920-7.
10. Yang Y, Ge W, Chen Y, Zhang Z, Shen W, Wu C, et al.
Contribution of astrocytes to hippocampal long-term
potentiation through release of D-serine. Proceedings of the
National Academy of Sciences of the United States of America.
2003;100(25):15194-9.
11. Gordon GR, Baimoukhametova DV, Hewitt SA,
Rajapaksha WR, Fisher TE, Bains JS. Norepinephrine triggers
release of glial ATP to increase postsynaptic efficacy. Nature
neuroscience. 2005;8(8):1078-86.
12. Pascual O, Casper KB, Kubera C, Zhang J, Revilla-
![Page 80: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/80.jpg)
70
Sanchez R, Sul JY, et al. Astrocytic purinergic signaling
coordinates synaptic networks. Science. 2005;310(5745):113-
6.
13. Zhang JM, Wang HK, Ye CQ, Ge W, Chen Y, Jiang ZL, et
al. ATP released by astrocytes mediates glutamatergic
activity-dependent heterosynaptic suppression. Neuron.
2003;40(5):971-82.
14. Bowser DN, Khakh BS. ATP excites interneurons and
astrocytes to increase synaptic inhibition in neuronal networks.
The Journal of neuroscience : the official journal of the Society
for Neuroscience. 2004;24(39):8606-20.
15. Akiyama H, Barger S, Barnum S, Bradt B, Bauer J, Cole
GM, et al. Inflammation and Alzheimer's disease. Neurobiology
of aging. 2000;21(3):383-421.
16. Wegiel J, Wang KC, Tarnawski M, Lach B. Microglia
cells are the driving force in fibrillar plaque formation, whereas
astrocytes are a leading factor in plague degradation. Acta
neuropathologica. 2000;100(4):356-64.
17. Murray FE, Landsberg JP, Williams RJ, Esiri MM, Watt
F. Elemental analysis of neurofibrillary tangles in Alzheimer's
disease using proton-induced X-ray analysis. Ciba Foundation
symposium. 1992;169:201-10; discussion 10-6.
![Page 81: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/81.jpg)
71
18. Sennvik K, Benedikz E, Fastbom J, Sundstrom E,
Winblad B, Ankarcrona M. Calcium ionophore A23187
specifically decreases the secretion of beta-secretase cleaved
amyloid precursor protein during apoptosis in primary rat
cortical cultures. Journal of neuroscience research.
2001;63(5):429-37.
19. Querfurth HW, Selkoe DJ. Calcium ionophore increases
amyloid beta peptide production by cultured cells. Biochemistry.
1994;33(15):4550-61.
20. Hershko A, Ciechanover A. The ubiquitin system.
Annual review of biochemistry. 1998;67:425-79.
21. Ciechanover A, Brundin P. The ubiquitin proteasome
system in neurodegenerative diseases: sometimes the chicken,
sometimes the egg. Neuron. 2003;40(2):427-46.
22. Perry G, Friedman R, Shaw G, Chau V. Ubiquitin is
detected in neurofibrillary tangles and senile plaque neurites of
Alzheimer disease brains. Proceedings of the National Academy
of Sciences of the United States of America. 1987;84(9):3033-
6.
23. Mori H, Kondo J, Ihara Y. Ubiquitin is a component of
paired helical filaments in Alzheimer's disease. Science.
1987;235(4796):1641-4.
![Page 82: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/82.jpg)
72
24. Keller JN, Hanni KB, Markesbery WR. Impaired
proteasome function in Alzheimer's disease. Journal of
neurochemistry. 2000;75(1):436-9.
25. Oddo S. The ubiquitin-proteasome system in
Alzheimer's disease. Journal of cellular and molecular medicine.
2008;12(2):363-73.
26. Meusser B, Hirsch C, Jarosch E, Sommer T. ERAD: the
long road to destruction. Nature cell biology. 2005;7(8):766-
72.
27. McCracken AA, Brodsky JL. A molecular portrait of the
response to unfolded proteins. Genome biology.
2000;1(2):REVIEWS1013.
28. Menendez-Benito V, Verhoef LG, Masucci MG, Dantuma
NP. Endoplasmic reticulum stress compromises the ubiquitin-
proteasome system. Human molecular genetics.
2005;14(19):2787-99.
29. Gorlach A, Klappa P, Kietzmann T. The endoplasmic
reticulum: folding, calcium homeostasis, signaling, and redox
control. Antioxidants & redox signaling. 2006;8(9-10):1391-
418.
30. Greenfield JP, Tsai J, Gouras GK, Hai B, Thinakaran G,
Checler F, et al. Endoplasmic reticulum and trans-Golgi
![Page 83: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/83.jpg)
73
network generate distinct populations of Alzheimer beta-
amyloid peptides. Proceedings of the National Academy of
Sciences of the United States of America. 1999;96(2):742-7.
31. Hartmann T, Bieger SC, Bruhl B, Tienari PJ, Ida N,
Allsop D, et al. Distinct sites of intracellular production for
Alzheimer's disease A beta40/42 amyloid peptides. Nature
medicine. 1997;3(9):1016-20.
32. Mattson MP, Chan SL. Neuronal and glial calcium
signaling in Alzheimer's disease. Cell calcium. 2003;34(4-
5):385-97.
33. Stix B, Reiser G. Beta-amyloid peptide 25-35 regulates
basal and hormone-stimulated Ca2+ levels in cultured rat
astrocytes. Neuroscience letters. 1998;243(1-3):121-4.
34. Abramov AY, Canevari L, Duchen MR. Changes in
intracellular calcium and glutathione in astrocytes as the
primary mechanism of amyloid neurotoxicity. The Journal of
neuroscience : the official journal of the Society for
Neuroscience. 2003;23(12):5088-95.
35. Collin C, Miyaguchi K, Segal M. Dendritic spine density
and LTP induction in cultured hippocampal slices. Journal of
neurophysiology. 1997;77(3):1614-23.
36. Lazarowski ER, Boucher RC, Harden TK. Mechanisms of
![Page 84: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/84.jpg)
74
release of nucleotides and integration of their action as P2X-
and P2Y-receptor activating molecules. Molecular
pharmacology. 2003;64(4):785-95.
37. Gandelman M, Peluffo H, Beckman JS, Cassina P,
Barbeito L. Extracellular ATP and the P2X7 receptor in
astrocyte-mediated motor neuron death: implications for
amyotrophic lateral sclerosis. Journal of neuroinflammation.
2010;7:33.
38. Sun XP, Stanley EF. An ATP-activated, ligand-gated
ion channel on a cholinergic presynaptic nerve terminal.
Proceedings of the National Academy of Sciences of the United
States of America. 1996;93(5):1859-63.
39. Zhou X, Galligan JJ. P2X purinoceptors in cultured
myenteric neurons of guinea-pig small intestine. The Journal of
physiology. 1996;496 ( Pt 3):719-29.
40. Moser MB, Trommald M, Andersen P. An increase in
dendritic spine density on hippocampal CA1 pyramidal cells
following spatial learning in adult rats suggests the formation of
new synapses. Proceedings of the National Academy of
Sciences of the United States of America. 1994;91(26):12673-
5.
41. Geinisman Y, deToledo-Morrell L, Morrell F. Induction
![Page 85: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/85.jpg)
75
of long-term potentiation is associated with an increase in the
number of axospinous synapses with segmented postsynaptic
densities. Brain research. 1991;566(1-2):77-88.
42. Geinisman Y. Structural synaptic modifications
associated with hippocampal LTP and behavioral learning.
Cerebral cortex. 2000;10(10):952-62.
43. Cullen WK, Suh YH, Anwyl R, Rowan MJ. Block of LTP
in rat hippocampus in vivo by beta-amyloid precursor protein
fragments. Neuroreport. 1997;8(15):3213-7.
44. Chen QS, Kagan BL, Hirakura Y, Xie CW. Impairment of
hippocampal long-term potentiation by Alzheimer amyloid
beta-peptides. Journal of neuroscience research.
2000;60(1):65-72.
45. Collingridge GL, Kehl SJ, McLennan H. Excitatory amino
acids in synaptic transmission in the Schaffer collateral-
commissural pathway of the rat hippocampus. The Journal of
physiology. 1983;334:33-46.
46. Elgersma Y, Silva AJ. Molecular mechanisms of synaptic
plasticity and memory. Current opinion in neurobiology.
1999;9(2):209-13.
47. Kornau HC, Schenker LT, Kennedy MB, Seeburg PH.
Domain interaction between NMDA receptor subunits and the
![Page 86: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/86.jpg)
76
postsynaptic density protein PSD-95. Science.
1995;269(5231):1737-40.
48. Beique JC, Andrade R. PSD-95 regulates synaptic
transmission and plasticity in rat cerebral cortex. The Journal
of physiology. 2003;546(Pt 3):859-67.
49. Kanjhan R, Housley GD, Thorne PR, Christie DL, Palmer
DJ, Luo L, et al. Localization of ATP-gated ion channels in
cerebellum using P2x2R subunit-specific antisera. Neuroreport.
1996;7(15-17):2665-9.
50. Bogdanov Y, Rubino A, Burnstock G. Characterisation of
subtypes of the P2X and P2Y families of ATP receptors in the
foetal human heart. Life sciences. 1998;62(8):697-703.
51. Ralevic V, Burnstock G. Receptors for purines and
pyrimidines. Pharmacological reviews. 1998;50(3):413-92.
52. Lambrecht G. Agonists and antagonists acting at P2X
receptors: selectivity profiles and functional implications.
Naunyn-Schmiedeberg's archives of pharmacology.
2000;362(4-5):340-50.
53. Lambrecht G, Braun K, Damer M, Ganso M, Hildebrandt
C, Ullmann H, et al. Structure-activity relationships of suramin
and pyridoxal-5'-phosphate derivatives as P2 receptor
antagonists. Current pharmaceutical design. 2002;8(26):2371-
![Page 87: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/87.jpg)
77
99.
54. Knecht E, Aguado C, Carcel J, Esteban I, Esteve JM,
Ghislat G, et al. Intracellular protein degradation in mammalian
cells: recent developments. Cellular and molecular life sciences :
CMLS. 2009;66(15):2427-43.
55. Schroder M, Kaufman RJ. The mammalian unfolded
protein response. Annual review of biochemistry.
2005;74:739-89.
56. Harding HP, Calfon M, Urano F, Novoa I, Ron D.
Transcriptional and translational control in the Mammalian
unfolded protein response. Annual review of cell and
developmental biology. 2002;18:575-99.
57. Kaneko M, Koike H, Saito R, Kitamura Y, Okuma Y,
Nomura Y. Loss of HRD1-mediated protein degradation causes
amyloid precursor protein accumulation and amyloid-beta
generation. The Journal of neuroscience : the official journal of
the Society for Neuroscience. 2010;30(11):3924-32.
58. Araque A. Astrocytes process synaptic information.
Neuron glia biology. 2008;4(1):3-10.
59. Kuchibhotla KV, Lattarulo CR, Hyman BT, Bacskai BJ.
Synchronous hyperactivity and intercellular calcium waves in
astrocytes in Alzheimer mice. Science. 2009;323(5918):1211-
![Page 88: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/88.jpg)
78
5.
60. Orellana JA, Shoji KF, Abudara V, Ezan P, Amigou E,
Saez PJ, et al. Amyloid beta-induced death in neurons involves
glial and neuronal hemichannels. The Journal of neuroscience :
the official journal of the Society for Neuroscience.
2011;31(13):4962-77.
61. Walsh DM, Klyubin I, Fadeeva JV, Cullen WK, Anwyl R,
Wolfe MS, et al. Naturally secreted oligomers of amyloid beta
protein potently inhibit hippocampal long-term potentiation in
vivo. Nature. 2002;416(6880):535-9.
62. Wang Q, Walsh DM, Rowan MJ, Selkoe DJ, Anwyl R.
Block of long-term potentiation by naturally secreted and
synthetic amyloid beta-peptide in hippocampal slices is
mediated via activation of the kinases c-Jun N-terminal kinase,
cyclin-dependent kinase 5, and p38 mitogen-activated protein
kinase as well as metabotropic glutamate receptor type 5. The
Journal of neuroscience : the official journal of the Society for
Neuroscience. 2004;24(13):3370-8.
63. Zhao D, Watson JB, Xie CW. Amyloid beta prevents
activation of calcium/calmodulin-dependent protein kinase II
and AMPA receptor phosphorylation during hippocampal long-
term potentiation. Journal of neurophysiology.
![Page 89: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/89.jpg)
79
2004;92(5):2853-8.
64. Monyer H, Sprengel R, Schoepfer R, Herb A, Higuchi M,
Lomeli H, et al. Heteromeric NMDA receptors: molecular and
functional distinction of subtypes. Science.
1992;256(5060):1217-21.
65. Nakanishi S. Molecular diversity of glutamate receptors
and implications for brain function. Science.
1992;258(5082):597-603.
66. Ishii T, Moriyoshi K, Sugihara H, Sakurada K, Kadotani
H, Yokoi M, et al. Molecular characterization of the family of the
N-methyl-D-aspartate receptor subunits. The Journal of
biological chemistry. 1993;268(4):2836-43.
67. Hynd MR, Scott HL, Dodd PR. Glutamate-mediated
excitotoxicity and neurodegeneration in Alzheimer's disease.
Neurochemistry international. 2004;45(5):583-95.
68. Niethammer M, Kim E, Sheng M. Interaction between
the C terminus of NMDA receptor subunits and multiple
members of the PSD-95 family of membrane-associated
guanylate kinases. The Journal of neuroscience : the official
journal of the Society for Neuroscience. 1996;16(7):2157-63.
69. Burnstock G, Knight GE. Cellular distribution and
functions of P2 receptor subtypes in different systems.
![Page 90: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/90.jpg)
80
International review of cytology. 2004;240:31-304.
70. North RA. Molecular physiology of P2X receptors.
Physiological reviews. 2002;82(4):1013-67.
71. Rubio ME, Soto F. Distinct Localization of P2X receptors
at excitatory postsynaptic specializations. The Journal of
neuroscience : the official journal of the Society for
Neuroscience. 2001;21(2):641-53.
72. Khakh BS. Molecular physiology of P2X receptors and
ATP signalling at synapses. Nature reviews Neuroscience.
2001;2(3):165-74.
73. Robertson SJ, Ennion SJ, Evans RJ, Edwards FA.
Synaptic P2X receptors. Current opinion in neurobiology.
2001;11(3):378-86.
74. Illes P, Alexandre Ribeiro J. Molecular physiology of P2
receptors in the central nervous system. European journal of
pharmacology. 2004;483(1):5-17.
75. Zimmermann H. Signalling via ATP in the nervous
system. Trends in neurosciences. 1994;17(10):420-6.
76. Kaster MP, Rosa AO, Rosso MM, Goulart EC, Santos AR,
Rodrigues AL. Adenosine administration produces an
antidepressant-like effect in mice: evidence for the
involvement of A1 and A2A receptors. Neuroscience letters.
![Page 91: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/91.jpg)
81
2004;355(1-2):21-4.
77. Dare E, Schulte G, Karovic O, Hammarberg C, Fredholm
BB. Modulation of glial cell functions by adenosine receptors.
Physiology & behavior. 2007;92(1-2):15-20.
78. Haass C, Hung AY, Schlossmacher MG, Teplow DB,
Selkoe DJ. beta-Amyloid peptide and a 3-kDa fragment are
derived by distinct cellular mechanisms. The Journal of
biological chemistry. 1993;268(5):3021-4.
79. Wild-Bode C, Yamazaki T, Capell A, Leimer U, Steiner
H, Ihara Y, et al. Intracellular generation and accumulation of
amyloid beta-peptide terminating at amino acid 42. The Journal
of biological chemistry. 1997;272(26):16085-8.
80. Klionsky DJ, Emr SD. Autophagy as a regulated pathway
of cellular degradation. Science. 2000;290(5497):1717-21.
81. Levine B, Klionsky DJ. Development by self-digestion:
molecular mechanisms and biological functions of autophagy.
Developmental cell. 2004;6(4):463-77.
82. Lum JJ, DeBerardinis RJ, Thompson CB. Autophagy in
metazoans: cell survival in the land of plenty. Nature reviews
Molecular cell biology. 2005;6(6):439-48.
83. Kajitani N, Kobuchi H, Fujita H, Yano H, Fujiwara T,
Yasuda T, et al. Mechanism of A23187-induced apoptosis in
![Page 92: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/92.jpg)
82
HL-60 cells: dependency on mitochondrial permeability
transition but not on NADPH oxidase. Bioscience, biotechnology,
and biochemistry. 2007;71(11):2701-11.
84. Kozian D, Proulle V, Nitsche A, Galitzine M, Martinez
MC, Schumann B, et al. Identification of genes involved in Ca2+
ionophore A23187-mediated apoptosis and demonstration of a
high susceptibility for transcriptional repression of cell cycle
genes in B lymphoblasts from a patient with Scott syndrome.
BMC genomics. 2005;6:146.
85. Blount JR, Burr AA, Denuc A, Marfany G, Todi SV.
Ubiquitin-specific protease 25 functions in Endoplasmic
Reticulum-associated degradation. PloS one.
2012;7(5):e36542.
86. Lafleur MA, Stevens JL, Lawrence JW. Xenobiotic
perturbation of ER stress and the unfolded protein response.
Toxicologic pathology. 2013;41(2):235-62.
87. Walter P, Ron D. The unfolded protein response: from
stress pathway to homeostatic regulation. Science.
2011;334(6059):1081-6.
88. Zhang K, Kaufman RJ. Signaling the unfolded protein
response from the endoplasmic reticulum. The Journal of
biological chemistry. 2004;279(25):25935-8.
![Page 93: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/93.jpg)
83
89. Rutkowski DT, Kaufman RJ. A trip to the ER: coping
with stress. Trends in cell biology. 2004;14(1):20-8.
90. Hare JF. Intracellular pathways of folded and misfolded
amyloid precursor protein degradation. Archives of
biochemistry and biophysics. 2006;451(1):79-90.
91. Hoozemans JJ, Veerhuis R, Van Haastert ES, Rozemuller
JM, Baas F, Eikelenboom P, et al. The unfolded protein
response is activated in Alzheimer's disease. Acta
neuropathologica. 2005;110(2):165-72.
92. Unterberger U, Voigtlander T, Budka H. Pathogenesis of
prion diseases. Acta neuropathologica. 2005;109(1):32-48.
93. Ko MH, Puglielli L. Two endoplasmic reticulum (ER)/ER
Golgi intermediate compartment-based lysine
acetyltransferases post-translationally regulate BACE1 levels.
The Journal of biological chemistry. 2009;284(4):2482-92.
94. Cupers P, Bentahir M, Craessaerts K, Orlans I,
Vanderstichele H, Saftig P, et al. The discrepancy between
presenilin subcellular localization and gamma-secretase
processing of amyloid precursor protein. The Journal of cell
biology. 2001;154(4):731-40.
![Page 94: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/94.jpg)
84
Abstract
Eun Sun Jung
Interdisciplinary Graduate Program
in Genetic Engineering
Seoul National University
Activated microglia and reactive astrocytes are commonly
found in and around the senile plaque, which is the central
pathological hallmark of Alzheimer’s disease. Astrocytes
respond to neuronal activity through the release of
gliotransmitters such as glutamate, D-serine, and ATP.
However, it is largely unknown whether and how
gliotransmitters affect neuronal functions. In this study, we
explored the effect of a gliotransmitter, ATP, on neurons
damaged by Aβ. We found that Aβ42 increased the release of
ATP in cultures of primary astrocytes and U373 astrocyte cell
line. We also found that exogenous ATP protected Aβ42-
mediated reduction in synaptic molecules, such as NMDA
receptor 2A and PSD-95, through P2 purinergic receptors and
prevented Aβ42-induced spine reduction and impairment of
long-term potentiation. Our findings suggest that Aβ-induced
release of gliotransmitter ATP plays a protective role against
![Page 95: Disclaimer - Seoul National Universitys-space.snu.ac.kr/bitstream/10371/125362/1/000000021080.pdf · 주요 기능 중의 하나는 신경세포의 시냅스 간극에서 신경전달물질](https://reader033.vdocuments.net/reader033/viewer/2022041706/5e451b7eb5d6052a8f594b0f/html5/thumbnails/95.jpg)
85
Aβ42-mediated disruption of synaptic plasticity. In addition,
we found that APP is rapidly degraded by ubiquitin-proteasome
system (UPS) in CHO cell lines in response to ER stress, such
as calcium dyshomeostasis. It is known that Aβ42 can induce
calcium dyshomeostasis. Increased intracellular calcium by
A23187 induces polyubiquitination of APP, causing degradation
of APP. A23187-induced reduction of APP prevented by only
poteasome inhibitor MG132. Also, we observed that APP was
accumulated in the ER by MG132. Impaired proteasome activity
have been reported in Alzheimer’s disease. Taken together,
these results suggest that astrocyte can protects neuron
through gliostransmitter, ATP and proteasome may prevents
accumulation of misfolded APP through rapid degradation under
pathological stress such as Aβ or calcium dyshomeostasis.
Threfore, regulation of astrocyte-neuron interaction and
proteasome activity under phathological stress such as Aβ and
calcium dyshomeostasis may provide therapeutic targets for
treating AD.
--------------------------------------------------
Keywords: Alzheimer’s disease, β-amyloid (Aβ), synaptic
plasticity, ATP, Amyloid precursor protein (APP), ER stress,
calcium, Ubiquitin-Proteasome System (UPS)
Student number: 2009 – 30843