diy primer design oligonucleotides for special applications in molecular biology alberto catalano...
TRANSCRIPT
DIY Primer DesignDIY Primer DesignOligonucleotides for Special Oligonucleotides for Special
Applications in Molecular BiologyApplications in Molecular Biology
Alberto CatalanoAlberto Catalano
Kanematsu Labs, Institute of HaematologyKanematsu Labs, Institute of HaematologyRPAHRPAH
[email protected]@email.cs.nsw.gov.au
Ph: 9515 7453Ph: 9515 7453
http://http://users.bigpond.net.au/albert/primers.htmusers.bigpond.net.au/albert/primers.htm
OutlineOutline DNA Refresher: “DNA 101”DNA Refresher: “DNA 101” PCRPCR
IntroductionIntroduction Oligonucleotide Primers for PCROligonucleotide Primers for PCR
PropertiesProperties SpecificitySpecificity Self complementarity & primer-primer interactionsSelf complementarity & primer-primer interactions General rulesGeneral rules
Primer DesignPrimer Design Computer programmes: on internet & on PCComputer programmes: on internet & on PC
Special PCR ApplicationsSpecial PCR Applications
• Common form of DNA
• Formed under high humidity conditions
• Right-handed double helix
• Major groove & minor groove
• Sugar-phosphate backbones
B-DNA
Ramaswamy H. Sarma 1996
2nm
3.4nm
10 nucleotides per turn
Base-pairing & DNA StabilityBase-pairing & DNA Stability 4 nucleotide bases in DNA4 nucleotide bases in DNA Cytosine (C) pairs with Guanine (G)Cytosine (C) pairs with Guanine (G)
3 hydrogen bonds3 hydrogen bonds Strong-pairingStrong-pairing
Adenine (A) pairs with Thymine (Adenine (A) pairs with Thymine ( TT )) 2 hydrogen bonds2 hydrogen bonds Weak-pairingWeak-pairing
Stacking forcesStacking forces Van der Waals forcesVan der Waals forces Influenced by nearest neighbour sequenceInfluenced by nearest neighbour sequence
Uses for oligonucleotidesUses for oligonucleotides PCR, PCR, etc.etc.
Primer pairs Primer pairs Primer sets in multiplex assaysPrimer sets in multiplex assays
ProbesProbes Sequence identificationSequence identification Gel shift assaysGel shift assays
Gene technologyGene technology Synthetic genesSynthetic genes Site-directed mutagenesisSite-directed mutagenesis
Oligonucleotide ChoiceOligonucleotide Choice SequenceSequence
SpecificitySpecificity GC contentGC content Target sequence locationTarget sequence location
Avoiding repeat sequencesAvoiding repeat sequences
Melting temperatureMelting temperature Avoid Secondary structuresAvoid Secondary structures
SpecificitySpecificity
Approximation of complexity (for a random Approximation of complexity (for a random sequence)sequence) 1 base = 41 base = 411 ; 2 bases = 4 ; 2 bases = 422 ; 3 bases = 4 ; 3 bases = 43 3 ; ...; ...
n bases = 4n bases = 4nn
Biological sequences are not random!Biological sequences are not random! Check the oligos with BLASTCheck the oligos with BLAST
Need to avoid complementarity with Need to avoid complementarity with repetitive sequences in specific organismrepetitive sequences in specific organism e.g. human Alu sequences, simple repeatse.g. human Alu sequences, simple repeats
Unwanted Self & Primer-Primer Unwanted Self & Primer-Primer InteractionsInteractions
Primer self-complementarityPrimer self-complementarity At 3’-end can result in primer-dimer formationAt 3’-end can result in primer-dimer formation
Internal homology : stem & loop structuresInternal homology : stem & loop structures
Forward & reverse primer complementarityForward & reverse primer complementarity Primer-dimer formation between different primersPrimer-dimer formation between different primers
|||||||||||||||||||||||||||
|||||||||||||||||||||||||||
|||||||||||||||||||||||
|||||||||||||||||||||||
|||||||||||||||||||||||||||
|||||||||||||||||||||||||||
|||||||||||||||||||||||
|||||||||||||||||||||||
Primer Length vs PurityPrimer Length vs Purity Most oligonucleotide synthesis reactions are Most oligonucleotide synthesis reactions are
only 98% efficient. only 98% efficient. Each time a base is added, only 98% of the Each time a base is added, only 98% of the
oligos will receive the base.oligos will receive the base. As length increases, so does the probability As length increases, so does the probability
that a primer will be missing a basethat a primer will be missing a base Critical in mutagenesis or cloning reactions. Critical in mutagenesis or cloning reactions. Purification by HPLC or PAGE is Purification by HPLC or PAGE is
recommended in some cases. recommended in some cases.
Primer Length vs PurityPrimer Length vs Purity
Oligonucleotide lengthOligonucleotide length Percent with correct sequencePercent with correct sequence
10 bases (0.98)10 = 81.7%
20 bases (0.98)20 = 66.7%
30 bases (0.98)30 = 54.6%
40 bases (0.98)40 = 44.6%
Melting TemperatureMelting Temperature
Oligonucleotide Factors:Oligonucleotide Factors: Primer lengthPrimer length GC content i.e. Overall Sequence GC content i.e. Overall Sequence Sequence order due to stacking forces: Sequence order due to stacking forces:
nearest neighbour analysisnearest neighbour analysis
Reaction Conditions:Reaction Conditions: Salt concentrationSalt concentration Primer concentrationPrimer concentration Presence of additives in reaction;Presence of additives in reaction;
e.g. formamide, DMSO, betaine, glycerole.g. formamide, DMSO, betaine, glycerol
Hyperchromic shift & THyperchromic shift & Tmm
1
1.1
1.2
1.3
1.4
1.5
40 50 60 70 80 90
Temperature (°C)
Rel
ativ
e ab
sorb
ance
at
260n
m
Melting temperature
ssDNA
dsDNA
50% denatured
Experimental determination of DNA melting temperature
1
1.1
1.2
1.3
1.4
1.5
40 50 60 70 80 90
Temperature (°C)
Rel
ativ
e ab
sorb
ance
at
260n
m
Melting Temperature Melting Temperature vsvs
Annealing TemperatureAnnealing Temperature
Melting temperature
ssDNA
dsDNA
Annealingtemperatures
Mismatched bases
Bonding between neighbouring bases is weakened by the mismatch.Therefore, the melting temperature is lowered
Mismatched Bases
General Rules for PCR PrimersGeneral Rules for PCR Primers
Innis & Gelfand 1990Innis & Gelfand 19901.1. Length : 17-28 basesLength : 17-28 bases
2.2. G+C content : 50-60%G+C content : 50-60%
3.3. GC clamp: terminal G, C, GC or CGGC clamp: terminal G, C, GC or CG
4.4. Primer TPrimer Tmm : 55° - 80°C : 55° - 80°C
5.5. Avoid 3’-complementarityAvoid 3’-complementarity
6.6. Avoid internal self-complementarityAvoid internal self-complementarity
7.7. Avoid runs of 3 or more Gs or Cs near endsAvoid runs of 3 or more Gs or Cs near ends
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Steps of PCRSteps of PCR
DENATURATIONDENATURATION PRIMER ANNEALINGPRIMER ANNEALING PRIMER EXTENSION BY POLYMERASEPRIMER EXTENSION BY POLYMERASE2200 to 2 to 211
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
21 to 22
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||22 to 23
Primer DesignPrimer DesignUsing computers to get primers Using computers to get primers
that will work wellthat will work well
Why use computers?Why use computers?
Comparison of candidate primer sequence with Comparison of candidate primer sequence with repeat sequences from the species of interestrepeat sequences from the species of interest
Nearest-neighbour TNearest-neighbour Tmm calculations calculations
Primer self-complementarity analysisPrimer self-complementarity analysis Identification of potential primer-dimer formationIdentification of potential primer-dimer formation Analysis of large numbers of forward and reverse Analysis of large numbers of forward and reverse
primer combinations to find a pair that fit the primer combinations to find a pair that fit the desired criteria for target sequence, product size, desired criteria for target sequence, product size, primer Tprimer Tmm, etc., etc.
PC based softwarePC based software
Commercial packages:Commercial packages: iOligo iOligo DNA StarDNA Star PCR Help! (free demo)PCR Help! (free demo) Oligo (free demo)Oligo (free demo) Primer Premier (free demo)Primer Premier (free demo)
Free software:Free software: PerlPrimerPerlPrimer OligosOligos GeneTool Lite (no longer supported)GeneTool Lite (no longer supported)
TerminologyTerminology
Template: (genomic DNA or cDNA)
Target: sequence to be included between primers
Forward primer
Reverse primer
Amplicon: resulting PCR product
ANGIS BiomanagerANGIS Biomanager GCG PrimeGCG Prime
Basic selection of oligonucleotide primers for PCR and Basic selection of oligonucleotide primers for PCR and sequencingsequencing
CodeHopCodeHop designs a pool of primers containing all possible 11- or designs a pool of primers containing all possible 11- or
12-mers for the 3' degenerate core region and having 12-mers for the 3' degenerate core region and having the most probable nucleotide predicted for each the most probable nucleotide predicted for each position in the 5' non-degenerate clamp regionposition in the 5' non-degenerate clamp region
Primer3Primer3
““Primer3”Primer3” http://frodo.wi.mit.edu/http://frodo.wi.mit.edu/ Primer3 picks primers for PCR reactions, according Primer3 picks primers for PCR reactions, according
to the conditions specified by the user. to the conditions specified by the user. Primer3 considers things like Primer3 considers things like
melting temperature melting temperature concentrations of various solutions in PCR reactions concentrations of various solutions in PCR reactions primer bending and foldingprimer bending and folding
Can also pick probes according to specified Can also pick probes according to specified parametersparameters
Variants: e.g. PrimerQuest, with graphic outputVariants: e.g. PrimerQuest, with graphic output http://scitools.idtdna.com/Primerquest/http://scitools.idtdna.com/Primerquest/
““Exon Primer”Exon Primer” http://ihg.gsf.de/ihg/ExonPrimer.htmlhttp://ihg.gsf.de/ihg/ExonPrimer.html helps to design intronic primers for the PCR helps to design intronic primers for the PCR
amplification of exons amplification of exons needs a cDNA and the corresponding needs a cDNA and the corresponding
genomic sequence as input genomic sequence as input can avoid primers to be positioned across can avoid primers to be positioned across
SNPs, using genomic sequence where SNPs SNPs, using genomic sequence where SNPs are masked by N’s in input genomic are masked by N’s in input genomic sequencesequence
““Exon Primer”Exon Primer”
Template: genomic DNA
Multiple Targets: gene exons
Multiple Amplicons Overlapping amplicons for large exons
Single amplicon for small exons/introns
SNPs
““CODEHOP”CODEHOP”
http://blocks.fhcrc.org/blocks/codehop.htmlhttp://blocks.fhcrc.org/blocks/codehop.html COCOnsensus-nsensus-DEDEgenerate generate HHybrid ybrid
OOligonucleotide ligonucleotide PPrimers rimers PCR primers designed from protein multiple PCR primers designed from protein multiple
sequence alignments sequence alignments Amino acid alignments must be in Blocks Amino acid alignments must be in Blocks
Database format Database format Intended for cases where the protein Intended for cases where the protein
sequences are distant from each other and sequences are distant from each other and degenerate primers are neededdegenerate primers are needed
““POLAND”POLAND” http://www.biophys.uni-duesseldorf.de/local/POLAND/poland.htmlhttp://www.biophys.uni-duesseldorf.de/local/POLAND/poland.html
Calculates the thermal denaturation profile of Calculates the thermal denaturation profile of double-stranded RNA, DNA or RNA/DNA-double-stranded RNA, DNA or RNA/DNA-hybrids based on sequence input and hybrids based on sequence input and parameter settingsparameter settings
e.g. Sequence: 70 44r CGCCAGCTTGGTCCGAGCTCGGATCCACTAGCTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTACCTGG
PerlPrimerPerlPrimer http://perlprimer.sourceforge.net/http://perlprimer.sourceforge.net/ for downloading for downloading Free open source standaloneFree open source standalone
Runs in Windows, Linux, MacOS Runs in Windows, Linux, MacOS
Features:Features: Calculation of possible primer-dimers Calculation of possible primer-dimers Retrieval of genomic or cDNA sequences from Retrieval of genomic or cDNA sequences from EnsemblEnsembl (including (including
both sequences automatically for Q-PCR) both sequences automatically for Q-PCR) Ability to BLAST search primers using the Ability to BLAST search primers using the NCBINCBI server server Results can be saved or optionally exported in a tab-delimited format Results can be saved or optionally exported in a tab-delimited format
that is compatible with most spreadsheet applications. that is compatible with most spreadsheet applications. ORF and CpG island detection algorithms ORF and CpG island detection algorithms Ability to add cloning sequences to primers, automatically adjusted Ability to add cloning sequences to primers, automatically adjusted
to be in-frame to be in-frame Q-PCR primer design without manual intron-exon boundary entry Q-PCR primer design without manual intron-exon boundary entry
Other ResourcesOther Resources NCBI: NCBI: http://www.ncbi.nlm.nih.govhttp://www.ncbi.nlm.nih.gov
BLASTBLAST EntrezEntrez
Genome Browser @ UCSCGenome Browser @ UCSC http://genome.ucsc.edu/http://genome.ucsc.edu/ Genome BrowserGenome Browser
HumanHuman DogDogDrosophilaDrosophila
MouseMouse ChickenChicken S. S. cerevisiae cerevisiae
RatRat FuguFuguChimpChimp C. elegansC. elegans
In-Silico PCRIn-Silico PCR Blat searchBlat search SNPsSNPs
Special ApplicationsSpecial ApplicationsModified OligonucleotidesModified Oligonucleotides
&&
Special PrimersSpecial Primers
Degenerate PrimersDegenerate Primers
Mixed oligosMixed oligos e.g. actgattc[gc]tgct[atc]e.g. actgattc[gc]tgct[atc] Nucleotides can be in unequal ratiosNucleotides can be in unequal ratios Increased degeneracy means concentration of the Increased degeneracy means concentration of the
individual primers decreasesindividual primers decreases
Deoxyinosine (Deoxyinosine (dIdI)) dIdI at degenerate positions rather than use mixed oligos at degenerate positions rather than use mixed oligos dI dI base-pairs with any other base, effectively giving a base-pairs with any other base, effectively giving a
four-fold degeneracy at any position in the oligo where it four-fold degeneracy at any position in the oligo where it is presentis present
Degeneracies obviously reduce the specificity Degeneracies obviously reduce the specificity
Autosticky PCRAutosticky PCR
““dSpacer” protected tetrahydrofuran dSpacer” protected tetrahydrofuran phosphoramiditephosphoramidite For inclusion of abasic sites in an oligoFor inclusion of abasic sites in an oligo Abasic sites cause stalling of DNA polymerasesAbasic sites cause stalling of DNA polymerases Can therefore be used to create 5’-overhangs in Can therefore be used to create 5’-overhangs in
PCR products; “autosticky-PCR”PCR products; “autosticky-PCR” Overhangs capable of annealing with restriction Overhangs capable of annealing with restriction
enzyme generated 5’-overhangsenzyme generated 5’-overhangs
Chemical 5’-phosphorylation recommendedChemical 5’-phosphorylation recommended
Real Time PCRReal Time PCR
Considerations for primer designConsiderations for primer design Smaller amplicon = higher efficiencySmaller amplicon = higher efficiency
amplicon ideally < 150 bp; maximum 400 bpamplicon ideally < 150 bp; maximum 400 bp
Amplifying gDNA or cDNAAmplifying gDNA or cDNA gDNA: primers that are intron-specific gDNA: primers that are intron-specific cDNA: primers spanning exon-exon boundaries of cDNA: primers spanning exon-exon boundaries of
spliced transcriptspliced transcript
Avoid a 3'-end T as this has a greater tolerance Avoid a 3'-end T as this has a greater tolerance of mismatchof mismatch
Primer length: 18–30 nucleotidesPrimer length: 18–30 nucleotides
Taqman ProbesTaqman Probes Select the probe first and design the primers as Select the probe first and design the primers as
close as possible to the probe without overlapping it close as possible to the probe without overlapping it TTmm should be 68°–70°C should be 68°–70°C No G on the 5´ end No G on the 5´ end Select the strand that gives the probe more C than Select the strand that gives the probe more C than
G bases G bases Avoid runs of an identical nucleotide. This is Avoid runs of an identical nucleotide. This is
especially true for guanine, where runs of four or especially true for guanine, where runs of four or more Gs should be avoidedmore Gs should be avoided
Fluorophore to quencher: optimally 6-14 bases Fluorophore to quencher: optimally 6-14 bases apartapart Internally positioned quencher increases probe sensitivityInternally positioned quencher increases probe sensitivity
SummarySummary
Oligo synthesis services that design Q-PCR Oligo synthesis services that design Q-PCR primers and probes and guarantee themprimers and probes and guarantee them
Many useful commercial programmesMany useful commercial programmes Multiple free tools for designing primersMultiple free tools for designing primers
PerlPrimer (Desktop computer) : simplePerlPrimer (Desktop computer) : simple Primer3 (Web) : highly customisablePrimer3 (Web) : highly customisable CODEHOP (Web) : for degenerate primersCODEHOP (Web) : for degenerate primers
Always check your primer sequence!Always check your primer sequence! Many published primers contain serious errors!Many published primers contain serious errors!