[CANCERRESEARCH54, 6512—6516,December 15, 1994]

ABSTRACT

A partial-length A-myb complementary DNA recently cloned by lowstringency hybridization with a c.myb probe to complementary DNAlibraries derived from human cell lines showed a high degree of homologywith the DNA-binding domain ofc-myb and B.myb, suggesting that A.mybalso encoded a DNA-binding proteln We report here the sequence of theentire coding region of A-myb complementary DNA and show that thefull-length GST-A-myb fission protein or a truncated derivative correspending only to the putative DNA-binding domain interacts specificallywith Myb-bmdlng sites of the c-myb responsive promoters, MIM-1 andCD34. In transient transfection assays, A-myb transactivated the boundpromoters. These results suggest that, analogous to the other members ofthe Myb family, the A-mybgene encodes a bona flde transactivator. Thedistinct function of A-myb might derive from its pattern of expressionand/or its relative potency as a transactivator of myb target genes.

INTRODUCTION

Two c-myb-related genes, A-myb and B-myb, have recently beenidentified which are homologous to c-myb in the DNA-binding domain and are abundantly expressed in many cell types includinghematopoietic cells, epithelial cells, and fibroblasts (1). Like c-myb,B-myb appears to be involved in transcriptional regulation by directinteraction with Myb-binding sites (2). B-myb might also be a c-mybfunctional equivalent in nonhematopoietic cells since introduction ofa constitutively expressed B-myb cDNA3 into BALB/c3T3 mousefibroblasts results in reduced growth factor requirements and activation of cdc2 and cyclin Dl expression (3). The biochemical propertiesof A-myb are unknown, and there are no functional studies thatsupport a role similar to that of c-myb; on the contrary, the reporteddecline of A-myb mRNA levels upon exit from G0 in normal Tlymphocytes raises the possibility that A-myb negatively regulates cellproliferation (4). To address these possibilities, we cloned the fulllength A-myb cDNA and analyzed its DNA-binding and -transactivating properties. Our results suggest that A-myb binds to and transactivates promoters containing Myb-binding sites, propertiescompatible with a c-myb-like function in cells that do not expressc-myb. In cells that coexpress A-myb and c-myb, A-myb could eitherpotentiate or weaken c-myb activity depending on the relative potencyof each gene as a positive regulator of Myb-responsive genes.

MATERIALS AND METHODS

Cloning of a Full-Length A-myb cDNA. The 5' region of A-myb cDNAfrom nt 1 to 1300 cloned in the pUC18 plasmid (pUCA-myb NcoI) was a kindgift from Dr. N. Nomura. The segment of A-myb cDNA extending from nt

1300 to 2341 was amplified by reverse transcriptase-PCR from RNA of the

Received 8/3/94; accepted 10/12/94.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

I Supported by NIH Grants to B. C.

2 To whom requests for reprints should be addressed, at Jefferson Cancer Institute,

Thomas Jefferson University, Bluemle Life Sciences Building, 233 South 10th Street,Philadelphia, PA 19107.

3 The abbreviations used are: cDNA, complementary DNA; PCR, polymerase chainreaction; SDS, sodium dodecyl sulfate; PBS, phosphate-buffered saline; HA, hemagglutinin; nt, nucleotide; NETN, 20 mt@Tris-HC1(pH 8.0)-100 m@.tNaC1-1m@EDTA-O.5%Nonidet P-40; CAT, cliloramphenicol-acetyl transferase; GST, glutathione S-transferase.

CCRF-CEM T-leukemia line and subcloned into the TA-cloning plasmid

p2000. The PCR fragment was sequenced, shown to be identical to thepublished sequence, ligated to the pUCA-myb NcoI plasmid using NcoI andScaI sites, and designated pUCA-myb ScaI. This partial-lengthA-myb cDNAwas then cloned into the pSV4O polylinker vector and named pSVA-myb ScaLTo reconstitute the remaining 3' segment of the A-myb cDNA, a genomiclibrary from peripheral blood lymphocytes was screened with the most 3'fragment of the A-myb cDNA. Three positive clones were isolated and foundto be identical by restriction enzyme analysis. A !.3-kilobase Hindlll fragmenthybridized with an 18-base oligomer corresponding to the most 3' region of thepartial-length A-myb cDNA. Sequence analysis of this !.3-kilobase Ifindlllfragment revealed a 109-nt sequence overlapping with the published 3' A-mybcDNA sequence, followed by 22 nt of new A-mybcoding sequence and a TAAstop codon. An 800-base pair EcoRV-HindII segment included in the 1.3-kilobase HindlII genomic subclone was then inserted into pSV-A-myb ScaIdigested with EcoRV and SmaI, generating the full-length pSV-A-myb cDNA.

Cloning of HA-tag@ A.myb Full-Length cDNA. The full-length A-mybcDNA was tagged by insertion of a triple tandem 9-amino acid-HA epitope(YPYDFVPDYA) (5, 6). The TGA stop codon upstream of the translationinitiation ATG codon of A-myb was eliminated by PCR amplification using amutated 5' oligomer and a 3' oligomer corresponding to nt 639—665.The PCRproduct was cloned into the PCR 2000 vector (In Vitrogen, San Diego, CA),sequenced, and cloned back into SKA-myb using XhoI and NdeI restriction

sites. This plasmid is designated SKA-myb 4. SKA-myb HA was constructedby inserting a double-stranded synthetic oligonucleotide encoding a singleepitope, preceded by the Kozak's consensus sequence for proper initiation(5'T CGAGOCCACCATGGcTFACCCATACGATGTFCCAGAUACGCT

TO 3')(3' CCOOTOGTACCGAAT000TATGCFACAAGGTCTAATGCGAACAGCT-5') SKA-myb 5' HA3 was made by inserting two additionalin-frame copies of the epitope at the Sal! restriction site (6).

Ooning of A-myb/c-myb Chimeric Constructs. The chimeric SKA-mybDBc-myb construct containing the A-myb DNA-binding domain (nt 1—755)

linked to the c-myb transactivating domain (nt 1201—2450)was cloned asfollows: (a) the c-myb fragment that includes the transactivating domain wasobtained from pSV-c-myb (10) by NdeI restriction digestion, blunt-ending, anda second digestion with HindllI; the fragment was ligated into the Bluescriptvector at the Hindfl and HindllI sites, and the plasmid was called SKTADcmyb; (b) pSKTADc-myb was digested with HindIII, Klenow-filled withdGTP, dATP, and dCTP only, and redigested with XbaI; and (c). The A-mybfragment containing the DNA-binding domain was obtained frompUC!8Amyb ScaI by NdeI digestion, Klenow filling with dfl'P, digestionwith XbaI, and ligation of the resulting fragment into pSKTADc-myb.

The chimeric SKc-mybDBA-myb construct containing the c-myb DNAbinding domain (nt 1—1200)followed by the A-myb putative transactivationdomain (nt 754—2463)was constructed by digesting pSKAmyb with Sal!,blunt-ending with Kienow enzyme, redigesting with NdeI, followed by Mungbean nuclease digestion. The c-myb DNA-binding domain was obtained frompSVc-myb (10), digested with NcoI, Hindffl, and blunted with the Klenowenzyme. This c-myb fragment was ligated into the SKAmyb vector. Sequenceanalysis confirmed that the constructs were in the correct reading frame. Bothchimeric constructs were cloned into the pSV polylinker expression vector byblunt-end cloning at the EcoRV site.

Generation of Recombinant GST.A-myb Plasmids The A-myb cDNAsegment from nt9Oto 760, which covers the putative DNA-bindingdomain andincludes the BamHI and EcoRV restriction sites, was amplified by PCR. ThisPCR product was purified, digested with BamHI and EcoRV, ligated to theBluescript 5K vector, and designated SKAmyb3R. The A-myb DNA-bindingdomain was excised with BamHI and EcoRV, ligated to pGEX-2TK linearizedwith EcoRI and blunt-ended with the Klenow fragment, and digested withBamHI. This plasmid was named GST A-mybDB. To obtain the full-lengthGST-A-myb construct, the full-length A-myb cDNA was cloned into the SKvector (SKA-mybi), digested with Cia! and Sins!, and ligated to SKAinyb3R

65!2

DNA Binding and Transactivation Activity of A-myb, a c-myb-.related Gene'

Xiao-Ping Ma and Bruno Calabretta2

JeffersonCancerInstitute.ThomasJeffersonUniversity,Philadelphia.Pennsylvania19107

on June 14, 2020. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DNA BINDING AND TRANSACI1VATION ACTIVITY OF A-myb

CAT Assays. Two reporterconstructswere used: (a) a minimal humanc-myb promoter driving the CAT gene and containing three Myb-binding sitesof the Myb responsive MJM-1 gene (8) upstream of the minimal c-mybpromoter (MIM-1-P1CAT); and (b) the CD34-CAT gene containing the 5'flanking region (nt —293to +55) ofthe Myb-responsive human CD34 promoter(9) linked to the CAT gene. Synthetic oligonucleotides including the Mybbinding sites of the MIM-1 gene were first annealed to generate doublestranded oligomers, then phosphorylated with a T4 polynucleotide kinase,multimerized using T4 DNA ligase, purified by polyacrylamide gel electrophoresis, blunt-ended with the Klenow polymerase, and cloned upstream of theminimal c-myb promoter of the Myb-P!CAT construct.

CAT assays were performed as described (17). Briefly, TK-tsl3 hamsterfibroblasts were transfected with 1 @gof CAT reporter plasmid with or without 1or 5 g@gof effector plasmid plus 1 pg of DNA pol-f3-gal,which contains thebacterial (3-galactosidasegene driven by the DNA polymerasea-promoter as aninternal control of transfectionefficiency.At 48 h after transfection,cells wereharvested and proteins were extracted by freeze-thawing and then normalized for

transfectionefficiencyby @3-galactosidaseassay as describedby the manufacturer(Promega Corp.). For each assay, cellular lysate was incubated with [‘4C]chloramphenicol and acetyl-CoA for 1 h at 37°C.Transactivation of reporter constructs

was assayed by measuring the amount of acetylated [‘4C]chloramphenicolbythin-layerchromatographyfollowedby autoradiographyand Cerenkovcounting.

RESULTS

Cloning and Expression of a Full-Length A-myb cDNA. Toobtain a full-length A-myb cDNA, we screened a cDNA libraryderived from chronic lymphocytic leukemia cells using a 5' segmentof the human A-myb cDNA (clone A-myb 1). Several positive cloneswere isolated and sequenced to determine the identity with the published sequence of A-myb cDNA and to select the clone with thelongest insert. Since none of the clones contained the full-lengthA-myb cDNA, we first linked the longest insert that was isolated fromthe cDNA library to a fragment of the A-myb cDNA amplified by thereverse transcriptase-PCR method with primers derived from thepublished sequence of the partial-length A-myb (1). To obtain thefull-length coding sequence of A-myb, we screened a human genomiclibrary to identify a genomic clone containing the remaining distalsegment of A-myb. After subcloning and sequence analysis of a!.3-kilobase Hind!!! fragment that hybridized to the most distal portion of the partial-length A-myb cDNA, we linked the region ofoverlap to our longest A-myb cDNA insert, which was only 22nucleotides short of the complete coding sequence as revealed by theposition of the first stop codon (Fig. !). We show only the region ofoverlapping with the previously published A-myb cDNA sequence(1). To determine whether the cloned A-myb cDNA generates anA-myb protein of the expected size, we attached a HA epitope at the

@2terminus of A-myb, inserted the A-myb cDNA into the pSV

based expression vector, and transfected TK-tsl3 hamster fibroblastswith the construct. Northern blot analysis revealed the exogenousA-myb mRNA in transfected cells (Fig. 2A), and use of anti-HAmonoclonal antibody !2 CM allowed detection of a protein with theexpected size for A-myb (Fig. 2B).

A.myb Encodesa DNA-binding Protein Interacting with Mybbinding Sites. To demonstrate that A-myb encodes a DNA-bindingprotein that interacts with Myb-binding sites, the full-length or theamino-terminal portion of A-myb (nt 90—760) was prepared as abacterially expressed GST-fusion protein and assayed by gel retardation analysis for the ability to interact with Myb-binding sites identifled in the c-myb-responsive genes MIM-1 (8) and CD34 (9). Thefull-length and truncated GST-A-myb fusion proteins reacted with theoligomer including one copy of the Myb-binding site (Box A of theMIM-! promoter) (Fig. 3A). Abrogation of the interaction by 100-foldexcess of the wild-type, but not of the mutated, unlabeled doublestranded oligomer containing the Myb-binding site demonstrated the

digested with CIa! and HindII. This plasmid was named SKAmyb3. SKAmyb3

was digested with XIZOI,blunt-ended with Klenow enzyme, and redigested withBamHI. This XhoI-BamHl fragment was ligated to the pGEX-2TK vectordigested with EcoRI, blunt-ended with the Klenow enzyme, and digested withBamHl. The full-length GST-A-myb plasmid was named GST-A-myb2.

Expression and Purification of Glutathione S-Transferase Fusion Protelns. Olutathione S-transferase fusion protein expression and purificationwere essentially as described (7). Fresh overnight cultures of Escherichia coli(DH5a; Bethesda Research Laboratories) transformed with one of the abovementioned plasmids were diluted 1:10 in Luria-Bertani medium containingampicillin and incubated for 4 h at 37°Cwith shaking. After 2 h of culture,isopropyl-g3-D-thiogalactopyranoside (Bethesda Research Laboratories) wasadded to a final concentration of 0.1 mM,and the incubation was continued for3 h at room temperature. The induced bacterial cultures were collected bycentrifugation at 4000 X g for 5 mm at 4°Cand resuspended in one-tenth ofthe original volume in NETN. Bacteria were then lysed in ice by mildsonication and centrifuged at 10,000 X g for 10 mm at 4°C.

The resulting supernatant was rocked for 15—30mm at 4°Cwith 25 @tl/mlof glutathione-Sepharose beads, prewashed three times, and resuspended (finalconcentration, 1:1 v/v) in NETN containing 0.5% powdered milk. The glutathione-Sepharose beads were then washed three times with NETN and thebound material was eluted by rocking the Sepharose for 20—30mm in 20 mt@treduced glutathione and 50 mM Tris-HC1 (pH 8.0) at 4°Con a rotating platformfor 15 mm. Supematant containing the fusion protein was collected by briefcentrifugation. For analysis of bound bacterial proteins, supernatants wereboiled in 1X sample buffer [2% SDS-10% glycerol-62 mM Tris (pH 6.8)] andloaded onto SDS-polyacrylamide gels. Proteins were visualized by Coomassieblue staining and quantitated by Bradford protein microassay (Bio-Rad).

Gel Retardation Assay. Different amounts of GST-A-myb fusion proteinwere mixedwith a 32P-labeleddouble-strandedoligonucleotideincludingtheMyb-binding site (Fig. 3, Box A) of the Myb-responsive MIM-1 promoter (8)or two Myb-binding sites (nt +67 to +102) of the human CD34 promoter (9),and gel retardation assays were performed as described (10). The Box Aoligonucleotide of the MIM-1 promoter (5' TCGACACAfl'ATAACG@i.1-1-I-I-I-1AGC 3') was used as specific competitor. The underlined consensus

sequence TAAC was mutated to T000 and used as irrelevant competitor. TheCD34 oligonucleotide from +67 to +102 (5' 1TFGGGAC@@CAOGGGAGCrCAA@GTAGCAG 3') was used as specificcompetitor.The @4@-iin@iconsensussequencesCAACandGTI'AweremutatedtoTGGCandGCCC,respectively.The mutated oligomerwas used as an irrelevantcompetitor.

RNA Isolation and Northern Blot Analysis. Total cellular RNA waspurified from transfected cells as described (11). RNA blotting to nylon filtersand hybridization to a 32P-labeled 1.0-kilobase A-myb insert (nt 1246—2341)were completed following established procedures (12—14).

Immunoprecipitation and Western Blotting. Cells were washed withPBS and trypsinized with 0.25% trypsin in Hanks' balanced salt solution.Equal numbers of cells were then washed three times with ice-cold PBS priorto lysis with 1 ml of lysis buffer [10 mMTris (jH 7.5)-iSO mMNaCl-1 mMEDTA-0.2% Nonidet P-40-1 @g/mlleupeptin and pepstatin A-i mMphenylmethylsulfonyl fluoride]. Lysates were incubated on ice for 30 mm andcentrifuged at 16,000 X g for 15 mm at 4°C.Supernatants were preclearedwith protein A-agarose (Oncogene Science, Inc.) and immunoprecipitated withmonoclonal antibody 12CA5, on recognizing the HA epitope, on a rotatingplatform at 4°C for 3 h. Immunocomplexes were isolated by adding 15 @lof

protein A-agarose and rotating for an additional 60 mm at 4°C.After threewashes with lysis buffer, samples were fractionated on SDS-polyacrylamidegels and electrophoretically transferred to nitrocellulose membranes usingstandard conditions. Membranes were blocked for 3 h at room temperature inPBS containing 5% dry milk, and 2.5% Tween 20, washed several times (5 miii

each)with washingbuffer(PBSwith0.5%Tween20), and incubatedwith primaryantibody at room temperature for 2 h. After several 5-mm washes with washing

buffer, membranes were incubated for 2 h with goat anti-mouse immunoglobulinconjugatedto horseradishperoxidase(Amersham).Membraneswere then washedand developed using chemilumunescence substrates according to manufacturer'sinstructions (enhanced chemiluminescence mixture; Amersham).

Cell Culture and Transfection. TK-tsl3 hamsterfibroblasts (15) growing in Dulbecco's modified Eagle's medium with 10% fetal bovine serumwere transfected by the standard calcium phosphate precipitation method(16).

6513

on June 14, 2020. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DNA BINDINGAND TRANSACTIVATIONACFIVITYOF A-myb

2283 CTTATTATGACTGAACAAGCAAGAAGATATCTGAGTACTTACACAGCTACCAGTAGTACILeuI1eMetThrG1uG1nA1aArgArgTyrLeuSerThrTyrThrA1aThrSerSerTh@

234 3 TCAAGAGCTCTCATACTGTAATTGTTATTAAAATTGAT@ATATGCCCCACPCCCTPACTGSerArgAlaLeuIleLeu* * *

CAGTCTCTACTAAATTAGGTTGCAGTGAAATTTTTCTCAATPAGTPGTTTPTAAAGT?GT

AAGATAGCCCTTTTAATACAGCATCTTTTTTCTATTCTATATAGTAGGCAGAAAGCTAGT

AAGTCACTTAAG000TAGATAGTTTCATAGTTTATTTTTTAAGAGATGAGATTTTTAAAA

ATTGTTTTTAAAGAACAAGAT000AAAATAATAGAATGTTCATGGATTTCTAAAAGPAAA

TTCTCATATAPTTTCTTCACAAGATATATGTTGCTACTCTCTTGATGCTGCAGTTTTGTT

ATAGATAGGTGTATGAGTATATATGATTTCTGAAATTAGTCTATGTATGGAAAGCACACA

TGATTTTATGAAGTACTTTTGCCCATGTGCTGATTTACTTAGGCTACCATTTACAAAGAA

ACACATTGAAAAGGAATTTAAAGGAAGGATAGAAAGTTGCACTACTAATTTTTTGTTTTt

TTTTTCAGAAGCAGTAAAATTAACTACAGTGTTAAATGTATTTATTTGAGCATAGTACTG

AAAACAAAAAGCATTCAAAAAAGAGTTTTTTCTTTATTAGTAAATAGTATTTTCTTAATC

TCAGAGGAGCTGAGAGTTTTGTTGAATGTATTGTACAGTAPGTAGGAGCAGGAfAACPTT

GTAAATTGGAAAG.AAGTCTGTTTTTATAATTTATTTTTATTTTTAAAGCTT 3116

1 2 3

specificity of the interaction (Fig. 3A). Similar experiments with an CAT reporter constructs driven by a segment of the c-myb promoteroligomer from the Myb-responsive human CD34 promoter containing (P1CAT; nt —78to +203) linked to synthetic Myb-binding sites (boxtwo Myb-binding sites revealed specific interaction with bacterially A of the M!M-1 promoter), or by a segment of the human CD34synthesized GST-A-myb protein (Fig. 3B). promoter (nt —293to +55). In TK-tsl3 fibroblasts transfected at a 1:1

A-myb TransactivatesPromoters Containing Myb-binding or 5:1effector:reporterratioandassayedfor CAT activity48 h later,Sites. To determine whether the DNA-binding activity of A-myb is the SV4O-A-myb effector plasmid induced a 5—8-fold increase inassociated with negative or positive effects on promoters containing CAT expression driven by the MIM-1 Myb construct (Fig. 4A) or byMyb-binding sites, we examined the ability of A-myb to transactivate the CD34 construct (Fig. 4B).

6514

2403

2463

2523

2583

2643

2703

2763

2823

2883

2943

3003

3063

Fig. 1. Novel coding and 3' untranslated sequence of A-myb cDNA. Nucleotide sequence cxtending that previously published is underlined.

A>

>Cl)0.<

>U)

0.I—I—F—

B

Fig. 2. A-myb expression in transiently trans.fected TK-ts13 cells. A, Northern blot analysis ofA-myb mRNA levels in untransfected TK-ts13cells (Lane 1) and in TK-tsl3 cells 48 h aftertransfection with empty vector (Lane 2) or pSVAmyb vector(Lane 3). 8. immunoprecipitation andWestern blot analysis of HA-tagged A-myb proteinin transfected cells as detected with the 12CManti-HAepitopemonoclonalantibody.Lanesarethe same as in A. kd@kilodalton.

Ito

@- .00

0 E. S> ‘<

> >C/) CO0. 0.

S S

I-. @_ I-

e@@ S

200kd —

97kd

68kd

43kd —

A-myb

@—@-actln

t@@ —

1 23

on June 14, 2020. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

I 2 3

DNA BINDING AND TRANSACTIVATIONACtiVITY OF A-rnyb

tion of the MIM-1-P1CAT construct was also observed with twohybrid cDNAs containing either the c-myb DNA-binding domainlinked to the putative transactivation domain of A-myb or the A-mybDNA-binding domain linked to c-myb transactivation domain (Fig.4A). These observations raise the possibility that the functional domains of c-myb and A-myb are interchangeable and that the distinctfunction of these two genes may derive from their pattern of expression and/or their preferential interaction with Myb-binding sites oftarget genes.

In contrast to the reported decrease in A-myb mRNA levels following G0 exit of peripheral blood lymphocytes by phytohemagglutinin stimulation (4), we find that A-myb mRNA levels increase on

A15@

0 10000

a.0

5.

4

A I 2 3 4 5 6 7 8 9 1011Protein - GST GSTc-myb GSTA-myb GSTA-myb3R

competitor_- - - S N - S N - S N

B 1 2 3 4 5 6 7 8

Protein - GST GSTc-myb GSTA-mybcompetitor- - - S N - S N

I5

2 3 4 5

B 4000

3000

Fig. 3. A-myb binding to Myb binding sites. A. band-shift analysis of double-strandedoligonucleotides containing Box A of the MIM-1 promoter and the recombinant GST-Amyb proteins. GST A-myb 3R indicates GST plus the A-myb DNA-binding domain; 5,specific competitor; N, nonspecific competitor. Lane 1. lysate only; Lane 2, GST proteinonly; Lane 3, GST-c-myb protein only; Lane 4. GST-c-myb protein in the presence ofspecific competitor; Lane 5, GST-c-myb protein in the presence of nonspecific competitor; Lane 6, GST-A-myb protein only; Lane 7. GST-A-myb protein in the presence ofspecificcompetitor;Lane8, GST-A-mybproteinin thepresenceof nonspecificcompetitor; Lane 9, truncated GST-A-myb protein only; Lane 10, truncated GST-A-myb proteinin the presenceof specificcompetitor;Lane I1, truncatedGST-A-mybproteinin thepresence of unspecific competitor. B, band-shift analysis of double-stranded oligonucleotides corresponding to a Myb-binding site of the CD34 promoter and the recombinantGST-A-myb protein. S, specific competitor; N, nonspecific competitor. Lanes are as in A,except that experiments with truncated GST-A-myb protein were not performed.

Fig. 4. Transactivation of c-myb-responsive promoters by pSV-A-myb in transienttransfection assay. A, transactivation of the MIM-1 promoter. Histograms of CAT activityin lysates of TK-tsl3 cells transfected with: 1 @gMIM-1-P1CAT (Lane 1); 1 pgMIM-1-PICAT plus 1 pg pSV-A myb (Lane 2); 1 pg MIM-1-P1CAT plus 1 pgpSV-c-myb (Lane 3); 1 pg MIM-1-P1CAT plus 1 pg pSV-A-myb DB-c-myb (Lane 4);1 pg MIM-1-P1CAT plus 1 pg pSV-c-myb DB-A-myb (Lane 5). Bars, mean + SD ofthree different experiments. B, transactivation of the CD34 promoter. Histograms of CATactivity in lysates of TK-tsl3 cells transfected with: 1 pg CD34.-CAT(Lane 1); 1 pgCD34-CAT plus 1 pg of pSV-A-myb (Lane 2); 1 pg CD34-CAT plus 5 pg of pSV-Amyb (Lane 3); 1 pg CD34-CAT plus 1 pg pSV-c-myb (Lane 4); 1 pg CD34-CAT plus5 pg pSV-c-myb (Lane 5). Bars, mean + SD of three different experiments.

6515

DISCUSSION

We demonstrate here that A-myb encodes a DNA-binding proteinwith sequence specificity identical or similar to that of c-myb andB-myb. More important are the data indicating transactivation of twoMyb responsive promoters (Fig. 4) which suggest a positive correlation between DNA-binding and transactivation activity. Transactiva

on June 14, 2020. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DNA BINDING AND TRANSACFIVATIONACTiVITY OF A-rnyb

S. cerevisiae is regulated by proteolysis and phosphorylation. EMBO J., 11:1775—1784,1992.

7. Smith, D. B., and Johnson, K. S. Single step purification ofpolypeptides expressed inEscherichia coli as fusions with glutathione S-transferase. Gene, 67: 31—40,1988.

8. Ness, S. A., Marknell, A., and Graf, T. The V-myboncogene product binds to andactivates the promyelocyte-specific mim-1 gene. Cell, 59: 1115—1125, 1989.

9. Melotti, P., Ku, D-H., and Calabretta, B. Regulation of expression of the hematopoietic stem cell antigen CD34: role of c-myb. J. Exp. Med., 179: 1023—1028,1994.

10. Nicolaides, N. C., Gualdi, R., Casadevall, C., Manzella, L., and Calabretta, B.Positive autoregulation of c-myb expression via Myb binding sites in the 5' flankingregionof the humanc-mybgene.Mol.Cell.Biol.,11:6166—6176,1991.

11. Chomczynski, P., and Sacchi, N. Single step method of RNA isolation by acidicguanidinium-thiocyanate phenol-chloroform extraction. Anal. Biochem., 162:156—159,1987.

12. Thomas, P. S. Hybridization of denatured RNA and small DNA fragments transferredto nitrocellulose. Proc. Natl. Acad. Sci. USA, 77: 5201—5205,1980.

13. Feinberg, A. P., and Vogelstein, B. A technique for radiolabeling DNA restrictionendonuclease fragments to high specific activity. Anal. Biochem., 132: 6—13,1983.

14. Wahl, G. M., Stein, M., and Stark, G. R. Efficient transfer of large DNA fragmentsfrom agarose gels to diazobenzyloxymethyl-paper and rapid hybridization by usingdextran sulfate. Proc. NatI. Acad. Sci. USA, 76: 3683—3687,1979.

15. Talavera, A., and Basiico, C. Temperature sensitive mutants of BHK cells affectedin cellcycleprogression.J. Cell.Physiol.,92: 425—436,1977.

16. Huttner, K. M., Barbosa, J. A., Scangos, C-A., Pratcheva, D. D., and Ruddle, F. H.DNAmediatedgenetransferwithoutearnerDNA.J. CellBiol.,91: 153—156,1981.

17. Ku, D-H., Wen, S-E., Engelhard, A, Nicolaides, N. C., Marmno,T., and Calabretta, B.C-myb transactivates cdc2 expression via Myb binding sites in the 5' flanking regionof the human c-myb gene. J. Biol. Chem., 268: 2255—2259,1993.

18. Torch, G., Selleri, L., Donelli, A., Ferrari, S., Emiia, G., Venturelli, D., Moretti, L.,and Torelli, U. Activation of c-myb expression by phytohemagglutinin stimulation innormal human T-lymphocytes. Mol. Cell. Biol., 5: 2874—2878, 1985.

19. Reed, J. C., Alpers, J. D., Nowell, P. C., and Hoover, R. G. Sequential expression ofproto-oncogenes during lectin-stimulated mitogenesis of normal human lymphocytes.Proc. Natl. Acad. Sci. USA, 83: 3982—3985,1986.

20. Reiss, K., Travali, S., Calabretta, B., and Baserga, R. Growth regulated expression ofB-myb in fibroblasts and hematopoietic cells. J. Cell. Physiol., 148: 338—343,1991.

6516

serum stimulation of T98G glioblastoma cells (not shown), suggestingthat, at least in some cell types, the pattern of A-myb expression issimilar to that of c-myb or B-myb (18—20).At present, it remainsunclear whether A-myb and c-myb are functionally similar in nonhematopoietic cells expressing A-myb or whether the regulation ofMyb-responsive genes in cells coexpressing A-myb and c-myb depends on the relative transactivating potency of each Myb familymember. The availability of a full-length A-myb cDNA enables investigations of these possibilities and a detailed analysis of the significance of the interrelationships between A-myb and the other Mybfamily members in the regulation of cell proliferation, differentiation,and development.

REFERENCES

1. Namura, N., Takahashi, M., Matsui, M., Ishii, S., Date, T., Sasamoto, S., and Ishizaki,R. Isolation of human cDNA clones of Myb related genes: A-myb and B-myb. NucleicAcids Res., 16: 11075—11039,1988.

2. Nakagoshi, H., Takemoto, Y., and Ishii, S. Functional domains of the human B-myb

gene product. J. Biol. Chem., 268: 14161—14167, 1993.3. Sala,A., andCalabretta,B. Regulationof Balb/c-3T3fibroblastproliferationby

B-myb is accompanied by selective activation of cdc2 and cyclin Dl expression. Proc.Natl. Acad. Sci. USA, 89: 10415—10419,1992.

4. Golay, J., Capucci, A., Arsura, M., Castellano, M., Rizzo, V., and Introna, M.Expression of c-myb and B-myb, but not A-myb. correlates with proliferation inhuman hematopoietic cells. Blood, 77: 149—158,1991.

5. Field,J., Nikawa,J-I.,Brock,D., McDonald,B., Rodgers,R. A., Wilson,I. A.,Lemer, R. A., and Wigler, M. Purification of a RAS-responsive adenyl cyclasecomplex from Saccharomyces cerevisiae by use of an epitope addition method. Mol.Cell. Biol., 8: 2159—2165,1988.

6. Tyers, M., Tokiva, G., Nash, R., and Futcher, B. The Cln3-cdc28 kinase complex of

on June 14, 2020. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1994;54:6512-6516. Cancer Res   Xiao-Ping Ma and Bruno Calabretta  -related Gene

myb, a c-mybDNA Binding and Transactivation Activity of A-

  Updated version

  http://cancerres.aacrjournals.org/content/54/24/6512

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/54/24/6512To request permission to re-use all or part of this article, use this link

on June 14, 2020. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from