DNA ProfilingDNA ProfilingForensic ScienceForensic Science

FlorioFlorio

Learning SequenceLearning Sequence History, DNA Structure, ChromosomesHistory, DNA Structure, Chromosomes

Sources of DNASources of DNA

DNA and the Crime SceneDNA and the Crime Scene

Methods of DNA TypingMethods of DNA Typing

Process of DNA TypingProcess of DNA Typing

CODISCODIS

Brief HistoryBrief History 1980 - 1980 - American American

researchers researchers discovered non-coding discovered non-coding regions of DNAregions of DNA

1984 - 1984 - Professor Alec Professor Alec Jeffreys developed the Jeffreys developed the process of DNA process of DNA profilingprofiling

1987 - 1987 - First conviction First conviction based on DNA based on DNA evidenceevidence

DNADNA What is DNA?What is DNA? How does DNA work?How does DNA work? Why test DNA?Why test DNA? Where can DNA be Where can DNA be

located?located?• Biological tissues?Biological tissues?• Evidence collection?Evidence collection?

How can DNA be used How can DNA be used to potentially identify to potentially identify an individual?an individual?

Can DNA evidence be Can DNA evidence be destroyed or destroyed or contaminated?contaminated?

To what extent is DNA To what extent is DNA profiling accurate?profiling accurate?

What is DNA?What is DNA? Double stranded Double stranded

helixhelix PolymerPolymer NucleusNucleus

• MitochondriaMitochondria Sugar, phosphate Sugar, phosphate

and 4 types of bases and 4 types of bases (A,T,C,G) = (A,T,C,G) = NUCLEOTIDENUCLEOTIDE

-Hydrogen bonds-Hydrogen bonds

Skin cell

Skin cell DNA

What is DNA?What is DNA?

What is DNA?What is DNA?ChromosomesChromosomes

From mom From dad

22 pairs total (traits) +X,Y or XX

Male Female

Important DefinitionsImportant Definitions

GenesGenes – DNA – DNA sequences that sequences that have instructions have instructions that determine our that determine our inherited traitsinherited traits

AlleleAllele – one of two – one of two or more alternative or more alternative forms of a gene (1 forms of a gene (1 from mom, 1 from from mom, 1 from dad)dad)

PolymorphismPolymorphism – – differences in DNA differences in DNA sequences; vary in sequences; vary in length, bases, and length, bases, and number of repeatsnumber of repeats

Review of DNAReview of DNA• What does DNA do?What does DNA do?

• Make proteins!Make proteins!• DNA DNA mRNA mRNA

ProteinsProteins

• How is it copied How is it copied during mitosis?during mitosis?• DNA Replication!DNA Replication!

Why Test DNA?Why Test DNA?Human Identity TestingHuman Identity Testing

Forensic cases -- Forensic cases -- matching suspect with matching suspect with evidenceevidence

Paternity testing -- Paternity testing -- identifying fatheridentifying father Historical investigationsHistorical investigations Missing persons investigationsMissing persons investigations Mass disasters -- Mass disasters -- putting pieces back putting pieces back

togethertogether Military DNA Military DNA ““dog tagdog tag”” Convicted felon DNA databasesConvicted felon DNA databases

Where can DNA be located?Where can DNA be located?(Biological tissue)(Biological tissue)

BloodBlood SemenSemen SalivaSaliva UrineUrine HairHair TeethTeeth BoneBone TissueTissue

DNA and the Crime SceneDNA and the Crime Scene

You could have a scene You could have a scene that looks like this…that looks like this…

DNA and the Crime SceneDNA and the Crime Scene

Or a scene that looks like this…

What are some sources of DNA What are some sources of DNA at this scene?at this scene?

Sources of DNA EvidenceSources of DNA Evidence

EvidenceEvidence Possible Location of DNA on the Possible Location of DNA on the EvidenceEvidence Source of DNASource of DNA

baseball bat or similar baseball bat or similar weaponweapon handle, endhandle, end sweat, skin, blood, tissue sweat, skin, blood, tissue

hat, bandanna, or maskhat, bandanna, or mask insideinside sweat, hair, dandruffsweat, hair, dandruff

eyeglasseseyeglasses nose or ear pieces, lensnose or ear pieces, lens sweat, skinsweat, skin

facial tissue, cotton swabfacial tissue, cotton swab surface areasurface area mucus, blood, sweat, semen, ear mucus, blood, sweat, semen, ear waxwax

dirty laundrydirty laundry surface areasurface area blood, sweat, semenblood, sweat, semen

toothpicktoothpick tipstips salivasaliva

used cigaretteused cigarette cigarette buttcigarette butt salivasaliva

stamp or envelopestamp or envelope licked arealicked area salivasaliva

tape or ligaturetape or ligature inside/outside surfaceinside/outside surface skin, sweatskin, sweat

bottle, can, or glassbottle, can, or glass sides, mouthpiecesides, mouthpiece saliva, sweatsaliva, sweat

used condomused condom inside/outside surfaceinside/outside surface semen, vaginal or rectal cellssemen, vaginal or rectal cells

blanket, pillow, sheetblanket, pillow, sheet surface areasurface area sweat, hair, semen, urine, salivasweat, hair, semen, urine, saliva

"through and through" bullet"through and through" bullet outside surfaceoutside surface blood, tissueblood, tissue

bite mark bite mark person's skin or clothingperson's skin or clothing salivasaliva

fingernail, partial fingernailfingernail, partial fingernail scrapingsscrapings blood, sweat, tissueblood, sweat, tissue

DNA and the Crime SceneDNA and the Crime Scene

The Method of DNA The Method of DNA Typing depends on…Typing depends on…

1)1)How much DNA you How much DNA you have (# of cells)have (# of cells)

2)2)Condition of the DNACondition of the DNA

3)3)Nature of the crimeNature of the crime

DNA and The Crime SceneDNA and The Crime Scene

DNA and The Crime SceneDNA and The Crime Scene

PackagingPackaging1)1)All clothing packaged separately in All clothing packaged separately in breathable bags or boxesbreathable bags or boxes

2)2)Dried blood – remove with moisten Dried blood – remove with moisten cotton swabcotton swab

3)3)Acquire a Acquire a substrate control substrate control – – unstained portion of surface on unstained portion of surface on which bio material has been which bio material has been deposited – compare to stained areadeposited – compare to stained area

Packaging DNAPackaging DNA

DNA and The Crime SceneDNA and The Crime Scene

PackagingPackaging1)1)All swabs and evidence must be All swabs and evidence must be air driedair dried!!

2)2)Refrigerated Refrigerated

3)3)Obtain Obtain buccal swabs buccal swabs from from suspectssuspects

Polymorphism critical to distinguish individuals

A.• GATCTAGCTAGCTACCTAGCTATCCTAGC• GATCTAGCTTGCTACGTAG-TATCCTAGC

eg Single Nucleotide Polymorphism B.

• GCTGCTGCTGCTGCTGCTGCTGCTGCT• GCTGCTGCT---------------GCT

eg Repeat unit (including Short Tandem Repeats - STRs)

Individuals differ on average by 0.1% at the DNA level = 3.4 million base pairs

What patterns do we observe in our genomes?

AGCTGACTGACTTTCAGCTAGCTACACGTACGCTAGCTAGCTAGACTAGCATGCATGCCATGCCATGCCATGCCATGCCATGCCATGCCATGCCATGCCCATGCTAACTTGATCGGACCGCGCGCTAGCTAGCTAGCTACACTGCTAGCCCGATCGCTAGCCTAGCAGCTGGT

What is DNA Profiling?What is DNA Profiling?

DNA PROFILINGDNA PROFILING• A process or A process or

technique of technique of analysis revealing analysis revealing unique patterns of unique patterns of an individualan individual’’s DNA s DNA involving non-involving non-coding regionscoding regions

Not enough DNA? PCR is the Not enough DNA? PCR is the answer!answer!

Polymerase chain reaction Polymerase chain reaction (PCR)(PCR)

Small quantities of DNA/broken pieces Small quantities of DNA/broken pieces of DNA can be copiedof DNA can be copied

Use enzyme Use enzyme DNA PolymeraseDNA Polymerase1 DNA molecule 1 million DNA molecules

Sample size

PCRPCR

What part of the DNA is What part of the DNA is amplified?amplified?

Short repeated segments Short repeated segments (STRs) – region of DNA molecule (STRs) – region of DNA molecule that contains short segments of that contains short segments of repeating bases (3-7 base pairs)repeating bases (3-7 base pairs)

PCRPCRPurpose – Quickly make many copies of a region of a DNA molecule

Method – Multiple rounds of DNA replication using a Thermal Cycler

* each cycle doubles amount of DNA until millions of copies are produced

Methods of AnalysisMethods of Analysis

1)Restriction Fragment Length Polymorphism (RFLP)

2)Short Tandem Repeat (STR)

* Y-STR3)Mitochondrial DNA

(Restriction Fragment Length (Restriction Fragment Length Polymorphisms - RFLP)Polymorphisms - RFLP)

9-80 bases in 9-80 bases in

lengthlength Non-coding regionsNon-coding regions Pieces cut by Pieces cut by

restriction enzymesrestriction enzymes Number of repeats Number of repeats variesvaries from one from one person to the nextperson to the next

STRsSTRs

Short Tandem Repeat Short Tandem Repeat (STR) (STR) • Repeats of 2-5 or 3-7 bases (dependent Repeats of 2-5 or 3-7 bases (dependent

on source) on source) • Shorter than samples needed for RFLPShorter than samples needed for RFLP• High degree of polymorphismHigh degree of polymorphism

Greater variation in # of repeatsGreater variation in # of repeats• More preferred method of analysisMore preferred method of analysis

Larger the strand, harder it is to Larger the strand, harder it is to separate sequencesseparate sequences

What makes Short Tandem Repeats(STR) good markers?

Repetitive sequences on all human chromosomes

High degree of genetic variability Sensitive and rapid detection Several loci can be combined in a

single test

Collect Tissue Sample

Identifying an individual?

The Big Picture

>1000 cells

RFLP PCR AnalysisPCR Analysis(STR)

>20 cells

Multiplex PCR Over 10 Markers Can Be Over 10 Markers Can Be

Copied at OnceCopied at Once Sensitivities to levels Sensitivities to levels

less than 1 ng of DNAless than 1 ng of DNA Ability to Handle Ability to Handle

Mixtures and Degraded Mixtures and Degraded SamplesSamples

Different Fluorescent Different Fluorescent Dyes Used to Dyes Used to Distinguish STR Alleles Distinguish STR Alleles with Overlapping Size with Overlapping Size RangesRanges

Y STR Analysis

Locates STRs on the Locates STRs on the Y chromosomeY chromosome

Look for about 17 Look for about 17 STRsSTRs

Helpful with sexual Helpful with sexual assaults or when assaults or when more than 1 male more than 1 male involvedinvolvedVaginal swabsVaginal swabsSalivaSalivaBloodBlood

Mitochondrial DNA AnalysisMitochondrial DNA Analysis

Inherited from Inherited from mothermother

Single mito Single mito contains many contains many loops of DNAloops of DNA

Each cell contains Each cell contains 100-1000 mito100-1000 mito

Useful when nDNA Useful when nDNA is degradedis degraded

Mitochondrial DNA AnalysisMitochondrial DNA Analysis

Charred remainsCharred remains Old remainsOld remains HairHair Mass DisastersMass Disasters Historic Historic

InvestigationsInvestigations Need living Need living

maternal relative maternal relative for a matchfor a match

Mitochondrial DNA AnalysisMitochondrial DNA Analysis

Constructed in Constructed in circular loop circular loop

Single mito Single mito contains many contains many loops of DNAloops of DNA

Each cell contains Each cell contains 100-1000 mito100-1000 mito

Useful when nDNA Useful when nDNA is degradedis degraded

The Process of DNA AnalysisThe Process of DNA Analysis

1) Extraction2) Amplification (if needed)3) Enzyme Digestion (restriction

enzymes)4) Gel or Capillary

Electrophoresis

STAGES INVOLVEDSTAGES INVOLVED

Cells broken down Cells broken down to release DNAto release DNA

DNA strands cut DNA strands cut into fragmentsinto fragments

Fragments Fragments separatedseparated

Pattern of Pattern of fragments fragments analyzedanalyzed

DNA ExtractionDNA Extraction

Enzyme DigestionEnzyme Digestion

Enzyme DigestionEnzyme Digestion

• Restriction enzymes Restriction enzymes added to sample added to sample DNADNA

• DNA cleaved at DNA cleaved at specific sitesspecific sites

• Due to varying Due to varying number of repeated number of repeated segments at these segments at these sites, DNA will be sites, DNA will be cut in varying cut in varying lengthslengths

Identifying an individual?Identifying an individual?

Techniques?Techniques?• RFLP analysisRFLP analysis

• STR analysisSTR analysis

We need more DNA!!!!!!!We need more DNA!!!!!!!Polymerase chain reaction (PCR)Polymerase chain reaction (PCR)

DNA ProfilingDNA ProfilingRFLPRFLP

Extract DNA sampleDigest DNA sample

Separate fragments by (via charge)molecular weight

Label andanalyze

Collect DNA

Gel electrophoresis

DNA ProfilingDNA ProfilingPCR/STRsPCR/STRs

Extract DNA sample

Collect DNA

PCR amplification

Capillary electrophoresis

Gel ElectrophoresisGel Electrophoresis

Fragments Fragments separated byseparated by

lengthlength DNA (negativelyDNA (negatively charged)charged) Moves towards +veMoves towards +ve terminalterminal Shorter fragments Shorter fragments

move fastermove faster

Gel TransferGel Transfer DNA split into single strands DNA split into single strands

using alkaline solutionusing alkaline solution

DNA fragments transferred DNA fragments transferred from gel to filter paper or from gel to filter paper or nylon membrane. (This is nylon membrane. (This is called Southern blotting)called Southern blotting)

Gel, with filter paper Gel, with filter paper attached, is removed & attached, is removed & separatedseparated

X-ray film

Revealing a pattern of bandsRadioactive probe in solution binds to DNA

DNA Probes

How Do DNA Probes Work?How Do DNA Probes Work?

Capillary ElectrophoresisCapillary Electrophoresis Used with STR analysisUsed with STR analysis Quick and can be automatedQuick and can be automated

• Carried out in thin, glass capillary columnCarried out in thin, glass capillary column• 2 reservoirs hold buffers connected to high 2 reservoirs hold buffers connected to high

voltagevoltage ProcessProcess

1)1) DNA injected into capillary tubeDNA injected into capillary tube

2)2) STR fragments move b/c of electrical STR fragments move b/c of electrical potentialpotential

3)3) DNA segments move through DETECTOR DNA segments move through DETECTOR

4)4) Data displayed on ELECTROPHEROGRAMData displayed on ELECTROPHEROGRAM

Capillary ElectrophoresisCapillary Electrophoresis

ABI Prism 310 Genetic Analyzer

capillary

Syringe with polymer solution

Autosampler tray

Outlet buffer

Injection electrode

Inlet buffer

ElectropherogramElectropherogram

Electropherogram with Electropherogram with amelogenin – determines sexamelogenin – determines sex

SensitivitySensitivity

• Can perform STR analysis on as little as 125 picograms• Human cell = 7 pg• You need about 18 cells

• New modification to technology allow for even fewer (9 cells)• DNA below the normal level of

detection = LOW COPY NUMBER• Sources – touch DNA, licked

envelopes

Low Copy NumberLow Copy Number

Challenges with DNA Challenges with DNA profilingprofiling

•Mixtures must be resolved (2 people in a fight, blood is mixed)

•Contamination

•DNA is often degraded

•Inhibitors to PCR are often present (dirt, soils, dyes)

Degradation of DNADegradation of DNA

HeatHeat UV lightUV light Contaminating bacteriaContaminating bacteria

FBIFBI’’s CODIS DNA Databases CODIS DNA Database

CoCombined mbined DDNA NA IIndex ndex SSystemystem Used for linking serial crimes and Used for linking serial crimes and

unsolved cases with repeat offendersunsolved cases with repeat offenders Launched October 1998Launched October 1998 Links all 50 statesLinks all 50 states Requires >4 RFLP markersRequires >4 RFLP markers and/or 13 core STR markersand/or 13 core STR markers Current backlog of >600,000 samplesCurrent backlog of >600,000 samples

13 Core Loci13 Core Loci

13 regions on various chromosomes13 regions on various chromosomes High variable regionsHigh variable regions Frequency that 2 people will have the Frequency that 2 people will have the

same sequence at that region is raresame sequence at that region is rareDepends on ethnicity/raceDepends on ethnicity/race

Odds of two caucasian individuals Odds of two caucasian individuals possessing the same 13 STRs = 1 in possessing the same 13 STRs = 1 in 575 trillion and 1 in 900 trillion in 575 trillion and 1 in 900 trillion in African Americans)African Americans)