DNA ProfilingApplications and Methodology

Ruth E. Ballard, Ph.D.Dept of Biological SciencesCalifornia State University, Sacramentoballardr@csus.edu; Forensic Science Graduate ProgramUniversity of California, Davisreballard@ucdavis.edu

Name: Ballard, RuthHair: BrownEyes: GreenHt: 5’ 2”Wt: 105Occupation: Professor and DNA/Biology Program AdvisorLast Known Addresses:Dept of Biological SciencesCalifornia State University, Sacramentoballardr@csus.edu; Forensic Science Graduate ProgramUniversity of California, Davisreballard@ucdavis.eduWanted for: Impersonating a criminalist

Why we need DNA markers

Why we need DNA markers

Short Tandem Repeat Markers

Outline

Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

Generating a profile

Applications

Definition

CODIS

DNA profiling is a scientific technique that exploits genetic differences among people to distinguish them from one another

Definition

Humans share 99.9% of their DNA On average (for unrelated individuals) 1 in

1,000 base-pairs is different

Definition

Sister chromatids

Homologues

Example: Human chromosome 1 4,220 genes (2%) 98% non-coding “junk DNA” 2.47 x 108 base-pairs Average number of differences between

unrelated homologues: 247,000 Most differences are in non-coding fraction DNA profiling exploits these differences

across all chromosomes

Definition

Short Tandem Repeat Markers

Outline

Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

Generating a profile

Applications

Definition

CODIS

Applications Solving Crimes (murder, sexual assaults,

burglaries)

Applications Missing persons and unidentified remains

Skull found in a field in the Los Gatos hills is identified as belonging to missing Vallejo child, Xiana Fairchild, 14 months after her disappearance in Dec,1999

Applications

13

Establishing Biological Relationships (child support, visitation, immigration, inheritance)

Applications Assigning twin status

◦ Identical or fraternal?

Applications Identifying victims of man-made disasters

◦ TWA Flight 800◦ Exploded and crashed July 1996 in Atlantic

Ocean off New York state

Applications Identifying victims of natural disasters

◦ “Baby 81” claimed by 9 couples after tsunami in Southeast Asia

◦ Identity confirmed as Abilass Jevarajah and reunited with biological parents

Short Tandem Repeat Markers

Outline

Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

Generating a profile

Applications

Definition

CODIS

Short Tandem Repeat Markers DNA profiling relies on short, tandemly

repeated sequences of DNA (STRs)◦ Ubiquitous in the human genome◦ Short (for DNA profiling 4 bp)

e.g. gaca, ctat, ggca, etc.◦ Highly polymorphic (many alleles in the

population) “Alleles” defined by number of repeats present (e.g.

6,7,8,9,10,11,12,13,14,15, etc.)◦ No one allele present at much higher frequencies

than others

Example: D7S820◦ Located on chromosome 7◦ Repeated sequence: 5’-gata-3’◦ Alleles observed in human population:

6,7,8,9,10,11,12,13,14,15,16

aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagttattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaactaacgatagatagatagatagatagatagatagatagatagatagatagatagatagatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttggtgcaattctgtcaatgaggataaatgtggaatcgttataattcttaagaatatatattccctctgagtttttgatacctcagattttaaggcc

Short Tandem Repeat Markers

Level of discrimination rises with number of possible alleles

Short Tandem Repeat Markers

# alleles in the

population (x)

# genotypes in the population

(x2 + x)/21 12 33 64 105 156 217 28

11 66

Short Tandem Repeat Markers Each person has only two alleles for each

STR locus◦ Can be either heterozygous or homozygous

(4,6) heterozygot

e

(5,5) homozygote

Short Tandem Repeat Markers Allele frequency tables can be used to estimate

genotype frequencies using Hardy Weinberg statistics

ALLELE FREQUENCY4 0.0015 0.0186 0.1627 0.1308 0.2629 0.250

10 0.12811 0.04512 0.00313 0.001

Frequency (4,6) = 2 pq= 2 (0.001)(0.162) = 0.000324(or 1 in 3,086 persons)

Frequency (5,5) = p2

= (0.018)2 = 0.0262(or 1 in 38 persons)

Short Tandem Repeat Markers The scientific community has chosen 13 core STR

loci for DNA profiling The amelogenin locus on the X and Y

chromosomes is also targeted for sex typing

Short Tandem Repeat Markers The loci are genetically unlinked Therefore, the inheritance of each STR is an

independent event This permits the product rule to be used

when calculating the probability of an entire profile

The genotype frequency for each locus is calculated and then they are multiplied together to provide a random match probability (RMP) for the profile

Short Tandem Repeat Markers

Random Match Probability (RMP)

The probability of randomly selecting an unrelated individual from the population who would have the same genetic profile as the person tested

For my profile:

Short Tandem Repeat Markers

Locus GenotypeD8S1179 (13,13) 0.093025D21S11 (29.3,33.2) 0.000416D7S820 (10,12) 0.080676CSF1PO (10,11) 0.130634D3S1358 (15,18) 0.079648THO1 (6,9.3) 0.170752D13S317 (11,12) 0.168144D16S539 (12,12) 0.106276D2S1338 (16,17) 0.012012D19S433 (13,14) 0.186714VWA (17,17) 0.078961TPOX (9,11) 0.057834D18S51 (12,15) 0.040386D5S818 (11,11) 0.130321FGA (20,10) 0.016129RMP 8.6177E-20

The probability of randomly selecting an unrelated individual from the population with the same genetic profile as myself is 1 in 11 quintillion!!

Short Tandem Repeat Markers

Outline

Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

Generating a profile

Applications

Definition

CODIS

DNA Profiling always starts with a biological sample◦ Cigarette butt a suspect smoked during

questioning (cheek cells in suspect’s saliva)◦ A bloody knife found in a suspect’s car (blood

cells - possibly from the victim)◦ A hair found in a ski mask left at the site of an

armed robbery (hair root cells, possibly from the suspect)

◦ Human femur bone found in a dumpster (bone cell DNA, possibly from the victim of a homicide)

◦ A reference buccal swab from an alleged father for paternity testing

Generating a Profile

Generating a Profile Lyse open cells and extract DNA

◦ PCA (organic method)◦ Spin columns◦ Robots (e.g. EZ1)

Quantify the amount of human DNA present◦ quantitative PCR (qPCR)

Amplify 13-15 STR loci in one PCR reaction◦ Multiplex◦ PCR primers are fluorescently-labeled◦ Amplicons differ by length depending on the number

of repeats present Separate and resolve amplicons by gel

electrophoresis

Primer A (forward primer)

Primer B (reverse primer)

CHROMOSOME 7 received from mother carrying 9 repeats of GATA

CHROMOSOME 7 received from father carrying 12 repeats of GATA

Amplicon from chromosome carrying 9 repeats

Amplicon from chromosome carrying 12 repeats

12 base pairs

PCR sample loaded into

capillary

Samples run through capillary according to size

(+)

(-)

As PCR products pass capillary window, a laser

excites the fluorescent tag and the tag emits a signal

The signal is sent to a computer for

interpretation and analysis

detector

Allele 14 at D7S820

Allele 11 at TPOX

Allele 14 at D7S820

Allele 7 atD7S820

Allele 9 atTPOX

X axis = Time since injection = size of amplicon

Y ax

is =

Ampl

itude

of

fluo

resc

ent s

igna

l

Blue

Green

Yellow

Red

Short Tandem Repeat Markers

Outline

Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

Generating a profile

Applications

Definition

CODIS

CODIS Established in 1994

◦ Director of FBI established a DNA Advisory Board◦ Defined and developed standards for DNA typing◦ Defined Indices for sample data banking

Fully operational in 1998◦ Stores DNA profiles from in:

Convicted Offenders Index Forensic Index Missing persons Index Missing persons reference Index Arrestee Index

◦ Allows law enforcement agencies to share information across all 50 states

BIOLOGICAL EVIDENCE AT CRIME SCENE

DNA Profile from evidence

Reference sample from victim

DNA profile of victim

Match?

Suspect(s)

DNA Profile from suspect(s)

Match?

If suspect(s) eliminated

(or no suspects)

Search Convicted Offender or Arrestee Indexes in CODIS

NO “HIT”

“HIT”

Repeat search every 7 days

Prosecute

CODIS• National (2008)• Convicted Offender profiles: 7,940,321 • Forensic profiles: 306,028 • “Hits”: 107,600

• California (2008)• Convicted Offender profiles: 1,251,307• Forensic profiles: 25,323• “Hits”: 12, 412

Short Tandem Repeat Markers

Outline

Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

Generating a profile

Applications

Definition

CODIS

Cold Case Study May 1977: Penny Parker, 15,

disappeared while out collecting money for her Sacramento Bee paper route

Found dead three days later, stabbed and sexually assaulted

At the time, the analysis of biological evidence was in its infancy

Suspect identified but insufficient evidence to charge

Cold Case Study

42

Parker case reopened in 2001

Semen stain found on panties and DNA profile obtained

Profile entered into the FBI’s national CODIS database; no match

DNA typing methods introduced in 1986 and rapidly improved in 1990’s

December 2002, samples submitted from the ex-wife and biological daughter of suspect Don Jennings.

Relationship DNA profiling showed that it was 10,000 times more likely that Mr. Jennings was the source of the semen on Penny Parker’s panties than a random, unrelated man

Judge ordered Mr. Jennings to provide DNA reference sample for comparison to DNA from semen stain on panties

Cold Case Study

January 2003, Sacramento Police Department detectives traveled to Arkansas to obtain a reference sample from Mr. Jennings.

Sample profiled and found to match the profile of the semen donor.

Mr. Jennings committed suicide in February 2003, when officers returned to Arkansas and attempted to arrest him for the rape/homicide of Parker.

Demonstrates power of biological evidence to solve crimes, even “cold” ones

Cold Case Study

American Academy of Forensic Sciences http://www.aafs.org/

U.S. Bureau of Labor Statistics http://www.aafs.org/

California Association of Criminalists http://www.cacnews.org/

STRbase (http://www.cstl.nist.gov/strbase/) U.C. Davis Forensic Science Graduate

Program http://forensicscience.ucdavis.edu/

Additional Information