Dot Plot

Dot Plot

Goal

• We will take two nucleotide base strings and look for common patterns – stretches where the bases match.

• GAATTCATACCAGATCACCGAAAACTGTCCTCCAAATGTGTCCCCCTCACACTCCCAAAT

• TCGCGGGCTTCTGCTCTTAGACCACTCTACCCTATTCCCCACACTCACCGGAGCCAAAGC

Start by entering the two sequences in question in Excel

Use the LEN Function to determine the length of the string

Set up a grid – mine was 60-by-60 since the lengths were 60

Enter the length of match one is seeking – start with 1

Enter the formula to look for matches

Anatomy of the formula (Part 1)

• =IF(MID($B$1,E$3,$B$4)=MID($B$2,$D4,$B$4),1,0)

• Recall MID takes a string $B$1 is the first base sequence and $B$2 is the second base sequence

• Then MID takes a part of the string beginning at the “second argument”

Anatomy of the formula (Part 2)

• =IF(MID($B$1,E$3,$B$4)=MID($B$2,$D4,$B$4),1,0)

• The starting point varies. • E$3 stays in the third row as the formula is

copied and uses the various numbers 1 through 60 set up in row 3.

• $D4 stays in column D and uses the various numbers 1 through 60 set up in column D.

Anatomy of the formula (Part 3)

• The third argument is the length of the match we seek. They are both the same length.

• If the two “substrings” (base mini sequences) match, output a 1, otherwise a zero.

• Then copy the formula throughout the grid.

With formula copied

Next add some conditional formatting rules

Result of Conditional Formatting

We are we looking for?

• In dot plots, one looks for dots (for us colored cells) along diagonals.

• A “long” diagonal means that the mini base sequences within the longer sequence match.

Change the length to eliminate some of the “noise”

Increasing the length of the substring match

Question

• What is the longest match between these two sequences?

Problem

• We are looking for diagonal matches; however, increasing the length of the match only allows only one of the two diagonal types to survive.

New Sheet: Enter one string and also make column of descending numbers

Enter formula that takes one letter at designated position

Use the concatenate formula to create the reversed string

Use Copy/Paste Special/Values to enter reversed string

Repeat the analysis looking for matches between one original and one reversed string

Question

• What is the longest match between these: one of the original sequences and one of the reversed sequences?