dove medical press web view0.001 32 (64) 19 (76) 0.431 gentamicin 21 (42) 14 (56) 0.327 22 (44) 10...

79
Supplementary material 1 Antibiotics tested in this study Class Abbreviatio n Antibiotic Concentration Aminoglycosides GM Gentamicin 10 ug NET Netilmicin 30 ug AMK Amikacin 30 ug Fluoroquinolone s OFX Ofloxacin 5 ug LVX Levofloxacin 5 ug NOR Norfloxacin 10 ug AN Nalidixic acid 30 ug CIP Ciprofloxacin 5 ug Penicillin AM Ampicillin 10 ug 1st-4th generation cephalosporins CF Cefalotin 30 ug CFX Cefuroxime 30 ug CFZ Ceftazidime 30 ug CTX Cefotaxime 30 ug CRO Ceftriaxone 30 ug FEP Cefepime 30 μg Monobactamic ATM Aztreonam 30 μg Penicillin with ESBL inhibitor AMC Amoxicillin- clavulanic acid 20/10 μg Sulphas TSX Trimetropim/ Sulphametoxazol 1.25/ 23.75ug Nitrofurans MAC Nitrofurantoin 300 ug Phosfonic acids FOS Fosfomycin 200 μg Phenicols C Cloramphenicol 30 ug Tetracyclines TE Tetracyclin 30mg polymyxins CL Colistin 10mg Carbapenemics ETP Ertapenem 10mg Clinical & Laboratory Standards Institute ( CLSI ) 1 1

Upload: others

Post on 23-Jan-2021

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 1 Antibiotics tested in this studyClass Abbreviation Antibiotic Concentration

AminoglycosidesGM Gentamicin 10 ugNET Netilmicin 30 ugAMK Amikacin 30 ug

Fluoroquinolones

OFX Ofloxacin 5 ugLVX Levofloxacin 5 ugNOR Norfloxacin 10 ugAN Nalidixic acid 30 ugCIP Ciprofloxacin 5 ug

Penicillin AM Ampicillin 10 ug

1st-4th generation cephalosporins

CF Cefalotin 30 ugCFX Cefuroxime 30 ugCFZ Ceftazidime 30 ugCTX Cefotaxime 30 ugCRO Ceftriaxone 30 ugFEP Cefepime 30 μg

Monobactamic ATM Aztreonam 30 μgPenicillin with ESBL

inhibitor AMC Amoxicillin-clavulanic acid 20/10 μg

Sulphas TSX Trimetropim/ Sulphametoxazol 1.25/ 23.75ug

Nitrofurans MAC Nitrofurantoin 300 ugPhosfonic acids FOS Fosfomycin 200 μg

Phenicols C Cloramphenicol 30 ugTetracyclines TE Tetracyclin 30mgpolymyxins CL Colistin 10mg

Carbapenemics ETP Ertapenem 10mgClinical & Laboratory Standards Institute (CLSI)1

1

Page 2: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 2 Genes and PAI sought in this study

PCR Genes oligonucleotides SequenceLengthBase pairs (bp)

Reference Positive control

Tm (C°)

mPCR1

fimH FimH F CCTACAGCTGAACCCAAAG 210 Arenas-Hernández unpublished data

E. coli CFT073 57.7

FimH 188 R CGAAAGATCTACGACCAG

fliC FliC 242 F GCTGTCCGAAATCAACAACAA 304 Arenas-Hernández unpublished dataFliC 445 R GGCTATCGTACCGGAACCATT

satA satA 978F CCAAAACAATGCAGATACCAC 384 Arenas-Hernández unpublished datasatA 1321R ATTACCTTACCATTTCCGCTT

iucD iucD-30F GCTGTGGCTGGTAACTCAGG 512 Arenas-Hernández unpublished dataiucD512R TGCTTCACACAGGGTGGTAAAT

mPCR2

iha IhaEMSAR CGGAATTCCGATCTCCGATCATGTTAACCG 150 Rashid et al., 20062

E. coli CFT073+

E. coli O59I61.4

IhaEMSAL CGGAATTCCGGCATGCCGAGGCAGTCGTTA

vatP vatP-86F TAGCGCGCAATTCAACAATA 226 Arenas-Hernández unpublished datavat226R GCAGATAGTGCCAGAGAGGTAAG

vatA vatA1076F CCTGGGACATAATGGTCAGAT 330 Arenas-Hernández unpublished datavatA1406R CTGGCAATATTCACGCTACTG

papGIII papG1/G3 F CATGGCTGGTTGTTCCTAAACAT 421 Tiba et al. 20083

papG2/G3 R TCCAGAGACTGTGCAGAAGGAC

papGII papG2 113F GGAATGTGGTGATTACTCAAAGG 562 Tiba et al. 20083

papG2/G3 R TCCAGAGACTGTGCAGAAGGAC

mPCR3

papA papA-45F CAGATATCTCTGGTGTGTTCAGTAA 641 Arenas-Hernández unpublished data

E. coli GAG1 61.4

papA+31R GGTCTTGCCTCACCCTGTAA

satP satP 82F AGCAAGCTGTTAGTAACCAACC 880 Arenas-Hernández unpublished datasatP 773R GAGCCGCTGTCTCCGAATA

hlyA hlyA-133F ACTCATGTTGGTAAAGTATCAGAAT 1, 280 Arenas-Hernández unpublished datahlyA1348R AGCCAGTACAGTGCTTATCGTTG

PCRcnf-1 cnf-1 CNF1-71F CTCGCCCAGTGATTAGGTATTC 3, 100 Arenas-Hernández unpublished data E. coli GAG1 61.4CNF1 +60R GCGCTAACAAAACAGCACAAGG

PAI mPCR-1

PAIICFT073RPAi GGACATCCTGTTACAGCGCGCA 930 Sabaté et. al., 20064

E. coli CFT073

60.1

RPAf TCGCCACCAATCACAGCGAAC

PAIIICFT073cft073.2Ent1 ATGGATGTTGTATCGCGC 400 Sabaté et. al., 20064

cftO73.2Ent2 ACGAGCATGTGGATCTGC

PAI mPCR-2

PAIIJ96papGIF TCGTGCTCAGGTCCGGAATTT 400 Sabaté et. al., 20064

E. coli J96papGIR TGGCATCCCACATTATCG

PAIIIJ96hlyd GGATCCATGAAAACATGGTTAATGGG 2,400 Sabaté et. al., 20064

cnf GATATTTTTGTTGCCATTGGTTACC

Supplementary material 3 Antibiotic resistance in UPEC strains by study group and geographic area

Class of antibiotics Specifics antibioticsPregnant (n= 75) p=0.743 Non-pregnant (n= 75) p= 0.601

Sonora Pueblapb Sonora Puebla

pb

n=50 (%) n=25 (%) n=50 (%) n=25 (%)

AminoglycosidesAmikacin 31 (62) 24 (96) 0.001 32 (64) 19 (76) 0.431

Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037

β-lactams

Ampicillin 50 (100) 25 (100) - 50 (100) 25 (100) -Cefalotine 48 (96) 24 (96) 1 49 (98) 25 (100) 1

Cefuroxime 41 (82) 25 (100) 0.025 50 (100) 23 (92) 0.108Cefotaxime 35 (70) 20 (80) 0.417 47 (94) 20 (80) 0.107Ceftazidime 37 (74) 21 (84) 0.393 33 (66) 19 (76) 0.435Ceftriaxone 41 (82) 24 (96) 0.15 50 (100) 24 (96) 0.333Cefepime 19 (38) 8 (32) 0.799 14 (28) 6 (24) 0.787

Aztreonam 20 (40) 15 (60) 0.141 15 (30) 11 (44) 0.304Amoxicillin/ Clavulanic Ácid 37 (74) 23 (92) 0.075 47 (94) 22 (84) 212

Fluoroquinolones

Nalidixic ácid 37 (74) 17 (68) 0.596 37 (74) 18 (72) 1Ciprofloxacin 29 (58) 10 (40) 0.152 22 (44) 13 (52) 0.624

Ofloxacin 27 (54) 12 (48) 0.634 18 (36) 14 (56) 0.137Norfloxacin 28 (56) 13 (32) 0.055 19 (38) 14 (56) 0.149

Levofloxacin 29 (58) 13 (32) 0.049 16 (32) 11 (44) 0.321Nitrofurantoins Nitrofurantoin 20 (40) 16 (64) 0.085 41 (82) 17 (68) 0.242Sulphonamides Cotrimoxazole 32 (64) 11 (44) 0.137 35 (70) 17 (68) 1Phosphonates Fosfomycin 2 (4) 5 (20) 0.037 2 (4) 1 (4) 1

Phenicols Chloramphenicol 30 (60) 9 (36) 0.085 25 (50) 11 (44) 0.806Tetracyclines Tetracyclin 35 (70) 13 (52) 0.304 29 (58) 18 (72) 0.313Polimixyns Colistin 35 (70) 14 (56) 0.136 34 (68) 17 (68) 1

Carbapenems Ertapenem 6 (12) 5 (20) 0.489 4 (8) 0 (0) 0.294

2

Page 3: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

pb: Fisher test exact. In bold the statistically significant values.

3

Supplementary material 4.1 Possible classification and type of beta-lactamases, according to the antibiotic resistance by Kirby-Bauer and substrate profile by double-disk diffusion test, of isolated strains of pregnant and non-pregnant women in Puebla.

Strain Source AMP AMC1GC 2GC 3GC 3GC 3GC 4GC CARB

ATM Substrate Profile β-lactamaseCF CFX CFZ CTX CRO FEP ETP3 Pregnant R R R R S S R S S S FEP ESBL

11 Pregnant R R R R S R R S S S CFZ ESBL13 Pregnant R S R R S S R S S S FEP ESBL16 Pregnant R R R R R R R S S S CFZ,CTX ESBL20 Pregnant R R R R R R R R S R CTX ESBL22 Pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL27 Pregnant R R R R R R S S S R CFZ ESBL30 Pregnant R R R R R R R S S R CRO,ATM ESBL35 Pregnant R R R R R R R R S R CTX,FEP, ATM ESBL37 Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL38 Pregnant R R R R R R R R S R CTX,FEP, ATM ESBL39 Pregnant R R R R R R R S S R FEP ESBL42 Pregnant R R R R R R R R R R CTX,FEP,ATM CP45 Pregnant R R R R R R R S S R CTX,FEP,ATM ESBL46 Pregnant R R R R R R R S R R ATM CP47 Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL50 Pregnant R R R R R R R R S R CTX ESBL1 Non- Pregnant R R R R S S R S S S FEP ESBL

26 Non- Pregnant R R R R R R R S S R CFZ ESBL29 Non- Pregnant R R R R R R R R S R CTX,CRO,FEP ESBL33 Non- Pregnant R R R R R R R R S R CTX,CRO,FEP,ATM ESBL36 Non- Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL

Page 4: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

1GC: First generation Cephalosporin; 2GC: Second generation Cephalosporin; 3GC: Third generation Cephalosporin; 4GC: Fourth generation Cephalosporin; R: Resistant; S: Sensitive; ESBL: Extended spectrum β -lactamase ; CP: Carbapenemase; AMP: Ampicilin; AMC: Amoxicilin/Clavulanic Acid; CF: Cefalotin; CFX: Cefuroxime; FEP: Cefepime; CFZ: Ceftazidime; CTX: Cefotaxime; ATM: Aztreonam; CRO: Ceftriaxone. This analysis was carry out following the criteria of Bush et al., 2010 and Piccazo et al., 2011 5,6.

4

Page 5: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 4.2 Possible classification and type of beta-lactamases, according to the antibiotic resistance by Kirby-Bauer and substrate profile by double-disk diffusion test, of isolated strains of pregnant women in Sonora (n=22)

Strain Source AMP AMC1GC 2GC 3GC 3GC 3GC 4GC CARB

ATM Substrate Profile β-lactamaseCF CFX CFZ CTX CRO FEP ETP2 Pregnant R R R R R R R R S R CFZ,CTX,ATM ESBL5 Pregnant R R R R R R R R S R CTX,ATM ESBL6 Pregnant R R R R S S R S S S CRO,ATM ESBL7 Pregnant R R R R S S S S S S CFZ ESBL8 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL9 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL

13 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL16 Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL17 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL18 Pregnant R R R R R R R R R R CFZ,CTX,CRO,FEP, ATM CP19 Pregnant R R R R R R R R R R CTX,FEP, ATM CP21 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL22 Pregnant R R R S R S S S S S CFZ ESBL23 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL27 Pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL28 Pregnant R R R R R R R R S S CFZ,CTX,FEP,ATM ESBL29 Pregnant R R R R R R R R S S CFZ,CTX,FEP,ATM ESBL32 Pregnant R S R R R R R S S S CTX ESBL34 Pregnant R R R R S R R S S S CRO ESBL36 Pregnant R R R R S S R S S S CFZ ESBL40 Pregnant R R R R R S S S S S CFZ ESBL44 Pregnant R R R R R R R R R S CTX,FEP CP

5

Page 6: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

1GC: First generation Cephalosporin; 2GC: Second generation Cephalosporin; 3GC: Third generation Cephalosporin; 4GC: Fourth generation Cephalosporin; R: Resistant; S: Sensitive; ESBL: Extended spectrum β -lactamase ; CP: Carbapenemase; AMP: Ampicilin; AMC: Amoxicilin/Clavulanic Acid; CF: Cefalotin;

CFX: Cefuroxime; FEP: Cefepime; CFZ: Ceftazidime; CTX: Cefotaxime; ATM: Aztreonam; CRO: Ceftriaxone. This analysis was carry out following the criteria of Bush et al., 2010 and Piccazo et al., 2011 5,6.

6

Page 7: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 4.3 Possible classification and type of beta-lactamases, according to the antibiotic resistance by Kirby-Bauer and substrate profile by double-disk diffusion test, of isolated strains of non-pregnnt women in Sonora (n=23)

Strain Source AMP AMC1GC 2GC 3GC 3GC 3GC 4GC CARB

ATM Substrate Profile β-lactamaseCF CFX CFZ CTX CRO FEP ETP2 Non-pregnant R R R R R R R S S S CFZ,CRO ESBL6 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL7 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL8 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL9 Non-pregnant R R R R R R R R S R CTX,FEP,ATM ESBL

10 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL11 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL12 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL13 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL17 Non-pregnant R R R R R R R R S R FEP ESBL18 Non-pregnant R R R R R R R S S R CTX ESBL19 Non-pregnant R R R R S R R S S S CFZ,CRO ESBL22 Non-pregnant R R R R S R R S R S CFZ,FEP CP24 Non-pregnant R R R R S R R S S S CFZ,CTX ESBL37 Non-pregnant R S R R R R R S S S CFZ,FEP ESBL40 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL41 Non-pregnant R R R R S R R S S S CRO ESBL42 Non-pregnant R R R R R R R R S R CTX,CRO,FEP,ATM ESBL45 Non-pregnant R R R R S R R S S S CFZ,CTX,CRO ESBL47 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL48 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL49 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL50 Non-pregnant R R R R S R R S S S CFZ,CTX,FEP ESBL

7

Page 8: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

1GC: First generation Cephalosporin; 2GC: Second generation Cephalosporin; 3GC: Third generation Cephalosporin; 4GC: Fourth generation Cephalosporin; R: Resistant; S: Sensitive; ESBL: Extended spectrum β -lactamase ; CP: Carbapenemase; AMP: Ampicilin; AMC: Amoxicilin/Clavulanic Acid; CF: Cefalotin; CFX: Cefuroxime; FEP: Cefepime; CFZ: Ceftazidime; CTX: Cefotaxime; ATM: Aztreonam; CRO: Ceftriaxone. This analysis was carry out following the criteria of Bush et al., 2010 and Piccazo et al., 2011 5,6.

8

Page 9: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 5 ESBL production and antibiotic resistance in UPEC strains from Sonora and Puebla

Antibiotic

SONORAn= 100

PUEBLAn= 50

Pregnantn= 50

Non-pregnantn= 50

Pregnantn= 25

Non-pregnantn= 25

ESBL+n=22 (%)

ESBL-n=28 (%) pb ESBL+

n= 23 (%)ESBL-

n= 27 (%) pb ESBL+n= 17 (%)

ESBL-n= 8 (%) pb BLEE+

n= 5 (%)BLEE-

n= 20 (%) pb

Amikacin 15 (68) 16 (57) 0.55 16 (70) 16 (59) 0.55 17 (100) 7 (88) 0.32 4 (80) 15 (75) 1Gentamicin 11 (50) 10 (36) 0.39 13 (57) 9 (33) 0.15 10 (59) 4 (50) 1 3 (60) 7 (35) 0.35Netilmicin 2 (9) 3 (11) 1 0 (0) 2 (7) 0.49 6 (35) 0 (0) 0.12 1 (20) 4 (20) 1

Nalidixic acid 18 (82) 19 (68) 0.33 15 (65) 22 (81) 0.21 14 (82) 3 (38) 0.06 2 (40) 16 (80) 0.11Ciprofloxacin 16 (72) 13 (46) 0.08 12 (52) 10 (37) 0.39 9 (53) 1 (12.5) 0.08 1 (20) 12 (60) 0.16

Ofloxacin 15 (68) 12 (43) 0.09 10 (43) 8 (30) 0.56 10 (59) 2 (25) 0.2 2 (40) 12 (60) 0.62Norfloxacin 15 (68) 13 (46) 0.15 10 (43) 9 (33) 0.56 8 (47) 0 (0) 0.02 2 (40) 12 (60) 0.62

Levofloxacin 16 (72) 13 (46) 0.08 10 (43) 6 (22) 0.13 8 (47) 0 (0) 0.02 1 (20) 10 (50) 0.34Trimethoprim-

Sulfamethoxazole 19 (86) 13 (46) 0.006 22 (96) 13 (48) 0 8 (47) 3 (38) 1 4 (80) 13 (65) 1

Nitrofurantoin 9 (40) 11 (39) 1 17 (74) 24 (89) 0.26 10 (59) 6 (75) 0.66 5 (100) 11 (55) 0.12Chloramphenicol 16 (72) 14 (50) 0.14 14 (61) 11 (41) 0.25 6 (35) 3 (38) 1 0 (0) 11 (55) 0.04

Ampicillin 22 (100) 28 (100) - 23 (100) 27 (100) - 17 (100) 8 (100) - 5 (100) 20 (100) -Cefalotin 22 (100) 26 (93) 0.49 22 (96) 27 (100) 0.46 17 (100) 7 (88) 0.32 5 (100) 20 (100) -

Cefuroxime 21 (95) 20 (71) 0.06 23 (100) 27 (100) - 17 (100) 8 (100) - 5 (100) 18 (90) 1Ceftazidime 18 (82) 19 (68) 0.33 17 (74) 16 (59) 0.37 14 (82) 7 (88) 1 4 (80) 15 (75) 1Cefotaxime 17 (77) 18 (65) 0.36 23 (100) 24 (88) 0.23 15 (88) 5 (62.5) 0.28 4 (80) 16 (80) 1Ceftriaxone 19 (86) 22 (79) 0.71 23 (100) 27 (100) - 16 (94) 8 (100) 1 5 (100) 19 (95) 1Cefepime 15 (68) 4 (14) 0 14 (61) 0 (0) 0 8 (47) 0 (0) 0.02 2 (40) 4 (20) 0.56

Aztreonam 15 (68) 5 (18) 0 15 (65) 0 (0) 0 12 (70) 3 (38) 0.19 4 (80) 7 (35) 0.13Amoxicilin- clavulanic

acid 21 (95) 16 (57) 0 22 (96) 25 (93) 1 16 (94) 7 (88) 1 5 (100) 16 (80) 0.54

Fosfomycin 1 (4) 1 (4) 1 0 (0) 2 (7) 0.49 3 (18) 2 (25) 1 1 (20) 0 (0) 0.2Colistin 16 (72) 19 (68) 0.76 14 (61) 20 (74) 0.37 10 (59) 4 (50) 1 2 (40) 15 (75) 0.28

Tetratcyclin 22 (100) 13 (46) 0 15 (65) 14 (52) 0.39 10 (59) 3 (38) 0.4 3 (60) 15 (75) 0.59Ertapenem 3 (12) 3 (11) 1 1 (4) 3 (11) 0.61 2 (12) 3 (38) 0.28 0 (0) 0 (0) -

pb: Fisher test exact. In bold the statistically significant values

9

Page 10: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 6.1 (Figure 2 data). Virulence genes distribution in E. coli isolates from urine of pregnant and non-pregnant women from Sonora (A) and Puebla (B), Mexico.

(A) E. coli isolates from women in Sonora (n=100) p valuea1= 0.170

Genes Pregnant (%)n=50

Non-pregnant (%)n=50

Totaln=100 (%) p valuea2

fimH 50 (100) 50 (100) 100 (100) -

papG+papA 13 (26) 6 (12) 19 (19) 0.124

iha 23 (46) 33 (66) 56 (56) 0.069

iucD 46 (92) 44 (88) 90 (90) 0.740

satA+satP 13 (26) 16 (32) 29 (29) 0.659

vatA+vatP 17 (34) 12 (24) 29 (29) 0.378

hlyA 22 (44) 11 (22) 33 (33) 0.032

cnf1 7 (14) 5 (10) 12 (12) 0.759

ªfliC 19 (38) 14 (28) 33 (33) 0.306

(B) E. coli isolates from women in Puebla (n=50) pa1= 0.300

Genes Pregnant (%)n=25

Non-pregnant (%)n=25

Totaln=50 (%) p valuea2

fimH 25 (100) 25 (100) 50 (100) -

papG+papA 10 (40) 12 (48) 22 (44) 0.776

Iha 15 (60) 17 (68) 32 (64) 0.768

iucD 21 (84) 19 (76) 40 (80) 0.725

satA+satP 10 (40) 11 (44) 21 (42) 1

vatA+vatP 10 (40) 3 (12) 13 (26) 0.050

hlyA 14 (56) 8 (32) 22 (44) 0.153

cnf1 2 (8) 7 (28) 9 (18) 0.138

fliC 11 (44) 4 (16) 15 (30) 0.062

fimH: gene that codified for the type 1 pilus adhesin; papG+papA: genes that codified for adhesin and pilin of the type P pili; iha: gene that codified for the enterobactin receptor/Irg homologue adhesin; iucD: gene that codified for the aerobactin receptor; satA+satP: genes that codified for autotransporter and peptidase regions of the secreted autotransporter toxin; vatA+vatP: genes that codified for autotransporter and peptidase regions of the vacuolating autotransporter toxin; hlyA: gene that codified for the pro-α-hemolysin; cnf-1: gene that codified for the cytotoxic necrotizing factor; fliC: gene that codified for the subunit of flagelin. pa1: Statistic analysis of the number of virulence genes between study groups; pa2: Statistic analysis of the major prevalence of each virulence genes between study groups. In bold the statistically significance results. pa: Fisher’s exact test.

10

Page 11: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 6.2 Prevalence of virulence genes by geographical areaGen Sonora n= 100 (%) Puebla n= 50 (%) pa

fimH 100 (100) 50 (100) -papG+papA 19 (19) 22 (44) 0.001

iha 56 (56) 32 (64) 0.38iucD 90 (90) 40 (80) 0.12

satA+satP 29 (29) 21 (42) 0.14vatA+vatP 29 (29) 13 (26) 0.84

hlyA 33 (33) 22 (44) 0.1cnf-1 12 (12) 9 (18) 0.32fliC 33 (33) 15 (30) 1

pc: x2; -: the value of p could not be obtained; In bold the statistically significant values.

11

Page 12: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 7 Prevalence of genes reported in PAIs

Gen/PAI Sonoraa

n (%)Pueblab

n (%)hlyA 33 (33) 22 (44)

PAI ICFT073 35 (35) 29 (58)

PAI IJ96 9 (9) 9 (18)

PAI IIJ96 8 (8) 13 (26)

cnf-1 12 (12) 9 (18)PAI IIJ96 8 (8) 13 (26)

papG+papA 19 (19) 22 (44)PAI ICFT073 35 (35) 29 (58)

PAI IICFT073 36 (36) 18 (36)

PAI IJ96 9 (9) 9 (18)a. 100 was the total number of strains; b. 50 was the total number of strainsIn bold virulence factors that are localized in PAIs

12

Page 13: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary material 8.1. Iron uptake phenotype of UPEC strains isolated from Puebla.

C-: Negative control. Strains 20 and 23 have halo with double coloration (Yellow-Orange). The method was modify from Sung et al., 2011 7.

Supplementary material 8.2. Hemolysis phenotype of UPEC strains isolated from Puebla

C-: Negative control

13

Page 14: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary Material 9 Correlation between hemolytic phenotype and hlyA genotype in UPEC strains isolated from Sonora and Puebla

Study group hemolytic phenotype Genotype (hlyA) hlyA+hemolytic phenotypePregnant from Sonora 19 (38) 22 (44) 8 (16)

Non-pregnant from Sonora 28 (56) 11 (22) 6 (12)

Pregant from Puebla 11 (44) 14 (56) 6 (24)

Non-pregnant from Puebla 7 (28) 8 (32) 2 (8) Pregnant from Sonora n= 50; Non-pregnant from Sonora n= 50; Pregnant from Puebla n=25; Non-pregnant from Puebla n=25.

14

Page 15: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary 10.1 Serotypes found in the E. coli strains isolated from pregnant women (n = 25) in Puebla and pathotypes or associated clinical reports.

SerotypeSerotype associated to

pathotype or clinic case

n (%) Accumulated % Reference

O18ac:H7UPEC

2 (8%)36% Wiles, Kulesus, &

Mulvey, 20088O25:H4 4 (16%)O6:H1 3 (12%)

O7:H18 ETEC 1 (4%) 4% Cravioto, R.J. Gross, 19799

O1:H- STEC or UPEC 1 (4%) 4%

Blanco, et al., 2004; Constantiniu,2013; Rodriguez-Angeles,

2002; Wiles, Kulesus, & Mulvey, 20088,10–12

O2:H6 Heteropathogenic E. coli 2 (8%) 8% Bielaszewska, et al.,

201413

O15:H1 Isolated from diarrhea in Mexico

1 (4%)8% Bourdin, et al.,201414

O48:H30 1 (4%)

O8:H25 isolated from lactating calves 1 (4%) 4%

Donaldson, et al., 200615

OR:H4Unreported

2 (8%)16% -

O139:H9 2 (8%)O?:H-

NT

1 (4%)

28% -O?:H? 2 (8%)

O?:H36 1 (4%)O?:H40 1 (4%)O25:H? 2 (8%)

UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin-producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.

15

Page 16: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Serotype Serotype associated to pathotype or clinic case n=25 (%) Accumulated % Reference

O1:H6

UPEC

1 (4%)

28%

Wiles, Kulesus, & Mulvey, 20088

O102:H6 2 (8%) Molina-López, et al., 201116

O25:H4 3 (12%) Wiles, Kulesus, & Mulvey, 20088O6:H1 1 (4%)

O27:H-

ETEC

1 (4%)

16% Cravioto, R.J. Gross, 19799CrO7:H18 2 (8%)

OR:H10 1 (4%)

OR:H- STEC 1 (4%) 4% Constantiniu, 200211

O15:H18 EAEC, EPEC and isolated from ITU cases in USA 2 (8%) 8%

Regua-Mangia, et al., 2010; Rodriguez-Angeles,

20028,10–12

O2:H6 Hereropatogenic E. coli 2 (8%) 8% Bielaszewska, et al., 201413

O16:H-

Unreported

1 (4%)

24% -OR:H4 1 (4%)

OR:H7 4 (16%)

O?:H-NT

2 (8%)16% -

O?:H? 2 (8%)Supplementary10.2 Serotypes found in the E. coli strains from non-pregnant women (n=25) in Puebla and pathotypes or associated clinical reports.UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.

16

Page 17: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Supplementary 10.3 Serotypes found in the E. coli strains isolated from pregnant women (n = 50) in Sonora

Serotype Serotype associated to -pathotype or clinic case n=50 (%) Accumulated % Reference

025:H4

UPEC

8 (16%)

28%Wiles, et al., 20088

06:H1 4 (8%)

O153:H6 2 (4%) Regua-Mangia. et al., 201017

O78:H- STEC 3 (6%) 8%Lienemann & Salo,

201218

O6:H10 1 (2%) Blanco, et al., 200319

O75:H- UPEC or STEC 4 (8%) 8% Rodriguez-Angeles, 200210

O44:H18 EAEC 1 (2%) 2% Rodriguez-Angeles, 200210

O15:H18 EAEC, EPEC and isolated from ITU cases in USA 3 (6%) 6% Regua-Mangia, et al.,

201017

O2:H6 Heteropatogenic E. coli 2 (4%) 4% Bielaszewska, et al., 201413

O2:H4 Isolated from diarrhea in humans

1 (2%) 6% Bourdin, et al., 201414

OR:H9 2 (4%)

O20:H9 Isolated from neonatal sepsis 9 (18%) 18% Carrillo-Casas, et al., 201320C

O165:H10 Associated with hemolytic uremic syndrome 1 (2%) 2% Regua-Mangia, et al.,

201017

O2:H- Others 1 (2%)4% Pearce, et al., 201021

O21:H10 1 (2%)O132:H10

Unreported

1 (2%)

10% -

O149:H20 1 (2%)O175:H5 1 (2%)O41:H34 1 (2%)

O78:H1 1 (2%)

O?:H-NT

1 (2%)6% -O?:H1 1 (2%)

O?:H11 1 (2%)UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.

17

Page 18: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.

Supplementary 10.4 Serotypes found in the E. coli strains isolated from non-pregnant women (n = 50) in Sonora.

Serotype Serotype associated to pathotype or clinic case n=50 (%) Accumulate

d % Reference

O75:H44UPEC

1 (2%)18% Wiles, et al, 2008;

Sainz, et al,20088,22O25:H4 4 (8%)O6:H1 4 (8%)

O153:H18

STEC

1 (2%)

10%

Zhang, et al., 200223

O73:H18 1 (2%)O78:H- 1 (2%) Cravioto, et al., 19799

O8:H19 1 (2%) Blanco, et al., 200319

O9:H21 1 (2%)

O75:H- UPEC or STEC 2 (4%) 4% Regua-Manguia, et al. 201017

O7:H15 ETEC 1 (2%) 2% Rowe, et al., 19799

015:H18 EAEC, EPEC and isolated from UTI cases 3 (6%) 6%Rodriguez-Angeles,

2002; Regua-Mangia, et al., 201010,17

O2:H6 Heteropatogenic E. coli 1 (2%) 2% Bielaszewska, et al., 201413

O20:H9 Isolated from neonatal sepsis 4 (8%) 8% Carrillo-Casas, et al., 201320

O22:H1 Isolated from diarrhea in humans 1 (2%) 12% Bourdin, et al., 201414

O44:H18 5 (10%)O101:H9 Isolated from animal infections 1 (2%) 6% Poppe, et al., 200424

O9:H- 2 (4%) Blanco, et al.,200319

O178:H10

Unreported

1 (2%)

18% -

O21:H4 1 (2%)O53:H10 1 (2%)

O8:H1 1 (2%)O8:H25 1 (2%)OR:H19 1 (2%)OR:H25 1 (2%)O1:H15 2 (4%)O?:H-

NT

1 (2%)

14% -

O?:H10 1 (2%)O?:H18 1 (2%)O?:H7 1 (2%)O?:H9 1 (2%)

O101:H? 1 (2%)O48:H? 1 (2%)

19

Page 19: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

The results were analyzed using two samples test and Fisher test using the Minitab 18, Statistix 10 trial and GraphPad Prims 6 software. The level of significance was set at a p value 0.05.

In this document we shown the statistical analysis for each result in the paper.

ANTIBIOTIC RESISTANCE

This table show the number of tested antibiotics to which each strain obtain in Sonora Resist,

Strain ID Number of antibiotics tested antibiotics to which each strain is resistant

Non-pregnant women from Sonora

Pregnant women from Sonora

1 13 12

2 16 18

3 10 8

4 9 5

5 6 18

6 18 10

7 12 7

8 20 20

9 19 18

10 17 7

11 18 10

12 14 11

13 18 20

14 11 6

15 18 3

16 10 18

17 15 10

18 13 21

19 10 19

20 14 8

21 13 20

22 13 8

23 10 19

24 11 10

25 14 17

26 14 8

27 12 20

20

Page 20: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

28 12 22

29 14 21

30 7 12

31 15 12

32 18 11

33 14 11

34 12 13

35 12 13

36 18 11

37 9 16

38 11 12

39 15 6

40 14 11

41 12 16

42 21 19

43 11 16

44 16 19

45 13 10

46 13 17

47 20 17

48 17 7

49 16 21

50 16 21

Then we compare the mean of resistance between the two study groups (strains from preganant women vs strains from non-pregnant women in Sonora)

 Descriptive Statistics

Study group MeanStandard deviation Minimum Median Maximum asymmetry

Non-pregnant women

13.880 3.414 6.000 14.000 21.000 0.03

Pregnant women 13.700 5.281 3.000 12.500 22.000 -0.09

Two samples test

μ₁: media de la muestra 1

µ₂: media de la muestra

21

Page 21: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

2

Diferencia: μ₁ - µ₂

No se presupuso igualdad de varianzas para este análisis.

Estadísticas descriptivas

Muestra NMedia Desv.Est.

Errorestándarde lamedia

Muestra 1 50 13.88 3.40 0.48

Muestra 2 50 13.70 5.20 0.74

Estimación de la diferencia

Diferencia

IC de 95%para ladiferencia

0.180 (-1.567, 1.927)

Prueba

Hipótesis nula H₀: μ₁ - µ₂ = 0

Hipótesis alterna

H₁: μ₁ - µ₂ ≠ 0

Valor T GL Valor p

0.20 84 0.838

Then we analyze if there was a difference in the resistance to each specific antibiotic between both groups.

Estadísticas tabuladas: Amikacina, Columnas de la hoja de trabajo

Filas: Amikacina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes

Sonora Nogestantes Todo

Amikacina Resistente 31 32 63

Amikacina Sensible 19 18 37

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

22

Page 22: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

1

Estadísticas tabuladas: Gentamicina, Columnas de la hoja de trabajo

Filas: Gentamicina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_1

Sonora Nogestantes_1 Todo

Gentamicina Resistente 21 22 43

Gentamicina Sensible 29 28 57

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1.00000

Estadísticas tabuladas: Netilmicina, Columnas de la hoja de trabajo

Filas: Netilmicina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_2

Sonora Nogestantes_2 Todo

Netilmicina Resistente 5 2 7

Netilmicina Sensible 45 48 93

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.436032

Estadísticas tabuladas: Ácido nalidixico, Columnas de la ... a de trabajo

Filas: Ácido nalidixico   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_3

Sonora Nogestantes_3 Todo

Ácido nalidixico Resistente 37 37 74

Ácido nalidixico Sensible 13 13 26

Todo 50 50 100

23

Page 23: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: Ciprofloxacino, Columnas de la hoja de trabajo

Filas: Ciprofloxacino   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_4

Sonora Nogestantes_4 Todo

Ciprofloxacina Resistente 29 22 51

Ciprofloxacina Sensible 21 28 49

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.229902

Estadísticas tabuladas: Ofloxacino, Columnas de la hoja de trabajo

Filas: Ofloxacino   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_5

Sonora Nogestantes_5 Todo

Ofloxacina Resistente 27 18 45

Ofloxacina Sensible 23 32 55

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.107356

Estadísticas tabuladas: Norfloxacino, Columnas de la hoja de trabajo

Filas: Norfloxacino   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_6

Sonora Nogestantes_6 Todo

Norfloxacina Resistente 28 19 47

Norfloxacina Sensible 22 31 53

24

Page 24: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.108508

Estadísticas tabuladas: Levofloxacino, Columnas de la hoja de trabajo

Filas: Levofloxacino   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_7

Sonora Nogestantes_7 Todo

Levofloxacina Resistente 29 16 45

Levofloxacina Sensible 21 34 55

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0154245

Estadísticas tabuladas: Ampicilina, Columnas de la hoja de trabajo

Filas: Ampicilina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_8

Sonora Nogestantes_8 Todo

Ampicilina Resistente

50 50 100

Ampicilina Sensible 0 0 0

Todo 50 50 100

Contenido de la celda      Conteo

* ERROR * No se puede calcular la Prueba exacta de Fisher.

Estadísticas tabuladas: Cefalotina, Columnas de la hoja de trabajo

Filas: Cefalotina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_9

Sonora Nogestantes_9 Todo

Cefalotina Resistente 48 49 97

25

Page 25: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Cefalotina Sensible 2 1 3

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: Cefuroxima, Columnas de la hoja de trabajo

Filas: Cefuroxima   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_10

Sonora Nogestantes_10 Todo

Cefuroxima Resistente 41 50 91

Cefuroxima Sensible 9 0 9

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0026342

Estadísticas tabuladas: Ceftazidima, Columnas de la hoja de trabajo

Filas: Ceftazidima   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_11

Sonora Nogestantes_11 Todo

Ceftazidima Resistente 37 33 70

Ceftazidima Sensible 13 17 30

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.513094

Estadísticas tabuladas: Cefotaxima, Columnas de la hoja de trabajo

Filas: Cefotaxima   Columnas: Columnas de la hoja de trabajo

26

Page 26: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

SonoraGestantes_12

Sonora Nogestantes_12 Todo

Cefotaxima Resistente 35 47 82

Cefotaxima Sensible 15 3 18

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0033040

Estadísticas tabuladas: Ceftriaxona, Columnas de la hoja de trabajo

Filas: Ceftriaxona   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_13

Sonora Nogestantes_13 Todo

Ceftriaxona Resistente 41 50 91

Ceftriaxona Sensible 9 0 9

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0026342

Estadísticas tabuladas: Cefepime, Columnas de la hoja de trabajo

Filas: Cefepime   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_14

Sonora Nogestantes_14 Todo

Cefepime Resistente 19 14 33

Cefepime Sensible 31 36 67

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.395160

Estadísticas tabuladas: Aztreonam, Columnas de la hoja de trabajo

27

Page 27: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Filas: Aztreonam   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_15

Sonora Nogestantes_15 Todo

Aztreonam Resistente 20 15 35

Aztreonam Sensible 30 35 65

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.401883

Estadísticas tabuladas: Amoxicilina-Ácido Clavulánico, ... ja de trabajo

Filas: Amoxicilina-Ácido Clavulánico   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_16

Sonora Nogestantes_16 Todo

Amoxicilina-Ácido Clavulánico R 37 47 84

Amoxicilina-Ácido Clavulánico S 13 3 16

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0122176

Estadísticas tabuladas: Trimetoprim con sulfametoxazol, ... de trabajo

Filas: Trimetoprim con sulfametoxazol   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_17

Sonora Nogestantes_17 Todo

Trimetoprim con sulfametoxazol 32 35 67

18 15 33

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.670942

28

Page 28: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: Nitrofurantoina, Columnas de la ... a de trabajo

Filas: Nitrofurantoina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_18

Sonora Nogestantes_18 Todo

Nitrofurantoina Resistente 20 41 61

Nitrofurantoina Sensible 30 9 39

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0000303

Estadísticas tabuladas: Cloramfenicol, Columnas de la hoja de trabajo

Filas: Cloramfenicol   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_19

Sonora Nogestantes_19 Todo

Cloramfenicol Resistente 30 25 55

Cloramfenicol Sensible 20 25 45

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.421552

Estadísticas tabuladas: Fosfomicina, Columnas de la hoja de trabajo

Filas: Fosfomicina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_20

Sonora Nogestantes_20 Todo

Fosfomicina Resistente

2 2 4

Fosfomicina Sensible 48 48 96

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

29

Page 29: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

1

Estadísticas tabuladas: Colistina, Columnas de la hoja de trabajo

Filas: Colistina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_21

Sonora Nogestantes_21 Todo

Colistina Resistente 35 34 69

Colistina Sensible 15 16 31

Todo 50 50 100

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: Tetraciclina, Columnas de la hoja de trabajo

Filas: Tetraciclina   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_22

Sonora Nogestantes_22 Todo

Tetraciclina Resistente 35 29 64

Tetraciclina Sensible 15 31 46

Todo 50 60 110

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0323160

Estadísticas tabuladas: Ertapenem, Columnas de la hoja de trabajo

Filas: Ertapenem   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_23

Sonora Nogestantes_23 Todo

Ertapenem Resistente 6 4 10

Ertapenem Sensible 44 46 90

Todo 50 50 100

Contenido de la celda      Conteo

30

Page 30: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Prueba exacta de Fisher

Valor p

0.740666

The same analysis was done for strains from Puebla

Estadísticos descriptivos: Puebla No gestantes, Puebla Gestantes

Estadísticas

Variable Media

Errorestándarde lamedia Desv.Est.

Varianza Suma Mínimo Mediana Máximo

Puebla No gestantes 14.360

0.772 3.861 14.907 359.000 6.000 15.000 21.000

Puebla Gestantes 14.280

0.877 4.383 19.210 357.000 7.000 15.000 24.000

Prueba T e IC de dos muestras: Puebla No gestantes, Puebla Gestantes

Método

μ₁: media de Puebla No gestantes

µ₂: media de Puebla Gestantes

Diferencia: μ₁ - µ₂

No se presupuso igualdad de varianzas para este análisis.

Estadísticas descriptivas

Muestra N MediaDesv.Est.

Errorestándarde lamedia

Puebla No gestantes 25

14.36 3.86 0.77

Puebla Gestantes 25

14.28 4.38 0.88

Estimación de la diferencia

Diferencia

IC de 95%para ladiferencia

0.08 (-2.27, 2.43)

Prueba

Hipótesis nula H₀: μ₁ - µ₂ = 0

31

Page 31: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Hipótesis alterna

H₁: μ₁ - µ₂ ≠ 0

Valor T GL Valor p

0.07 47 0.946

Estadísticas tabuladas: AMIKACINA, Columnas de la hoja de trabajo

Filas: AMIKACINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes

Puebla Nogestantes Todo

Amikacina Resistente 24 19 43

Amikacina Sensible 1 6 7

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0982776

Estadísticas tabuladas: GENTAMICINA, Columnas de la hoja de trabajo

Filas: GENTAMICINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_1

Puebla Nogestantes_1 Todo

Gentamicina Resistente 14 10 24

Gentamicina Sensible 11 15 26

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.396104

Estadísticas tabuladas: NETILMICINA, Columnas de la hoja de trabajo

Filas: NETILMICINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_2

Puebla Nogestantes_2 Todo

Netilmicina Resistente 6 5 11

32

Page 32: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Netilmicina Sensible 19 20 39

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: ÁCIDO NALIDIXICO, Columnas de ... de trabajo

Filas: ÁCIDO NALIDIXICO   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_3

Puebla Nogestantes_3 Todo

Ácido nalidixico Resistente 17 18 35

Ácido nalidixico Sensible 8 7 15

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: CIPROFLOXACINO, Columnas de ... a de trabajo

Filas: CIPROFLOXACINO   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_4

Puebla Nogestantes_4 Todo

Ciprofloxacina Resistente 10 13 23

Ciprofloxacina Sensible 15 12 27

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.570916

Estadísticas tabuladas: OFLOXACINO, Columnas de la hoja de trabajo

Filas: OFLOXACINO   Columnas: Columnas de la hoja de trabajo

33

Page 33: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

PueblaGestantes_5

Puebla Nogestantes_5 Todo

Ofloxacina Resistente 12 14 26

Ofloxacina Sensible 13 11 24

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.777512

Estadísticas tabuladas: NORFLOXACINO, Columnas de la ... de trabajo

Filas: NORFLOXACINO   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_6

Puebla Nogestantes_6 Todo

Norfloxacina Resistente 8 14 22

Norfloxacina Sensible 17 11 28

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.153647

Estadísticas tabuladas: LEVOFLOXACINO, Columnas de la ... de trabajo

Filas: LEVOFLOXACINO   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_7

Puebla Nogestantes_7 Todo

Levofloxacina Resistente 8 11 19

Levofloxacina Sensible 17 14 31

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.560744

Estadísticas tabuladas: AMPICILINA, Columnas de la hoja de trabajo

34

Page 34: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Filas: AMPICILINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_8

Puebla Nogestantes_8 Todo

Ampicilina Resistente

25 25 50

Ampicilina Sensible 0 0 0

Todo 25 25 50

Contenido de la celda      Conteo

* ERROR * No se puede calcular la Prueba exacta de Fisher.

Estadísticas tabuladas: CEFALOTINA, Columnas de la hoja de trabajo

Filas: CEFALOTINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_9

Puebla Nogestantes_9 Todo

Cefalotina Resistente 24 25 49

Cefalotina Sensible 1 0 1

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: CEFUROXIMA, Columnas de la hoja de trabajo

Filas: CEFUROXIMA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_10

Puebla Nogestantes_10 Todo

Cefuroxima Resistente 25 23 48

Cefuroxima Sensible 0 2 2

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.489796

Estadísticas tabuladas: CEFTAZIDIMA, Columnas de la hoja de trabajo

35

Page 35: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Filas: CEFTAZIDIMA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_11

Puebla Nogestantes_11 Todo

Ceftazidima Resistente 21 19 40

Ceftazidima Sensible 4 6 10

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.725202

Estadísticas tabuladas: CEFOTAXIMA, Columnas de la hoja de trabajo

Filas: CEFOTAXIMA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_12

Puebla Nogestantes_12 Todo

Cefotaxima Resistente 20 20 40

Cefotaxima Sensible 5 5 10

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: CEFTRIAXONA, Columnas de la hoja de trabajo

Filas: CEFTRIAXONA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_13

Puebla Nogestantes_13 Todo

Ceftriaxona Resistente 24 24 48

Ceftriaxona Sensible 1 1 2

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

36

Page 36: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo

Filas: CEFEPIME   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_14

Puebla Nogestantes_14 Todo

Cefepime Resistente 8 6 14

Cefepime Sensible 17 19 36

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.753614

Estadísticas tabuladas: AZTREONAM, Columnas de la hoja de trabajo

Filas: AZTREONAM   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_15

Puebla Nogestantes_15 Todo

Aztreonam Resistente 15 11 26

Aztreonam Sensible 10 14 24

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.396104

Estadísticas tabuladas: AMOXICILINA-ÁCIDO ... s de la hoja de trabajo

Filas: AMOXICILINA-ÁCIDO CLAVULÁNICO   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_16

Puebla Nogestantes_16 Todo

Amoxicilina-Ácido Clavulánico R 23 21 44

Amoxicilina-Ácido Clavulánico S 2 4 6

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.667101

37

Page 37: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: TRIMETOPRIM CON ... nas de la hoja de trabajo

Filas: TRIMETOPRIM CON SULFAMETOXAZOL   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_17

Puebla Nogestantes_17 Todo

Trimetoprim con sulfametoxazol 11 17 28

14 8 22

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.153647

Estadísticas tabuladas: NITROFURANTOINA, Columnas ... ja de trabajo

Filas: NITROFURANTOINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_18

Puebla Nogestantes_18 Todo

Nitrofurantoina Resistente 16 17 33

Nitrofurantoina Sensible 9 8 17

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: CLORAMFENICOL, Columnas de ... ja de trabajo

Filas: CLORAMFENICOL   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_19

Puebla Nogestantes_19 Todo

Cloramfenicol Resistente 9 11 20

Cloramfenicol Sensible 16 14 30

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher38

Page 38: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Valor p

0.773287

Estadísticas tabuladas: FOSFOMICINA, Columnas de la hoja de trabajo

Filas: FOSFOMICINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_20

Puebla Nogestantes_20 Todo

Fosfomicina Resistente

5 1 6

Fosfomicina Sensible 20 24 44

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.189463

Estadísticas tabuladas: COLISTINA, Columnas de la hoja de trabajo

Filas: COLISTINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_21

Puebla Nogestantes_21 Todo

Colistina Resistente 14 17 31

Colistina Sensible 11 8 19

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.560744

Estadísticas tabuladas: TETRACICLINA, Columnas de la hoja de trabajo

Filas: TETRACICLINA   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_22

Puebla Nogestantes_22 Todo

Tetraciclina Resistente 13 18 31

Tetraciclina Sensible 12 7 19

Todo 25 25 50

39

Page 39: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.243634

Estadísticas tabuladas: ERTAPENEM, Columnas de la hoja de trabajo

Filas: ERTAPENEM   Columnas: Columnas de la hoja de trabajo

PueblaGestantes_23

Puebla Nogestantes_23 Todo

Ertapenem Resistente 5 0 5

Ertapenem Sensible 20 25 45

Todo 25 25 50

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0501520

Then we compare the resistance between geographic area (pregnant from Sonora vs pregnant from Puebla and non-pregnant from Sonora vs non-pregnant from Puebla) and again we use fisher test exact.

Analysis of resistance between geographic area (pregnant women)

Estadísticos descriptivos: Sonora Gestantes, Puebla Gestantes

Estadísticas

Variable Media

Errorestándarde lamedia Varianza Suma Mínimo Mediana Máximo

Sonora Gestantes 13.700 0.747 27.888 685.000 3.000 12.500 22.000

Puebla Gestantes 14.280 0.877 19.210 357.000 7.000 15.000 24.000

Prueba T de dos muestras e IC

T DE DOS MUESTRAS PARA RESISTENCIA DE SONORA GESTANTES VS PUEBLA GESTANTES

Método

μ₁: media de la muestra 1

µ₂: media de la muestra 2

Diferencia: μ₁ - µ₂40

Page 40: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

No se presupuso igualdad de varianzas para este análisis.

Estadísticas descriptivas

Muestra NMedia Desv.Est.

Errorestándarde lamedia

Muestra 1 25 14.17 4.38 0.88

Muestra 2 50 13.80 5.28 0.75

Estimación de la diferencia

Diferencia

IC de 95%para ladiferencia

0.38 (-1.93, 2.69)

Prueba

Hipótesis nula H₀: μ₁ - µ₂ = 0

Hipótesis alterna

H₁: μ₁ - µ₂ ≠ 0

Valor T GL Valor p

0.33 56 0.743

Estadísticas tabuladas: AMIKACINA, Columnas de la hoja de trabajo

Filas: AMIKACINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes

PueblaGestantes Todo

Amikacina Resistente 31 24 55

Amikacina Sensible 19 1 20

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0017493

Estadísticas tabuladas: GENTAMICINA, Columnas de la hoja de trabajo

Filas: GENTAMICINA   Columnas: Columnas de la hoja de trabajo

41

Page 41: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

SonoraGestantes_1

PueblaGestantes_1 Todo

Gentamicina Resistente 21 14 35

Gentamicina Sensible 29 11 40

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.327681

Estadísticas tabuladas: NETILMICINA, Columnas de la hoja de trabajo

Filas: NETILMICINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_2

PueblaGestantes_2 Todo

Netilmicina Resistente 5 6 11

Netilmicina Sensible 45 19 64

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.164134

Estadísticas tabuladas: ÁCIDO NALIDIXICO, Columnas de ... de trabajo

Filas: ÁCIDO NALIDIXICO   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_3

PueblaGestantes_3 Todo

Ácido nalidixico Resistente 37 17 54

Ácido nalidixico Sensible 13 8 21

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.596183

Estadísticas tabuladas: CIPROFLOXACINO, Columnas de ... a de trabajo

42

Page 42: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Filas: CIPROFLOXACINO   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_4

PueblaGestantes_4 Todo

Ciprofloxacina Resistente

29 10 39

Ciprofloxacina Sensible 21 15 36

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.152476

Estadísticas tabuladas: OFLOXACINO, Columnas de la hoja de trabajo

Filas: OFLOXACINO   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_5

PueblaGestantes_5 Todo

Ofloxacina Resistente 27 12 39

Ofloxacina Sensible 23 13 36

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.634340

Estadísticas tabuladas: NORFLOXACINO, Columnas de la ... de trabajo

Filas: NORFLOXACINO   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_6

PueblaGestantes_6 Todo

Norfloxacina Resistente 28 8 36

Norfloxacina Sensible 22 17 39

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0557165

43

Page 43: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: LEVOFLOXACINO, Columnas de la ... de trabajo

Filas: LEVOFLOXACINO   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_7

PueblaGestantes_7 Todo

Levofloxacina Resistente 29 8 37

Levofloxacina Sensible 21 17 38

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0497151

Estadísticas tabuladas: AMPICILINA, Columnas de la hoja de trabajo

Filas: AMPICILINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_8

PueblaGestantes_8 Todo

Ampicilina Resistente 50 25 75

Ampicilina Sensible 0 0 0

Todo 50 25 75

Contenido de la celda      Conteo

* ERROR * No se puede calcular la Prueba exacta de Fisher.

Estadísticas tabuladas: CEFALOTINA, Columnas de la hoja de trabajo

Filas: CEFALOTINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_9

PueblaGestantes_9 Todo

Cefalotina Resistente 48 24 72

Cefalotina Sensible 2 1 3

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

44

Page 44: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: CEFUROXIMA, Columnas de la hoja de trabajo

Filas: CEFUROXIMA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_10

PueblaGestantes_10 Todo

Cefuroxima Resistente 41 25 66

Cefuroxima Sensible 9 0 9

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0250838

Estadísticas tabuladas: CEFTAZIDIMA, Columnas de la hoja de trabajo

Filas: CEFTAZIDIMA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_11

PueblaGestantes_11 Todo

Ceftazidima Resistente 37 21 58

Ceftazidima Sensible 13 4 17

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.393294

Estadísticas tabuladas: CEFOTAXIMA, Columnas de la hoja de trabajo

Filas: CEFOTAXIMA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_12

PueblaGestantes_12 Todo

Cefotaxima Resistente 35 20 55

Cefotaxima Sensible 15 5 20

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.417336

45

Page 45: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: CEFTRIAXONA, Columnas de la hoja de trabajo

Filas: CEFTRIAXONA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_13

PueblaGestantes_13 Todo

Ceftriaxona Resistente 41 24 65

Ceftriaxona Sensible 9 1 10

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.150249

Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo

Filas: CEFEPIME   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_14

PueblaGestantes_14 Todo

Cefepime Resistente 19 8 27

Cefepime Sensible 31 17 48

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.799042

Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo

Filas: CEFEPIME   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_14

PueblaGestantes_14 Todo

Cefepime Resistente 19 8 27

Cefepime Sensible 31 17 48

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

46

Page 46: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Valor p

0.799042

Estadísticas tabuladas: AZTREONAM, Columnas de la hoja de trabajo

Filas: AZTREONAM   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_15

PueblaGestantes_15 Todo

Aztreonam Resistente 20 15 35

Aztreonam Sensible 30 10 40

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.141307

Estadísticas tabuladas: AMOXICILINA-ÁCIDO ... s de la hoja de trabajo

Filas: AMOXICILINA-ÁCIDO CLAVULÁNICO   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_16

PueblaGestantes_16 Todo

Amoxicilina-Ácido Clavulánico R 37 23 60

Amoxicilina-Ácido Clavulánico S 13 2 15

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0757365

Estadísticas tabuladas: TRIMETOPRIM CON ... nas de la hoja de trabajo

Filas: TRIMETOPRIM CON SULFAMETOXAZOL   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_17

PueblaGestantes_17 Todo

Trimetoprim con sulfametoxazol 32 11 43

18 14 32

Todo 50 25 75

Contenido de la celda      Conteo

47

Page 47: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Prueba exacta de Fisher

Valor p

0.137766

Estadísticas tabuladas: NITROFURANTOINA, Columnas ... ja de trabajo

Filas: NITROFURANTOINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_18

PueblaGestantes_18 Todo

Nitrofurantoina Resistente 20 16 36

Nitrofurantoina Sensible 30 9 39

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0851649

Estadísticas tabuladas: CLORAMFENICOL, Columnas de ... ja de trabajo

Filas: CLORAMFENICOL   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_19

PueblaGestantes_19 Todo

Cloramfenicol Resistente 30 9 39

Cloramfenicol Sensible 20 16 36

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0851649

Estadísticas tabuladas: FOSFOMICINA, Columnas de la hoja de trabajo

Filas: FOSFOMICINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_20

PueblaGestantes_20 Todo

Fosfomicina Resistente 2 5 7

Fosfomicina Sensible 48 20 68

Todo 50 25 75

48

Page 48: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0374944

Estadísticas tabuladas: COLISTINA, Columnas de la hoja de trabajo

Filas: COLISTINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_21

PueblaGestantes_21 Todo

Colistina Resistente

35 14 49

Colistina Sensible 15 11 26

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.304327

Estadísticas tabuladas: TETRACICLINA, Columnas de la hoja de trabajo

Filas: TETRACICLINA   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_22

PueblaGestantes_22 Todo

Tetraciclina Resistente 35 13 48

Tetraciclina Sensible 15 12 27

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.136497

Estadísticas tabuladas: ERTAPENEM, Columnas de la hoja de trabajo

Filas: ERTAPENEM   Columnas: Columnas de la hoja de trabajo

SonoraGestantes_23

PueblaGestantes_23 Todo

Ertapenem Resistente 6 5 11

49

Page 49: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Ertapenem Sensible 44 20 64

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.489947

Analysis of resistance between geographic area (Non-pregnant women)

Estadísticos descriptivos: Sonora No gestantes, Puebla No gestantes

Estadísticas

Variable Media

Errorestándarde lamedia Varianza Suma Mínimo Mediana Máximo

Sonora No gestantes 13.880 0.483 11.659 694.000 6.000 14.000 21.000

Puebla No gestantes 14.360 0.772 14.907 359.000 6.000 15.000 21.000

Prueba T de dos muestras e IC

T DE DOS MUESTRAS PARA RESISTENCIA ENTRE SONORA NO GESTANTES VS PUEBLA NO GESTANTES

Método

μ₁: media de la muestra 1

µ₂: media de la muestra 2

Diferencia: μ₁ - µ₂

No se presupuso igualdad de varianzas para este análisis.

Estadísticas descriptivas

Muestra NMedia Desv.Est.

Errorestándarde lamedia

Muestra 1 25 14.36 3.86 0.77

Muestra 2 50 13.88 3.41 0.48

Estimación de la diferencia

Diferencia

IC de 95%para ladiferencia

0.480 (-1.357, 2.317)

50

Page 50: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Prueba

Hipótesis nula H₀: μ₁ - µ₂ = 0

Hipótesis alterna

H₁: μ₁ - µ₂ ≠ 0

Valor T GL Valor p

0.53 43 0.601

Estadísticas tabuladas: AMIKACINA, Columnas de la hoja de trabajo

Filas: AMIKACINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes

Sonora Nogestantes Todo

Amikacina Resistente 19 32 51

Amikacina Sensible 6 18 24

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.431416

Estadísticas tabuladas: GENTAMICINA, Columnas de la hoja de trabajo

Filas: GENTAMICINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_1

Sonora Nogestantes_1 Todo

Gentamicina Resistente 10 22 32

Gentamicina Sensible 15 28 43

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

51

Page 51: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

0.807699

Estadísticas tabuladas: NETILMICINA, Columnas de la hoja de trabajo

Filas: NETILMICINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_2

Sonora Nogestantes_2 Todo

Netilmicina Resistente

5 2 7

Netilmicina Sensible 20 48 68

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.0374944

Estadísticas tabuladas: ÁCIDO NALIDIXICO, Columnas de ... de trabajo

Filas: ÁCIDO NALIDIXICO   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_3

Sonora Nogestantes_3 Todo

Ácido nalidixico Resistente 18 37 55

Ácido nalidixico Sensible 7 13 20

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: CIPROFLOXACINA, Columnas de ... a de trabajo

Filas: CIPROFLOXACINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_4

Sonora Nogestantes_4 Todo

Ciprofloxacina Resistente

13 22 35

Ciprofloxacina Sensible 12 28 40

Todo 25 50 75

52

Page 52: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.624943

Estadísticas tabuladas: OFLOXACINA, Columnas de la hoja de trabajo

Filas: OFLOXACINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_5

Sonora Nogestantes_5 Todo

Ofloxacina Resistente 14 18 32

Ofloxacina Sensible 11 32 43

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.137766

Estadísticas tabuladas: NORFLOXACINA, Columnas de la ... de trabajo

Filas: NORFLOXACINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_6

Sonora Nogestantes_6 Todo

Norfloxacina Resistente 14 19 33

Norfloxacina Sensible 11 31 42

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.149742

Estadísticas tabuladas: LEVOFLOXACINA, Columnas de la ... de trabajo

Filas: LEVOFLOXACINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_7

Sonora Nogestantes_7 Todo

Levofloxacina Resistente 11 16 27

53

Page 53: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Levofloxacina Sensible 14 34 48

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.321042

Estadísticas tabuladas: AMPICILINA, Columnas de la hoja de trabajo

Filas: AMPICILINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_8

Sonora Nogestantes_8 Todo

Ampicilina Resistente 25 50 75

Ampicilina Sensible 0 0 0

Todo 25 50 75

Contenido de la celda      Conteo

* ERROR * No se puede calcular la Prueba exacta de Fisher.

Estadísticas tabuladas: CEFALOTINA, Columnas de la hoja de trabajo

Filas: CEFALOTINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_9

Sonora Nogestantes_9 Todo

Cefalotina Resistente 25 49 74

Cefalotina Sensible 0 1 1

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: CEFUROXIMA, Columnas de la hoja de trabajo

Filas: CEFUROXIMA   Columnas: Columnas de la hoja de trabajo

Sonora Nogestantes_10

Puebla Nogestantes_1

Todo

54

Page 54: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

0

Cefuroxima Resistente 50 23 73

Cefuroxima Sensible 0 2 2

Todo 50 25 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.108108

Estadísticas tabuladas: CEFTAZIDIMA, Columnas de la hoja de trabajo

Filas: CEFTAZIDIMA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_11

Sonora Nogestantes_11 Todo

Ceftazidima Resistente 19 33 52

Ceftazidima Sensible 6 17 23

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.435423

Estadísticas tabuladas: CEFOTAXIMA, Columnas de la hoja de trabajo

Filas: CEFOTAXIMA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_12

Sonora Nogestantes_12 Todo

Cefotaxima Resistente 20 47 67

Cefotaxima Sensible 5 3 8

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.107894

Estadísticas tabuladas: CEFTRIAXONA, Columnas de la hoja de trabajo

55

Page 55: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Filas: CEFTRIAXONA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_13

Sonora Nogestantes_13 Todo

Ceftriaxona Resistente 24 50 74

Ceftriaxona Sensible 1 0 1

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.333333

Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo

Filas: CEFEPIME   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_14

Sonora Nogestantes_14 Todo

Cefepime Resistente 6 14 20

Cefepime Sensible 19 36 55

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.787614

Estadísticas tabuladas: AZTREONAM, Columnas de la hoja de trabajo

Filas: AZTREONAM   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_15

Sonora Nogestantes_15 Todo

Aztreonam Resistente 11 15 26

Aztreonam Sensible 14 35 49

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.304327

56

Page 56: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Estadísticas tabuladas: AMOXICILINA-ÁCIDO ... s de la hoja de trabajo

Filas: AMOXICILINA-ÁCIDO CLAVULÁNICO   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_16

Sonora Nogestantes_16 Todo

Amoxicilina-Ácido Clavulánico R 21 47 68

Amoxicilina-Ácido Clavulánico S 4 3 7

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.212736

Estadísticas tabuladas: ... METOXAZOL, Columnas de la hoja de trabajo

Filas: TRIMETOPRIM-SULFAMETOXAZOL   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_17

Sonora Nogestantes_17 Todo

Trimetoprim con sulfametoxazol 17 35 52

8 15 23

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: NITROFURANTOINA, Columnas ... ja de trabajo

Filas: NITROFURANTOINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_18

Sonora Nogestantes_18 Todo

Nitrofurantoina Resistente 17 41 58

Nitrofurantoina Sensible 8 9 17

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

57

Page 57: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Valor p

0.242016

Estadísticas tabuladas: CLORAMFENICOL, Columnas de ... ja de trabajo

Filas: CLORAMFENICOL   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_19

Sonora Nogestantes_19 Todo

Cloramfenicol Resistente 11 25 36

Cloramfenicol Sensible 14 25 39

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.806675

Estadísticas tabuladas: FOSFOMICINA, Columnas de la hoja de trabajo

Filas: FOSFOMICINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_20

Sonora Nogestantes_20 Todo

Fosfomicina Resistente 1 2 3

Fosfomicina Sensible 24 48 72

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: COLISTINA, Columnas de la hoja de trabajo

Filas: COLISTINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_21

Sonora Nogestantes_21 Todo

Colistina Resistente

17 34 51

Colistina Sensible 8 16 24

Todo 25 50 7558

Page 58: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

1

Estadísticas tabuladas: TETRACICLINA, Columnas de la hoja de trabajo

Filas: TETRACICLINA   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_22

Sonora Nogestantes_22 Todo

Tetraciclina Resistente 18 29 47

Tetraciclina Sensible 7 21 28

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.313488

Estadísticas tabuladas: ERTAPENEM, Columnas de la hoja de trabajo

Filas: ERTAPENEM   Columnas: Columnas de la hoja de trabajo

Puebla Nogestantes_23

Sonora Nogestantes_23 Todo

Ertapenem Resistente 0 4 4

Ertapenem Sensible 25 46 71

Todo 25 50 75

Contenido de la celda      Conteo

Prueba exacta de Fisher

Valor p

0.294500

REFERENCES

1. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement.; 2017.

59

Page 59: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

2. Rashid RA, Tarr PI, Moseley SL. Expression of the Escherichia coli IrgA homolog adhesin is regulated by the ferric uptake regulation protein. Microb Pathog. 2006. doi:10.1016/j.micpath.2006.07.006

3. Tiba MR, Yano T, Leite DDS. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev Inst Med Trop Sao Paulo. 2008. doi:10.1590/S0036-46652008000500001

4. Sabate M, Moreno E, Perez T, Andreu A, Prats G. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Clin Microbiol Infect. 2006;12(9):880-886. doi:10.1111/j.1469-0691.2006.01461.x

5. Bush K, Jacoby GA. Updated Functional Classification of -Lactamases. Antimicrob Agents Chemother. 2010;54(3):969-976. doi:10.1128/AAC.01009-09

6. Picazo JJ, Gobernado M, Cruz FJ, et al. Procedimientos En Microbiología Clínica.; 2011. https://www.seimc.org/contenidos/documentoscientificos/procedimientosmicrobiologia/seimc-procedimientomicrobiologia14.pdf.

7. Shin SH, Lim Y, Lee SE, Yang NW, Rhee JH. CAS agar diffusion assay for the measurement of siderophores in biological fluids. J Microbiol Methods. 2001;44(1):89-95. doi:10.1016/S0167-7012(00)00229-3

8. Wiles TJ, Kulesus RR, Mulvey MA. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp Mol Pathol. 2008;85(1):11-19. doi:10.1016/j.yexmp.2008.03.007

9. A. Cravioto, R.J. Gross SMS and BR. STRAINS OF ESCHERICHIA COLI FROM EXTRAINTESTINAL SOURCES : LACK OF. 1979;6:41-44.

10. Rodriguez-Angeles MG. Principales caracter??sticas y diagn??stico de los grupos pat??genos de Escherichia coli. Salud Publica Mex. 2002;44(5):464-475. doi:10.1590/S0036-36342002000500011

11. Constantiniu S. Escherichia coli enterohemoragic – an emerged pathogen of human infections - Part II. Non-O157 Escherichia coli. J Prev Med. 2002;10(4):57-73.

12. Blanco JE, Blanco M, Alonso MP, et al. Serotypes , Virulence Genes , and Intimin Types of Shiga Toxin ( Verotoxin ) -Producing Escherichia coli Isolates from Human Patients : Prevalence in Lugo , Spain , from 1992 through 1999. J Clin Microbiol. 2013;42(1):311-319. doi:10.1128/JCM.42.1.311

13. Bielaszewska M, Schiller R, Lammers L, et al. Heteropathogenic virulence and phylogeny reveal phased pathogenic metamorphosis in Escherichia coli O2: H6. EMBO Mol Med. 2014;6(3):347-357. doi:10.1002/emmm.201303133

14. Bourdin G, Navarro A, Sarker SA, et al. Coverage of diarrhoea-associated Escherichia coli isolates from different origins with two types of phage cocktails. Microb Biotechnol. 2014;7(2):165-176. doi:10.1111/1751-7915.12113

15. Donaldson SC, Straley BA, Hegde N V., Sawant AA, DebRoy C, Jayarao BM. Molecular epidemiology of ceftiofur-resistant escherichia coli isolates from dairy calves. Appl Environ Microbiol. 2006;72(6):3940-3948. doi:10.1128/AEM.02770-05

16. Molina-López J, Aparicio-Ozores G, Ribas-Aparicio RM, et al. Drug resistance, serotypes, and phylogenetic groups among uropathogenic Escherichia coli including O25-ST131 in Mexico City. J Infect Dev Ctries. 2011;5(12):840-849. doi:10.3855/jidc.1703

17. Regua-Mangia AH, Irino K, Da Silva Pacheco R, Pimentel Bezerra RM, Santos Périssé AR, Teixeira LM. Molecular characterization of uropathogenic and diarrheagenic Escherichia coli pathotypes. J Basic Microbiol. 2010;50(SUPPL. 1):107-115. doi:10.1002/jobm.200900364

18. Lienemann T, Salo E. Shiga Toxin – producing Escherichia coli Serotype O78 : H – in Family, Finland, 2009 Taru. Emerg Infect …. 2012;18(4):577-581. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3309701/.

19. Blanco M, Blanco JE, Mora a, et al. Types of Shiga Toxin ( Verotoxin ) -Producing Escherichia coli Isolates from Healthy Sheep in Spain Serotypes , Virulence Genes , and Intimin Types of Shiga Toxin ( Verotoxin ) -Producing Escherichia coli Isolates from Healthy Sheep in Spain. Society. 2003;41(4):1351-1356. doi:10.1128/JCM.41.4.1351

20. Carrillo-Casas EM, Suástegui-Urquijo Z, Arroyo-Escalante S, et al. E. coli outbreak in a neonate intensive care unit in a general hospital in Mexico City. Folia Microbiol (Praha). 2013;58(3):229-234. doi:10.1007/s12223-012-0202-x

21. Pearce JL, Bettelheim KA, Luke RKJ, Goldwater PN. Serotypes of Escherichia coli in Sudden Infant Death Syndrome. J Appl Microbiol. 2010;108(2):731-735. doi:10.1111/j.1365-2672.2009.04473.x

60

Page 60: Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807 Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037 β-lactams Ampicillin

22. Sainz E, Rosario T, Reyes M, Vicente P, Patricia M, Eslava C. Resistencia a antimicrobianos de cepas de E. coli de diversos serotipos aisladas de pacientes de un Hospital Psiquiátrico. Rev Mex Ciencias Farm. 2008.

23. Zhang W, Bielaszewska M, Kuczius T, Karch H. Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx1c) in Escherichia coli strains isolated from humans. J Clin Microbiol. 2002. doi:10.1128/JCM.40.4.1441-1446.2002

24. Poppe C, Martin L, Gyles C, et al. Acquisition and transfer of resistance to extended-spectrum cephalosporins by Salmonella Newport and E. coli in the intestinal tract of turkey poults. Guelph Food Saf Semin Ser Symp Guelph,. 2004;71(3):1184-1192. doi:10.1128/AEM.71.3.1184

61