Transcript
Page 1: 2013 Rose Season Brochure
Page 2: 2013 Rose Season Brochure

Historically, October in Tyler was a time to celebrate the harvest of the rose. From these bountiful harvests and times

of celebration was borne the Texas Rose Festival in 1933. Th ough more well known today for processing roses rather than harvesting, Tyler continues to celebrate just the same.

Join us this Rose Season as we celebrate the fl ower

that made Tyler the Rose Capital of America. We invite you to be our guest at one of our many community events

ranging from family fun to elegant pageantry.

Please enjoy Tyler, a natural beauty.

TEXAS ROSE FESTIVAL EVENTS ARE LISTED ON BACK COVER

Ongoing & Seasonal EventsUT TYLER COWAN CENTERVisit our website for show times Tyler’s premiere performing arts center presents the best touring Broadway shows, concerts, dance, music, comedy and more. LOCATION: Cowan Center, UT Tyler, 3900 University BlvdCONTACT: 903-566-7424, www.cowancenter.org ADMISSION: Call ticket offi ce

TYLER MUSEUM OF ARTTue-Sat, 10am- 5pm; Sun, 1-5pm, Closed Mondays and most major holidaysAs the premiere regional art museum in Texas, the TMA provides world-class exhibitions and exciting programs throughout the entire year. Stop by and enjoy the lovely design sketches for Texas Rose Festival dresses and costumes by Winn Morton, on display Fall 2013.LOCATION: Tyler Museum of Art, 1300 S Mahon AveCONTACT: 903-595-1001, www.tylermuseum.orgADMISSION: Most exhibits are FREE, visit our website for more info

TOURS OF TYLER—HAUNTED HISTORY AND ROSESOct, Th urs-Sat, See website for tour departure timesEnjoy Tyler’s lovely Tyler Rose Garden and Museum from the comfort of a touring bus, as well as the historic Goodman LeGrand Museum and McClendon House. Th en take our haunted evening tours of Tyler where you will learn which rose bushes hide our resident ghosts! LOCATION: Tours depart from the Tyler Area Chamber of Commerce parking lotCONTACT: 903-245-6535, www.toursoftyler.com ADMISSION: $15 per adult, Children 12 & under are FREE

KIEPERSOL ESTATES WINERY Oct / See website for open hours Come enjoy complimentary wine tastings with any Rose Season event ticket! LOCATION: 4120 FM 344 E

CONTACT: 903-894-8995, www.kiepersol.com ADMISSION: FREE with Rose Season event ticket!

GALLERY MAIN STREET FINE ART EXHIBITSOct / Mon-Wed, 10am-5pm;Th urs-Fri, 10am-6pm; Sat, Noon-4pmEnjoy juried art exhibits at this downtownfi ne arts gallery. LOCATION: 110 W ErwinCONTACT: 903-593-6905,www.downtowntylerarts.comADMISSION: FREE

MOORE FARMSOct / Sat, 10am-6pm; Sun, 1-5pm;Weekdays, RESERVED for school fi eld trips ONLYPick a crop of fall fun at Moore Farms. Family fun with hayrides, u-pick pumpkins, farm animals and mazes.LOCATION: 22142 CR 181, BullardCONTACT: 903-894-1030, www.moorefarms.comADMISSION: Fee charged

MCCLENDON HOUSE TOURSFri-Sat / 10am-4pm (year round)Guided tours throughout this stately 130-year-old Victorian mansion.LOCATION: 806 W Houston StCONTACT: 903-592-3533,www.mcclendonhouse.net ADMISSION: $7 per adult, $5 seniors 55 and older, children 12 & under are FREE

THURSDAY NIGHT SCARY CLASSIC MOVIES AT LIBERTY HALLOct 3, 10, 17, 24 / Th urs, 7pm; Oct 31 / Th urs, 8pmClassic horror fi lms showing throughout the month of October, concluding with “Halloween” on Halloween night. LOCATION: Liberty Hall, 103 E ErwinCONTACT: 903-595-7274, www.libertytyler.com ADMISSION: $7 per person, cash only, no credit or debit cards please

ROSE NURSERY TOURSOct 4-5, 11-12, 18-19 / Fri-Sat, Every hour 9am-3pmBehind the scenes tour of a production rose nursery.LOCATION: Chamblee’s Rose Nursery, 10926 US Hwy 69 NCONTACT: 800-256-7673, www.chambleeroses.comADMISSION: FREE

FESTIVALS GONE BY–ROSE FESTIVAL GOWN EXHIBITOct 7-21 / Mon-Fri, 9am-7pm; Sat & Sun, 2-6pmRose Festival Gowns from past festivals on display. Many decades represented, also Ms. Texas Senior America Pageant Gown Division.LOCATION: Prestige Estates Assisted Living,6928 Paluxy DrCONTACT: 903-561-6102, www.prestigeestates.netADMISSION: FREE, Drawing for B&B overnight stay

MAYHEM AT THE MANSION, MURDER MYSTERY AT THE GOODMANNov 1, Fri / 7-9pmTh e murder mystery events at the Goodman are new in 2013! Enjoy a night of mystery, entertainment and refreshments. Th is evening of amusing interaction will be staged within the historic (and sometimes spooky) setting of the Goodman-LeGrand mansion.LOCATION: Goodman-LeGrand House & Museum, 624 N BroadwayCONTACT: 903-531-1286, www.goodmanmuseum.comADMISSION: $25 per person, limited space

pppppp

Welcome

nnnnnn rrrrrrrrososososoo e e eeeee nununnununu

ssssses.es.es.esses.es comcomcomcomoocomcomomom

EXH

onononono

uuuuursrsrsrsrsererereererre y.y.yy.y.y.yy

mmmmmmm

IBIT

nnnnn....

Page 3: 2013 Rose Season Brochure

Week & Weekend of Oct 1- 6TURN TYLER PINKOct 1, Tues / 5-8pmTyler Fire Fighters host a cancer awareness event. Fire fi ghters partner with local cancer organizations, businesses and schools with health screening, entertainment, blood donation and health education information.LOCATION: TB Butler Plaza, Downtown TylerCONTACT: 903-245-2132ADMISSION: FREE

HAUNTS OF FOUR WINDSOct 4-27, Fri, Sat & Sun only / Dusk-10pmHaunted Castle, Haunted Hay Ride, Black Forest Trail, Games, Shops, food and fun for the whole family.LOCATION: 21852 CR 2178 (between Whitehouse & Troup off Hwy 110 S)CONTACT: 903-839-5271, www.fourwindsfaire.comADMISSION: $15 for multipass or $5 per attraction

MULTI-CULTURAL ARTS FESTOct 5, Sat / 11am

Th e 2013 Multi-Cultural Arts Fest, hosted by the Arts & Humanities Council of East Texas, promises to be another beautiful celebration! Th e Fest

includes dancers draped in colorful costumes, African drumming and a

variety of multi-cultural performances. LOCATION: Downtown Tyler on the SquareCONTACT: 903-216-3671, www.artscouncilet.orgADMISSION: FREE

MOVIES IN THE PARK Oct 5 & 12, Sat / 8:00pm Tyler Parks and Recreation will show a feature fi lm in the amphitheater, movie titles to be announced. LOCATION: Bergfeld Park, 1510 N College or 4th and BroadwayCONTACT: 903-595-7271, www.TylerParksandRec.comADMISSION: FREE

Week & Weekend of Oct 7- 13 FALL FUN Oct 10-13, Th ur-Sun / 8am-dusk daily

Hunter/Jumper Horse Show. Great outdoor event for the entire family featuring $10,000 Jumper Classic. Saturday

aft ernoon Azleway Gala benefi ting Azleway Boys’ Ranch.LOCATION: Texas Rose Horse Park, 14078 State Hwy 110 NCONTACT: 903-882-8696, www.texasrosehorsepark.comADMISSION: FREE for spectators with the exception of the Azleway Gala Saturday

8TH ANNUAL FIREFIGHTER COMBAT CHALLENGEOct 11, Fri / 5-11pm & Oct 12, Sat /10am-3pmExperience the toughest two minutes in sports as trained fi refi ghters compete in fi ve exhausting challenges. Family fun with kid’s course.LOCATION: Broadway Square Mall(parking lot south of Sears)CONTACT: 903-245-3118, www.brookshirescombat.comADMISSION: FREE for spectators

mmmmmssssyyyyTTTTTT ppppp yyyy

mmmmststststtttstt TTTTTTTrararararaaaaililililililill, ,, , ,,, y.y.y.y.y.TrTrTrTrTrTTroupoupoupoupouppp offffofofofofoff Hf Hf Hf HHf Hf Hf Hf Hf HHHHHwywywyywywy wy wy wywyyyyw 110110111010001101101101101011 S)S)S)S)S)SS)S)S)SS)SSS)

THE TYLER ROSE MARATHONOct 12, Sat / 5k, 8am Oct 13, Sun / Marathon & Half Marathon, 7:30amMarathon, half marathon, and 5k.LOCATION: The Rose Garden Center,420 Rose Park DrCONTACT: 817-706-0368,www.tylermarathon.com ADMISSION: Varies, call for more info

FALL MIGRATION CELEBRATION AT TYLER STATE PARKOct 12, Sat / Bird Tour, 8:15am / Birding 101, 10:30am Bird Activities, 2pm / Woodpeckers, 3:30pm Enjoy our feathered friends at bird related programs throughout the day. Attend bird tours, workshops and activities. LOCATION: Tyler State Park, 789 Park Rd 16 off State Park Hwy (FM 14)CONTACT: 903-597-5338, www.tpwd.state.tx.us/state-parks/tylerADMISSION: $5 per person, 13 & up

FALL GARDEN CONFERENCE AND BULB & PLANT SALEOct 12, Sat / Conference, 8:30am, Plant Sale, 11:30amMorning conference on gardening followed by a sale of hardy perennial spring blooming bulbs and landscape plants adapted to the area.LOCATION: Harvey Convention Center, 2000 W Front StCONTACT: 903-590-2980, http://scmg.tamu.edu ADMISSION: FREE

SUSAN G. KOMEN RIDE FOR THE CURE®

Oct 12, Sat /8:30amHorse trail ride, featuring beginner and advanced trails.LOCATION: Tarrant Ranch, 3704 County Rd, BullardCONTACT: 903-561-6992, www.komentyler.orgADMISSION: $50 with $200 in minimum fundraising required

LINDALE COUNTRYFESTOct 12, Sat / 9am-3pmSince 1985, Lindale’s Country Fest annually entertains thousands of visitors and residents with arts and craft s, games for the kids, great food, live entertainment, live and silent auction and much more! LOCATION: Downtown LindaleCONTACT: 903-882-7181, www.lindalechamber.orgADMISSION: FREE

CHANDLER POW WOW AND CASI CHILI COOK-OFFOct 12, Sat / Festival Gates Open 9am, Parade Begins 10am, Chili Cook-Off 11amParade, Arts & Craft s Booths, Music, Great Food & Much More.LOCATION: Winchester Park, 3/4 mile south of Hwy 31 on FM 315, ChandlerCONTACT: 903-849-6853, www.chandlertx.comADMISSION: FREE

BOUQUETS OF CROQUETSOct 12, Sat / 10am-4pmCome tour the beautiful lawns of the Goodman Museum, sip some lemonade and enjoy the wonderful lawnsport of Croquet. LOCATION: Goodman-LeGrand Museum Grounds, 624 N BroadwayCONTACT: 903-592-4693, www.cwjctyler.orgADMISSION: $15

LOCLOCLOCOCCCLOLOCCL ATIATIATATIATIIATATATIATIAT ON:ON:ONON:ON:ON:ON:ON:O 21212122122 8528528852858852 CRCRCRCRRRRCR 2121212122 78 78 78 78 777878 (be(be(be(b(bebeetwetwetwetwetwew en en en en nen WhWhWhWhWhWhWhWWCONCONCONCONCONONNCONTACTACTACACTACTACTAACT:T:T:T:T:T::T 90909090909003-83-83-83-83-83-83-839-39-39-39-39-39 527527527527525275271, 1, 1, 1, 1, 1, wwwwwwwwwwwwwww.fo.fo.fo.fo.fourwurwurwurwrwrwurwindinindindindinnADMADMADMADMADMADMADMA MD ISSISSISSISSISSSIIISSIONIONNIONIONIONONIONNI :::: $$1$1$1$15 f5 f5 ff5 ff5 or or or or ororor mulmulmulmululmulmulmulmumm tiptiptiptipptipippassassasassassassassass orororororoo $5$5$5$5$5 pepepepeep rrrrr

MULTI-CULTURAL ARTS FESTOOOOOO tttt 5555555 SSSS tttt //// 11111a1a1a1a1ammmmmm

202020202202 1313131331313 MMMMMMMMuuuuuuuuubybybybyby ttttthehehehehehh AAAAAArrrrrEaEaEaEaEastststtst TTTTTexexexexexexaaaaabebebebebeauauauauaua titititiiifufufufuffufffful l lll clclclclludududududu esesesesses dddddddanananananatututututututumemememmeemm s,s,s,s,s,s,, AAAAAfrfrfrfrfrfy y yy y yyyyy ofoffofofofoffof mmmmmulululululllltititititiiit -----IOIOIOIOIOOON:N:N:N:N:N:: DoDoDoDoDownwnwnwnwn

T:T:T:T:: 90909090909 3-23-23-23-23-3-23 16-16-16-16-616 333333ONONONONONONNN:::: FRFRFRFRRFRREEEEEEEEEEEE

E PARKSaSaSaaaSat tttt ////// 8:8:8:88:8:8 000000000pppd dd d d ReReReReRecrcrccrcrreaeaeaeaeaatitititititihhhhheeaeeaeateteteteer,r,r,r, mmmmmmoooooogfgfgfgfgfg eldeldeldelelddld PaPaPaPaPaPP rk,rk,k,kk,-5-5-55595-95-95-9955 7277277277277271, 1, 1, 1,1,RRRRRRREE EE EE EEE EE

Week & W

ThThThThThThuuuuuuur-r-r-r-r-r SuSuSuSuSuSunnnnnnrsrsrssrsee e e e ShShShShShShhowowowowowowooo ..

thththththththee e e eneneneenenntitititittitiiirerererere fffffffamamammamamamilililillly y yyyy y y y fefefefefeatatattatataturururururininininininiing g g g gg $1$1$1$1$1$1$10,0,0,0,0,0,0,00000000000ftftftftft AAAAAA lllll GGGGGG lll bbbbbbb fifififitttttiiiii AAAAAA

OcOcOcOcOccOcOctt t ttt 5,5,5,5,55,55 SSSSSatatataatat //// 11111111Th Th Th Th Th ThThThThTheeeee

ininininninn cccccososososso tttttt

vavavavavaririririririr etetetettteteetyyyyyy LLLLLLOCAOCAOCAOCAOCAOCATITITITII

CONCONCONCONNC TACTACTACTACTACACTTTTTTADMADMADMADMDMADMDMISSISSSSISSISSISSISSIOIOIOOOIOIO

MOVIES IN THE OcOcOcOcOcOct tt t tt 5 5 5 55 55 & & & & & & 121212122121 , , , SSSSSS TyTyTyTyTyyTyTyyleleleleleller rrr r PaPaPaPaPaaPP rkrkrkrkrks ss ss anananananddddd inininnnininnn ttttthehehehehhhehhe aaaaaaampmpmpmpmpmphihihihihih ththththhththhhhLOCLOCLOCLOCLOCLOCCCOLOCCCLOCATIATIATIATIATIAA ION:ON:ON:OON:ON:ON BeBeBeBeBeBB rgrgrgrgrggCONCONCONCONONCONCONCONONC TACTACTACTACTACTTACT:T:T:T:T:T 909090900903-33-3-33ADMADMADMADMADMMADMADMADMADMISSISSISSISSISSISSIII IONIONIONIONIONIOION::::: FRFRFRFRFRF

W FALL FUN

OOcOcOOcOccOcO t t t tt 1010101010101 -1-1-1-1-1- 3,3,3,3,3,3 ThThThThThThThHuHuHuHuHuHHuHuntntntntntntererererererr/J/J/J//J/J/Jumummummumpepepepepepepep r r r rrrr HoHoHoHoHoHorrrrr

hhhh iii ffff ilillil ffffff

FOR THE CURE

rrrinininnniii g gg g gg bebebebebbbebegigigigigginnnnnnnnnnnnnnnerererer

ch,ch,chch,ch,hchc

2, 2,2,2, 2, ,

2222200 00 000 inin iin iiequequequireireireiir dddd

Tpppppppppmmmmmmmmmm

CoCoCoCoCooCooununununnunu trtrtrtrtrtrry y yy yy y y FeFeFeFeFeFeF ststststst aaaaaaannnnnnnnnnnnnnnnnnnnuauauauauauauauaau lllllllllllllllllllll y y y y yy yy y enenenenenenenneneneeeee teteteteteeteetetertrtrtrtrttrttrtttrr aiaiaiaiaiiaaaiaa nsnsnsnsnsnnnn ttttttttthohohohohhoohhhhhh uusususususssu anananannananddsdsdsddsdsddsdsdsdss oooooooof f f f f f f ffwwwwwwwwitititititttth hh hhhh ararararaara tstststststs aaaaaanndndndndnddddd ccccccrarararararaaft ft ft ftftft ftftftft ft s,s,s,s,s ggggggggggggamamamamammmamamammesesesesesessess fffffffffffforoororororororooo ttttthehehhehehehee kkkkkkkkkididididididididds,s,s,s,s,,,, ggggggggggggggrerererereerr atatatatatataatat ntntntntnttntn , ,, ,, lilililiveveveevve aaaaaaandndndndnddndn ssssssililililililiiilenenenenenenenenent tt t t auauauauauauauuuuuctctctcttctttioioioioioioioioioionnnnnn ananananaaananaaaaa d ddddd dddd mumumumummmmuumuchchchchch mmmmmmmorororoorororo e!e!e!e!!e!e!!e!!!!e  LinLinLinininLinLL daldaldaldaldaldald eeee111111, w, w, w, wwwww, ww.ww.ww.ww.ww.wwww.ww.www linlinlinlinininlininnlininlinl daldaldaldalldadaldaa echechechechchhechhechambambambmbambambmbmbmberer.er.erer.er.rereee orgorgorgorgorgorgo g

Page 4: 2013 Rose Season Brochure

26TH ANNUAL FESTIVAL ON THE SQUARE Oct 12, Sat / 5pm-midnight

Enjoy the best of Texas Music at this celebration on the brick streets of Downtown Tyler.

Gates open at 5pm with music continuing until midnight.LOCATION: TB Butler Plaza, Downtown Tyler

CONTACT: 903-593-6905, www.festivalonthesquare.comADMISSION: $15 in advance; $20 at the gate

Week & Weekend of Oct 14 -20 ROSELAND PLANTATION HISTORIC TOURS

Oct 15-17, Tue-Th urs / 2pm daily Four-Course Aft ernoon Tea and Historic Plantation Tour. LOCATION: Roseland Plantation/Hambrick House (Circa 1854) 2591 State Hwy. 64W (6 miles west of Tyler Pounds Regional Airport)CONTACT: 903-849-0205, www.RoselandPlantation.comADMISSION: Tea & Tour, $25 per person plus tax and gratuity; Tours only, $8 per person; (reservation required for both)

61st ANNUAL PALETTE OF ROSES ART SHOWOct 16, Wed / 7-9pm; Oct 17-19, Th ur-Sat / 9am-5pmProfessional judged Art Show. Th is show consists of over 200 fi ne art paintings from local artists of all ages and talents.Visit online to see live art demonstrations and learn more about joining the league.LOCATION: Rose Garden Center, 420 S Rose Park DrCONTACT: 903-571-5668, www.poraloftyler.orgADMISSION: FREE

ROSE GARDEN GUIDED TOUROct 17, Th ur / 1pm & Oct 18, Fri / 10amAn educational and guided tour of the Rose Garden roses and features presented by a Rose Garden Docent Volunteer (typically a Master Gardener).LOCATION: Tyler Rose Garden, 420 Rose Park DrCONTACT: 903-531-1200, www.cityoftyler.orgADMISSION: FREE

HOW ROSES FROM AROUND THE WORLD CAME TO TYLEROct 18, Fri / 11am Mark Chamblee of Chamblee Roses will explain how roses that were created in other countries found their way to Tyler, and why that is important to the local rose industry.LOCATION: Rose Garden Center, 420 Rose Park DrCONTACT: 903-256-7673, www.chambleeroses.comADMISSION: FREE

ALL ABOUT ROSES-WALK & TALK IN THE TYLER ROSE GARDEN Oct 18, Fri / 1pm Rose Garden Supervisor Craig Reiland off ers information for beginners and novices on rose varieties, planting, pruning and general care of roses. Includes a short walk among rose plantings in the Tyler Rose Garden. LOCATION: Tyler Rose Garden’s IDEA Garden Patio, W Houston at Peach Ave CONTACT: 903-531-1200, www.cityoftyler.org ADMISSION: FREE

PROPER TREE CARE Oct 18, Fri / 3pmTechniques to properly maintain your trees.LOCATION: Tyler Rose Garden, IDEA Garden (S. Peach at W. Houston)CONTACT: Luke Porter, 903-531-1179ADMISSION: FREE

ROSE CITY DISK GOLF TOURNAMENTOct 19, Sat / Registration at 8:15am / Tee-off at 9:45amTwo rounds of 18 holes with one hour break between rounds.LOCATION: Lindsey Park, Spur 364 & Greenbriar RdCONTACT: 903-571-5624ADMISSION: $40

10TH ANNUAL CROSSROADS CLASSIC CAR SHOWOct 19, Sat / 9am-2pmCars from all over will be on display in downtown Lindale for the 10th Annual Crossroads Classic Car Show benefi ting the Lindale Library. Come enjoy a day of family fun and both new and classic cars. LOCATION: Downtown Lindale CONTACT: 903-882-7181,www.lindalechamber.orgADMISSION: FREE

SURVIVAL DAY AT TYLER STATE PARKOct 19, Sat / 9am , Lost in the Forest /10:30am, Kids’ Wilderness Survival / 2pm, Snakes / 3:30pm, Survival Fire Learn some basic survival skills at a series of programs including being lost, about snakes, how to build a survival fi re. Programs for kids too.LOCATION: Tyler State Park, 789 Park Rd 16 off State Park Hwy (FM 14)CONTACT: 903-597-5338, www.tpwd.state.tx.usADMISSION: $5 per person, 13 & up

NORTH TEXAS HUNTER/JUMPER CLUB/ WAGON WHEEL SHOWOct 19-20, Sat-Sun / 8am-4pm dailyHunter/Jumper Horse Show. Come out and watch the exhibitors in some of their fi rst competitions. Great outdoor event for the entire family.LOCATION: Texas Rose Horse Park, 14078 State Hwy 110 NCONTACT: 903-882-8696,www.texasrosehorsepark.comADMISSION: FREE for spectators

GIRLS NIGHT OUT COMEDY SHOW Oct 19, Sat / 8pmStand up comedy show featuring comedian Monique Marvez and other female comedians. LOCATION: Liberty Hall, 103 E ErwinCONTACT: 903-595-7274,www.libertytyler.com and www.deep-magic.comADMISSION: $15 online; $20 at the door, cash only, no credit or debit cards

26th Anniversary26th Anniversary26th Anniversary

Page 5: 2013 Rose Season Brochure

ROSE FESTIVAL ARTS AND CRAFTS FAIR AND CONCERTOct 19, Sat / 9am-6pm; Concert at 6pmOct 20, Sun / 11am-5pm; More than 75 vendors will provide handmade items such as jewelry, mixed media art work, pottery and more.LOCATION: Bergfeld Park, 1510 S CollegeCONTACT: 903-531-1214,www.TylerParksandRec.comADMISSION: FREE (kids zone and concessions for a fee)

MCCLENDON TREASURES—ARTS, CRAFTS & HISTORYOct 19, Sat / 9am-5pm Local artists and craft ers display their creations to peruse and purchase. Historic characters to be portrayed as this 130-year-old Victorian Mansion opens for tours at a discounted price. Concessions available for purchase.LOCATION: 806 W Houston StCONTACT: 903-592-3533, www.mcclendonhouse.netADMISSION: FREE arts & crafts show; Tours, $5 per adult, children 12 & under FREE

4TH ANNUAL“OLD ROSE” OPEN HOUSE AT THE GOODMAN-LEGRAND MUSEUM Oct 19, Sat / 10am-5pm Be greeted by lovely Rose Belles and re-enactors in period attire at this stately, old southern mansion. Enjoy tours, entertainment, horse and carriage rides and complimentary refreshments. See the world’s fi rst EarthKind rose and botanical garden within the LeGrand Park.LOCATION: 624 N BroadwayCONTACT: 903-531-1286, www.goodmanmuseum.comADMISSION: FREE

KIEPERSOL ESTATES HARVEST FESTIVAL & GRAPE STOMPOct 19, Sat / 10am-6pmA family event with Old World grape stomping, festive music, family games, wine tasting and sangria.LOCATION: 4120 FM 344 ECONTACT: 903-894-8995,www.kiepersol.comADMISSION: FREE

Week & Weekend of Oct 21 -27 RIP VAN WINKLE’S LEGEND OF SLEEPY HOLLOWOct 21-23, Mon-Wed / 9:45am; Oct 24-26, Th ur-Sat / 7:30pm & Oct 27, Sun / 2:30pm Family friendly musical adventure. Perfect for the Fall Holiday Season!LOCATION: Tyler Civic Theatre Center, 400 Rose Park DrCONTACT: 903-592-0561, www.tylercivictheatre.comADMISSION: $18, adults; $15, students

FAMILY FISHING AT TYLER STATE PARKOct 26, Sat / 10am-12pmBring the family and try your luck at catching fi sh in Tyler State Park Lake. If you don’t have a pole, borrow one of ours. LOCATION: Tyler State Park, 789 Park Rd 16CONTACT: 903-597-5338, www.tpwd.state.tx.us ADMISSION: $5 per person, 13 & up

PETS IN THE PARKOct 26, Sat / 10am-4pmFundraising event designed to bring families and their family pets together for a fun day at Bergfeld Park. Animal activities include weeney dog races, contests, vendors, agility demonstrations and a blessing of the animals. Sponsored by Pets Fur People (formerly the Humane Society of East Texas).LOCATION: Bergfeld Park, 1510 S CollegeCONTACT: 903-597-2471, www.ksoet.com or www.petsfurpeople.orgADMISSION: Donations welcome

EAST TEXAS SYMPHONY ORCHESTRA JAZZ SPECTACULAROct 26, Sat / 7:30pmEast Texas Symphony OrchestraJazz Spectacular.LOCATION: Liberty Hall, 103 East Erwin, Downtown TylerCONTACT: 903-526-3876, www.etso.orgADMISSION: $30, $20, $15

Week & Weekend of Oct 28 -31DALLAS HARVESTOct 30-Nov 3, Wed-Sun / 8am-dusk dailyHunter/Jumper Horse Show featuring $25,000 Grand Prix and $15,000 International Hunter Derby. Great outdoor event for the entire family.LOCATION: Texas Rose Horse Park, 14078 State Hwy 110 NCONTACT: 903-882-8696, www.texasrosehorsepark.comADMISSION: FREE for spectators

SENIOR HEALTH AND LIVING EXPOOct 31, Th urs / 9am-2pmMore than 70 exhibitors of businesses that have goods and services for seniors. Th ere are health screenings available of almost every variety. Free lunch is served to attendees and entertainment is provided.LOCATION: Harvey Convention Center, 2000 W Front StCONTACT: 903-592-1661, www.tylertexas.comADMISSION: FREE

28 -31

uuuuuuusksskskssggggg

rsrrsrsrsssssofofofofoff vvvvvvee

dededdded ddd00000000000000000s.s.s cococo

8 -31

kkkkkkkk dddddddaiaiaiiaiiaiaiaiaiaiillyllylylylyly

sss. fffffffededdddddd ttttttto oooood.d.dddd.d0 W0 W0 WWWW FrFrFrFrFrontontontontontntonont StSStStStttomomoomomoooommm

D RON-LE

aaaaam-m-m-m-m-m-m 5555555yyyy RRRRRosososososo eeeeeeooooooldldlddddld sssssouououououuaaaaaandndndnddnd cccccccararararaar

wwwwwwororororororldldldldlddldd’s’s’s’s’s’s fifififififin n n n ththththththhhhe e e ee e LeLeLeLeLeLeLL GrGrGrGrGrGrGrrG

LLOCLOCOCATATIATIATIIOOON:NN:: 626262626 4 N444 N4 NN BBrBBroadoadoadoadadwaywaywaywayw yCONCONCONONONTACTACTACTACTACCT T:T:T:T:T: 9090909090909003-53-53-53-553- 31-31-31-31-31-31--1281281281281281286, 6, 6, 6, 6, , , wwwwwwwwwwwwwwwwww

ONONN:: FRFRFRFRFRFRFRFRFREE EE EE EE EE EEE

4TH ANNUAL“OLD AT THE GOODMAN OOOOOctctctctctctcccc 111119,9,9,9,9, SSSSSatatatatatt ////// 111110a0a0a0a0a BeBeBeBeBeBeBe ggggggggrerererererreetetettettte edededededdd bbbbbyy y y y lololololol vevevevevelylylylyly aaaaatttttttt iriririrrii e e e ee atatatatattatt ttttthihihihihhiih s ss ss stststststs atatatatatelelelelely,y,y,y,y, oo eneneneneenee tetettetertrtrtrttttaiiiaiiiaiaa nmnmnmnmnmnmmn enenenenenene t,t,t,t,t,, hhhhhhorororororsesessesese rrrrrrefefefefefeefrererererreeshshshshshhmememememementntntntnts.s.s.s.ss SSSSSSeeeeeeeeeeeeeeee tttttthehehehehehe wwwwww boboboboboobotatatatatatataanininininiicacacacaal l l l gagagagagagagag rdrdrdrdrdrdrdenenenenenn wwwwwwitititititthihihihihihihinn nnn n

LOCLOCLOCLOCCLOCATIATATIATIAATATIATION:ON:ON:ON:ONN:N:NNN 62626226262624 N4 N4 N4 NNN44 NN4 BrBrBrBrBrBroadoadoadoadoadwaywaywayywayaw

Page 6: 2013 Rose Season Brochure
Page 7: 2013 Rose Season Brochure

TEXAS ROSE FESTIVAL RIBBON CUTTING AND MORNING PRAYER SERVICEOct 17, Th urs / 10amMarking the offi cial opening of the 80th Annual Texas Rose Festival.LOCATION: Tyler Rose Garden Center, 420 Rose Park DrCONTACT: 903-597-3130 x 11ADMISSION: FREE & Open to the public

TEXAS ROSE FESTIVAL ROSE SHOWOct 17, Th urs / 10am-6pm & Oct 18-19, Fri & Sat / 9am-6pmArtful display of over 14,000 rosesLOCATION: Tyler Rose Garden Center, 420 Rose Park DrADMISSION: FREE & open to the public

TEXAS ROSE FESTIVAL LADIES’ AND MEN’S LUNCHEONS Oct 18, Fri / 11:30amEnjoy fabulous lunch and well-known speakers with friends and family. LOCATION: Ladies’ Luncheon, Crosswalk Conference Center, 1607 Troup HwyMen’s Luncheon, Villa di Felicita, 7891 Hwy 110 N CONTACT: 903-566-7424 ADMISSION: $50

TEXAS ROSE FESTIVAL CORONATIONOct 18, Fri / 2pm & 7pmAn impressive theatrical experience that always inspires fi rst time visitors. Gorgeous gowns, incredible colors and an intriguing story make this a must see event.LOCATION: UT Tyler Cowan Center, 3900 University BlvdCONTACT: For tickets: 903-566-7424 ADMISSION: $5-$65

TEXAS ROSE FESTIVAL PARADEOct 19, Sat / 9amBy far the community’s favorite event!LOCATION: Front and Glenwood into Rose Stadium CONTACT: 903-597-3130 x 11ADMISSION: $7-$10, Stadium seating tickets available the day of at TMF’s Rose Stadium, 400 Fair Park Dr, or in advance through UT Tyler Cowan Center, 903-566-7424

TEXAS ROSE FESTIVAL QUEEN’S TEAOct 19, Sat / 1-3pmCome meet the Rose Queen and her Court in their full coronation costumes.LOCATION: Tyler Rose Garden, 1900 W Front StCONTACT: 903-597-3130 x 11ADMISSION: FREE & open to the public

R oseF estival Texas80th

Annual


Top Related