![Page 1: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/1.jpg)
2 3 4
ACGCACTTCAGAACGCGTACTGACTGAA
TGCGTGAAGTCTTGCGCATGACTGACTT
![Page 2: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/2.jpg)
Agenda: 4/28
Objective: To determine how DNA is used in forensic cases
Human Genome – how people differ
DNA Uses and Sources
DNA Fingerprinting – Steps needed
- Restriction enzymes
- Gel electrophoresis
- Polymerase Chain Reaction
Homework: Tuesday: Lab Notebook – with Serial Dilution & Spectrophotometer Wednesday: News article – specific and detailed for credit
![Page 3: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/3.jpg)
Class notebookDate Assignment Pages
4/25 Processes represented in the Central Dogman
4/25 Proteins- function and structure
DNA Fingerprinting - Use of DNA in Forensic Cases
Restriction enzymes – background & lab preparation
![Page 4: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/4.jpg)
DNA fingerprintingDNA forensics • Digesting a DNA sample
using restriction enzymes• Gel electrophoresis
– Process: running gels– Data analysis
• Polymerase Chain Reaction – Process – Interpretation
• Solving the Case • Paternity Case - Blacketts
What we need to know:
• RFLP – Restriction Fragment Length
Polymorphism
• Restriction enzymes• How/why does gel
electrophoresis works?• How/why does PCR work? • Use of informatics/statistics
![Page 5: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/5.jpg)
The Human Genome
The sequence of bases make up our genes. The Human Genome Project determined the order of each of these
bases in all of our genes. Also found that most DNA is not coding for genes. There are many areas in which bases are repeated.
![Page 6: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/6.jpg)
How many bases are there in the human genome?
a) 3,000b) 300,000c) 3 milliond) 3 billione) 3 trillion
Facts & Figures about DNA
![Page 7: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/7.jpg)
How many bases are there in the human genome?
Facts & Figures about DNA
![Page 8: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/8.jpg)
How many bases are there in the human genome?
Facts & Figures about DNA
a) 3,000b) 300,000c) 3 milliond) 3 billione) 3 trillion
![Page 9: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/9.jpg)
How many bases are there in the human genome?
Facts & Figures about DNA
3,000,000,000
![Page 10: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/10.jpg)
We are not all exactly the same – What percent of your DNA is similar to any
other person in the world?
Facts & Figures about DNA
![Page 11: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/11.jpg)
We are not all exactly the same – What percent of your DNA is similar to any
other person in the world?
a) 99.9%b) 98%c) 90%d) 60%e) 10%
Facts & Figures about DNA
![Page 12: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/12.jpg)
We are not all exactly the same – What percent of your DNA is similar to any
other person in the world?
Facts & Figures about DNA
a) 99.9%b) 98%c) 90%d) 60%e) 10%
![Page 13: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/13.jpg)
We are not all exactly the same – What percent of your DNA is similar to any
other person in the world?
Facts & Figures about DNA
3 MILLION bases are different!
![Page 14: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/14.jpg)
Forensic scientists focus on these variable regions to generate a “DNA fingerprint” for each individual
Facts & Figures about DNA
![Page 15: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/15.jpg)
Summary – Nuclear DNA
![Page 16: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/16.jpg)
DNA Use in Forensic Cases
• Most are rape cases (>2 out of 3)• Looking for match between evidence
and suspect• Must compare victim’s DNA profile
• Mixtures must be resolved
• DNA is often degraded
• Inhibitors to PCR are often present
Challenges
![Page 17: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/17.jpg)
Human Identity Testing
• Forensic cases -- matching suspect with evidence
• Paternity testing -- identifying father
• Historical investigations• Missing persons investigations• Mass disasters -- putting pieces back together
• Military DNA “dog tag”• Convicted felon DNA databases
![Page 18: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/18.jpg)
• YouTube – DNA forensics – 4 videos• https://www.youtube.com/watch?v=dXYztbkMXwU&list
=PLC0B027FC81C82602 – 2 minute overview
• Includes CODIS – Story• https://www.youtube.com/watch?v=VF5s1loHxx4&list=P
LC0B027FC81C82602• https://www.youtube.com/watch?v=8w_VJ4G7qiw&list=P
LC0B027FC81C82602
• https://www.youtube.com/watch?v=yWKbQH2P6og&list=PLC0B027FC81C82602
![Page 19: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/19.jpg)
What are some sources of DNA?
![Page 20: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/20.jpg)
Sources of Biological Evidence
• Blood• Semen• Saliva• Urine• Hair• Teeth• Bone• Tissue• Mucus• Ear Wax
![Page 21: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/21.jpg)
DNA fingerprintingDNA forensics • Digesting a DNA sample
using restriction enzymes• Gel electrophoresis
– Process: running gels– Data analysis
• Polymerase Chain Reaction – Process – Interpretation
• Solving the Case • Paternity Case - Blacketts
What we need to know:
• RFLP – Restriction Fragment Length
Polymorphism
• Restriction enzymes• How/why does gel
electrophoresis works?• How/why does PCR work? • Use of informatics/statistics
![Page 22: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/22.jpg)
Cutting the DNA with Restriction Enzymes
![Page 23: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/23.jpg)
DNA can be cut into smaller pieces by restriction enzymes that recognize very specific sequences of DNA.
Restriction Enzyme Digest
AGCTAGAATTCTTTACGCTCGGATGAATTCCACCTATCTCC
![Page 24: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/24.jpg)
DNA can be cut into smaller pieces by restriction enzymes that recognize very specific sequences of DNA.
AGCTAG
AATTCTTTACGCTCGGATG AATTCCACCTATC
TCC
Restriction Enzyme Digest
AGCTAGAATTCTTTACGCTCGGATGAATTCCACCTATCTCC
![Page 25: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/25.jpg)
Multiple Restriction Enzymes Exist for Cutting DNA
EcoRI GAATTC G AATTC
PstI CTGCAG CTGCA G
SmaI CCCGGG CCC GGG
HindIII AAGCTT A AGCTT
BamI GGATCC G GATCC
HaeIII GGCC GG CC
![Page 26: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/26.jpg)
Separating the DNA fragments RFLP analysis
![Page 27: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/27.jpg)
Visualizing the DNA Restriction Fragments 1 – Ladder to determine size (number of base pairs in each segment)
2-7 samples from suspects or victims
![Page 28: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/28.jpg)
DNA Restriction Enzymes
• Evolved by bacteria to protect against viral DNA infection
• Endonucleases = cleave within DNA strands
• Over 3,000 known enzymes
![Page 29: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/29.jpg)
Enzyme Site Recognition
• Each enzyme digests (cuts) DNA at a specific sequence = restriction site
• Enzymes recognize 4- or 6- base pair, palindromic sequences (eg GAATTC)
Palindrome
Restriction site
Fragment 1 Fragment 2
![Page 30: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/30.jpg)
5 vs 3 Prime Overhang
• Generates 5 prime overhang
Enzyme cuts
![Page 31: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/31.jpg)
Common Restriction Enzymes EcoRI
– Eschericha coli– 5 prime overhang
Pstl– Providencia stuartii– 3 prime overhang
![Page 32: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/32.jpg)
The DNA DigestionReaction
Restriction Buffer provides optimal conditions
• NaCl provides the correct ionic strength
• Tris-HCI provides the proper pH
• Mg2+ is an enzyme co-factor
![Page 33: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/33.jpg)
DNA Digestion
Temperature
Why incubate at 37°C?
• Body temperature is optimal for these and most other enzymes
What happens if the temperature is too hot or cool?
• Too hot = enzyme may be denatured (killed)
• Too cool = enzyme activity lowered, requiring
longer digestion time
![Page 34: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/34.jpg)
Restriction Fragment Length PolymorphismRFLP
Allele 1
Allele 2
GAATTCGTTAAC
GAATTCGTTAAC
CTGCAGGAGCTC
CGGCAGGCGCTC
PstI EcoRI
1 2 3
3Fragment 1+2Different Base PairsNo restriction site
+
M A-1 A-2
Electrophoresis of restriction fragments
M: MarkerA-1: Allele 1 FragmentsA-2: Allele 2 Fragments
![Page 35: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/35.jpg)
AgaroseElectrophoresis
Loading
• Electrical current carries negatively-charged DNA through gel towards positive (red) electrode
Power Supply
Buffer
Dyes
Agarose gel
![Page 36: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/36.jpg)
AgaroseElectrophoresis
Running
• Agarose gel sieves DNA fragments according to size– Small fragments move farther than large fragments
Power Supply
Gel running
![Page 37: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/37.jpg)
Analysis of Stained Gel
Determinerestriction
fragmentsizes
• Create standard curve using DNA marker
• Measure distance traveled by restriction fragments
• Determine size of DNA fragments
Identify the relatedsamples
![Page 38: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/38.jpg)
Molecular Weight Determination
Size (bp) Distance (mm)
23,00011.0 9,400 13.0
6,500 15.0
4,400 18.0
2,300 23.0
2,000 24.0
100
1,000
10,000
100,000
0 5 10 15 20 25 30
Distance, mm
Siz
e, b
ase
pai
rsB
A
Fingerprinting Standard Curve: Semi-log
![Page 39: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/39.jpg)
Polymerase Chain Reaction (PCR)
PCR can make many copies in a very short period of time
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
![Page 40: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/40.jpg)
Polymerase Chain Reaction (PCR)
Heat to 94°C: Denature Strands of DNA
ACGCACTTCAGAACGCGTACTGACTGAA
TGCGTGAAGTCTTGCGCATGACTGACTT
![Page 41: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/41.jpg)
ACGCACTTCAGAACGCGTACTGACTGAA
TGCGTGAAGTCTTGCGCATGACTGACTT
Polymerase Chain Reaction (PCR)
Cool to 55°C: Allow primers to anneal
TGCGTGAA
TGACTGAA
![Page 42: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/42.jpg)
ACGCACTTCAGAACGCGTACTGACTGAA
TGCGTGAAGTCTTGCGCATGACTGACTT
Polymerase Chain Reaction (PCR)
Heat to 72°C: New DNA strand is synthesized
TGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAA
![Page 43: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/43.jpg)
Polymerase Chain Reaction (PCR)
PCR can make many copies in a very short period of time
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
ACGCACTTCAGAACGCGTACTGACTGAATGCGTGAAGTCTTGCGCATGACTGACTT
![Page 44: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/44.jpg)
![Page 45: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/45.jpg)
How do we generate a DNA fingerprint?
…After amplification of the variable regions through PCR
![Page 46: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/46.jpg)
FBI’s CODIS DNA Database
Combined DNA Index System• Used for linking serial crimes and unsolved
cases with repeat offenders• Launched October 1998• Links all 50 states• Requires >4 RFLP markers
and/or 13 core STR markers• Current backlog of >600,000 samples
![Page 47: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/47.jpg)
13 CODIS Core STR Loci with Chromosomal Positions
CSF1PO
D5S818
D21S11
TH01
TPOX
D13S317
D7S820
D16S539 D18S51
D8S1179
D3S1358
FGA
VWA
AMEL
AMEL
![Page 48: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/48.jpg)
Overview
• Basic – DNA Fingerprinting – Overview: 6 min. Bozeman Science
![Page 49: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/49.jpg)
Use of Short Tandem Repeats
• Non-coding sections (do not code from proteins)
• Inherited from parents – Individuals have 2
copies (alleles)
![Page 50: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/50.jpg)
13 CODIS Core STR Loci with Chromosomal Positions
CSF1PO
D5S818
D21S11
TH01
TPOX
D13S317
D7S820
D16S539 D18S51
D8S1179
D3S1358
FGA
VWA
AMEL
AMEL
![Page 51: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/51.jpg)
Short Tandem Repeats (STRs)
the repeat region is variable between samples while the flanking regions where PCR primers bind are constant
7 repeats
8 repeats
AATG
Homozygote = both alleles are the same length
Heterozygote = alleles differ and can be resolved from one another
![Page 52: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/52.jpg)
Short Tandem Repeats
STRs are short sequences of DNA, normally of length 2-5 base pairs, that are repeated numerous times Example: the 16 bp sequence of "gatagatagatagata" would represent 4 copies of the tetramer "gata".
The polymorphisms (variations in DNA sequence between individuals) in STRs are due to the different number of copies of the repeat element that can occur in a population of individuals.
![Page 53: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/53.jpg)
STR and probability
• Today's DNA profile :: DNA Learning Center
• http://www.dnalc.org/view/15983-Today-s-DNA-profile.html
![Page 54: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/54.jpg)
STR Allele Frequencies
0
5
10
15
20
25
30
35
40
45
6 7 8 9 9.3 10
Caucasians (N=427)
Blacks (N=414)
Hispanics (N=414)
TH01 Marker
*Proc. Int. Sym. Hum. ID (Promega) 1997, p. 34
Number of repeats
Fre
qu
ency
![Page 55: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/55.jpg)
170 bp170 bp195 bp195 bp
Different primer sets produce different PCR product sizes for the same STR allele
TCAT repeat unitTCAT repeat unit
![Page 56: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/56.jpg)
Multiplex PCR• Over 10 Markers Can Be
Copied at Once• Sensitivities to levels less than
1 ng of DNA• Ability to Handle Mixtures
and Degraded Samples• Different Fluorescent Dyes
Used to Distinguish STR Alleles with Overlapping Size Ranges
![Page 57: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/57.jpg)
ABI Prism 310 Genetic Analyzer
capillary
Syringe with polymer solution
Autosampler tray
Outlet buffer
Injection electrode
Inlet buffer
![Page 58: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/58.jpg)
Close-up of ABI Prism 310 Sample Loading Area
Autosampler Tray
Sample Vials
Electrode
Capillary
See Technology section for more information on CE
![Page 59: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/59.jpg)
amelogenin
D19
D3
D8
TH01
VWA D21FGA
D16D18 D2
amelogeninD19
D3D8 TH01
VWA D21
FGA
D16D18 D2
Two
diff
eren
t ind
ivid
uals
DNA Size (base pairs)
Results obtained in less than 5 hours with a spot of blood the size of a pinhead
probability of a random match: ~1 in 3 trillion
Human Identity Testing with Multiplex STRs
Simultaneous Analysis of 10 STRs and Gender ID
AmpFlSTR® SGM Plus™ kit
![Page 60: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/60.jpg)
STR genotyping is performed by comparison of sample data to allelic ladders
Microvariant allele
![Page 61: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/61.jpg)
STR Allele Frequencies
0
5
10
15
20
25
30
35
40
45
6 7 8 9 9.3 10
Caucasians (N=427)
Blacks (N=414)
Hispanics (N=414)
TH01 Marker
*Proc. Int. Sym. Hum. ID (Promega) 1997, p. 34
Number of repeats
Fre
qu
ency
![Page 62: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/62.jpg)
4 types of DNA
• http://learn.genetics.utah.edu/content/extras/molgen/index.html
![Page 63: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/63.jpg)
When nuclear DNA is degraded:
![Page 64: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/64.jpg)
Cases
• OJ Simpson• http://www.trutv.com/library/crime/criminal
_mind/forensics/serology/5.html• Australian• http://www.trutv.com/library/crime/
criminal_mind/forensics/serology/5.html
![Page 65: 23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting](https://reader036.vdocuments.net/reader036/viewer/2022081514/56649f2f5503460f94c492d6/html5/thumbnails/65.jpg)
Blackett Family
• Paternity Case• http://www.biology.arizona.edu/
human_bio/activities/blackett2/overview.html