Advances on the understanding of Spongospora subterranea
development disease in Colombia Elena Paola González Jaimes
Ing. Agr. MSc. Dr.
Politécnico Colombiano JIC – Colombia.
Potato and Spongospora subterranea
in Colombia
• Production of Solanumtuberosum sp andigena (18 varieties), and Solanumpurheja (5 varieties)
• Tropical country (5° SL- 12°NL)• 90.000 farmers• 3 millions of ton year-1
• 125.000 ha year-1
• 20 ton ha-1
• First report 1965.• New report 90´s• Antioquia, Boyacá,
Cundinamarca, Nariño.
Why Spongospora subterranea is a growing problem?
• Susceptible Varieties: Parda Pastusa, DiacolCapiro, ICA Puracé (S. tuberosum) and papacriolla (S. phureja)
• Cold and wet weather every day.
• Absent or few crop rotation
• Tools and soil contaminated
• No legal tuber seed production or sanityinspection for seed tubers.
• Reduction of 23% plants lenght, 32% foliar dryweight, 30% tuber weight.
1. Inoculated species: 33 species, (22 are crops related topotato, 11 weeds of potato crops)
Type Specie
Crops Allium cepa L., Allium sativum L., Apium graveolens L., Beta vulgaris L., Brassica oleraceae L., Cyphomandra betacea Cav., Coriandrum sativum L., Cucumis sativus L., Daucus carota L., Pennisetum clandestinum Hochst. Ex Chiov., Pennisetum sp., Petroselinum crispum (Mill.) Nyman ex A.W. Hill, Phaseolusvulgaris L., Physalis peruvianum L., Pisum sativum L., Raphanus sativus L., Rubus glaucus Benth., Solanumlycopersicum Mill., Solanum quitoense Lam., Zea mays L.
Weeds Brassica campestris L., Brassica napus L., Datura stramonium L., Hypochaeris radicata L., Polygonum nepalense Meisn., Polygonum segetum Kunth, Rumex crispus L., Solanum nigrum L., Sonchus oleraceus L., Taraxacum officinale Weber ex F.H. Wigg., Trifolium repens L.
Potato varieties Solanum tuberosum cv. DIACOL Capiro y Solanum tuberosumcv. ICA Puracé.
Nutritive solution by 12 days.Soil inoculum at 1x106 cistosoriml-1.
• Bioassays inoculation:
Turf
Two real leafs weretranslate to inoculationpots
Germination Inoculation Plots
1 m2, plots artifitialyinoculated
Evaluation:
AT: 100X y 400X)
20 plant: 10inoculated and 10no inoculated.Evaluations at 15days, 1, 2, 3 y 4months
Roots washing withtop water
5 roots plant-1
Stayned: Trypan blue0.05%
Results
Species clasification by S. subterranea f. sp. subterranea
structure observed inside roots:
Type Q Z Specie
No host Absence Absence Trifolium repens L., Beta vulgaris L., Allium sativum L.,
Hypochaeris radicata L., Brassica napus L., Brassica
campestris L.
Trap Plant Absence Presence Polygonum segetum Kunth, Solanum nigrum L.
Host Plant (Type I) Presence Absence Cyphomandra betacea Cav., Solanum quitoense Lam.,
Rumex crispus L., Coriandrum sativum L., Phaseolus
vulgaris L., Pennisetum sp., Cucumis sativus L., Rubus
glaucus Benth.
Host Plant (Type II) Presence Presence Physalis peruvianum L., Petroselinum crispum (Mill.)
Nyman ex A.W. Hill, Daucus carota L., Pennisetum
clandestinum Hochst. Ex Chiov., Zea mays L., Allium
cepa L., Raphanus sativus L., Solanum lycopersicum
Mill., Pisum sativum L., Polygonum nepalense Meisn.,
Sonchus oleraceus L., Apium graveolens L., Brassica
oleraceae L., Taraxacum officinale Weber ex F.H. Wigg.,
Datura stramonium L.
• S. subterranea f. sp. subterranea
Incidence of cistosory and zoosporangia onhost root plants
Confidence interval at 95%Specie Estimate
IncidenceLowerLimit Upper limite
Pennisetum clandestinum Hochst. Ex Chiov. 0,6170 0,4638 0,7549Datura stramonium L. 0,3478 0,1638 0,5727Apium graveolens L. 0,3000 0,1656 0,4653Solanum quitoense Lam. 0,1800 0,0858 0,3144Zea mays L. 0,1800 0,0858 0,3144Solanum lycopersicum Mill. 0,1600 0,0717 0,2911Allium cepa L. 0,1600 0,0717 0,2911Raphanus sativus L. 0,1333 0,0376 0,3072Physalis peruvianum L. 0,1200 0,0453 0,2431Sonchus oleraceus L. 0,1143 0,0320 0,2674Pennisetum sp. 0,0208 0,0005 0,1107Petroselinum crispum (Mill.) Nyman ex A.W. Hill. 0,0750 0,0157 0,2039Phaseolus vulgaris L. 0,0400 0,0049 0,1371Pisum sativum L. 0,0600 0,0125 0,1655Polygonum nepalense Meisn. 0,0526 0,0064 0,1775Polygonum segetum Kunth. 0,0690 0,0085 0,2277Rubus glaucus Benth. 0,0286 0,0007 0,1492Rumex crispus L. 0,0313 0,0008 0,1622Cyphomandra betacea Cav. 0,0303 0,0008 0,1576Solanum nigrum L. 0,0645 0,0079 0,2142Brassica oleraceae L. 0,0800 0,0222 0,1923Coriandrum sativum L. 0,0500 0,0061 0,1692Taraxacum officinale Weber ex F.H. Wigg. 0,0500 0,0061 0,1692Cucumis sativus L. 0,0286 0,0007 0,1492Daucus carota L. 0,0600 0,0125 0,1655
Rev.Fac.Nal.Agr.Medellín 67(2): 7261-7269.
2. Effect of the de Spongospora subterranea f.
sp. subterranea infection on alternatives hosts
during tree consecutive harvest period
Elevation : 2500 m, 14°C.
• Place: Centro Agrario Paysandú, Universidad Nacional deColombia (Medellín).
www.corregimientosantaelena.org
Alternative Host plant evaluated: (19 species)
Common name Cientific name
Onion Allium cepa L.
Celery Apium graveolens L.
Cabbage Brassica oleraceae L.
Coriander Coriandrum sativum L.
Carrot Daucus carota L.
Tomato Solanum lycopersicum Mill.
Grass Pennisetum clandestinum
Hochst. ex Chiov.
Parsley Petroselinum crispum
(Mill.) Nyman ex A.W. Hill
Common name Cientific name
Beens Phaseolus vulgaris L.
Uchuva Physalis peruvianum L.
Green beens Pisum sativum L.
Corazón herido Polygonum nepalense
Meisn.
Radish Raphanus sativus L.
Lengua de vaca Rumex crispus L.
Tamarillo Cyphomandra betacea Cav.
Black nightshade Solanum nigrum L.
Lulo Solanum quitoense Lam.
Sonchus sp Sonchus oleraceus L.
Corn Zea mays L.
Sowing and Harvest:
- Efect of soil inoculum- Presence of Sss structures on and inside roots by microscopy and detection by Real Time
PCR during tree consecutives harvest .
AT: 10X y 40X
Roots forstainedand forqPCR
www.usb.edu.co
DNA extraction and qPCR:
Roots with S. subterranea f. sp.subterranea structuresSamples without structures wereevaluted on bulks of 5 plants. KitDNeasy Plant mini (Qiagen, EEUU).
qPCR: kit Maxima Probe/ROX qPCRMaster Mix (2X).SponF(5´CTTTGAGTGTCGGTTTCTATTCTCCC3´)SponR (5´GCACGCCAATGGTTAGAGACG3´)Sonda TaqMan probe SponP (5´ FAM-TCTTTC AAG CCA TGG ACC GAC CAG A- BHQ-13’)Fragment of 138 pb from the ITS2 regiónof ADNr (Qu et al. 2011).
Programm: Rotor-Gene Q 5plex Platform(Qiagen):Inicial activation: 95ºC by 5 min.45 cycles at 95ºC by 25s and 60ºC by 1 min.Positives at cycle 40 (Shena et al., 2004).
• Statistical Analysis:
Exponential Model
Monomolecular Model
Yi: Incidence of S. subterranea f. sp. subterranea structures (Cistosory (Q),Zoosporangia (Z) or qPCR detection (M)).
: Intercept.
: Relative taxa of epidemic progress for the exponential andmonomolecular model
ei residual error
• Analized on R (R Development Core Team, 2012) statisticalenvironment among MCMCpack (Martin et al., 2011) and Coda (Plummer et al., 2006).
A posteriori estimative for the S. subterranea f. sp. subterranea incidence.
C. betacea, S. nigrum y S. lycopersicum were estimated by the Monomolecular
model, others by Exponential model.
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0 1 2 3 4
C. betacea Cav.
P. peruviana L.
P. crispum (Mill.) Nyman exA.W. HillSolanum sp.
P. clandestinum Holchst. ExChiov.Z. mays L.
A. cepa L.
R. sativus L.
S. lycopersicum Mill.
S. quitoense Lam.
R. crispus L.
Harvest
Inc
ide
nc
e
• D. carota reduced infection on cabagge (P. brassicae) (Macfarlane, 1952).
• D. stramonium reduced severity on powdery scab on 79% (White, 1954).
• R. sativus dicrease the incidence of S. subterranea f. sp. subterranea on 19-39%(Larkin y Griffin, 2007).
• Raphanus sativus var. longipinnatus reduced the inoculum in 71% on plots. Onfield reduced the inoculum in 94% (Murakami et al., 2000).
• Oats (62%), spinach Atlas variety(41%), spinach Baltic variety (29%), radish FR-1
variety (36% ), and radish CR-1 variety (45%), reduction on clubroots severity(Murakami et al., 2001).
• Trap Plants to S. subterranea f. sp. subterranea from microscopical observation indiferent root species. (Qu y Christ, 2006).
• Is possible to asume another trap plant concept: “Plant that even they are planthost they are able to reduce the S. subterranea f. sp. subterranea infection duringthe time, as C. betacea, P. peruviana, S. nigrum, A. cepa, S. Quitoense and R.
sativus can be used as natural control of the patogen.
Results of concordance analysis• Comparation of Microscopy observation vs. qPCR using
SsF/SsR and specific SponP lead.
• 840 samples by microscopy and 280 samples by qPCR
• Using the Kappa index : 0.196
Molecular Microscopy
Negative Positive Total
Negative 196 25 221
Positive 42 17 59
Total 238 42 280
ISSN 1900-4699 • Volumen 9 • Número 2 • Páginas 214-227 • 2013
Genetics Spongospora subterranea
variability in Colombia • 553 samples from Roots, tubers and soil: 150
Carreño 2009. MSc. Tesis
Type I + 1 mutation on 29 samples
Type II + 2 mutation on IT1 + 2 mutation on ITS 2
ITS1-5.8S-ITS2 amplificationwith primers Spo8-Spo9, having fragments of 391pb
Type I - II5 Different haplotypes in Colombia in 2009
Variability….• 210 samples from
tuber, roots and soil : 127
• New variants wereidentified by a PCR-RFLPs test using the Spo8 y Spo9 and SsF/SsRspecific primersand Hin6I y Bsp143I restrictionenzime
Bioagro 24(3): 151-162. (2014)
RFLPs of ITS1, 5.8S and ITS2 from ADN ribosomal of Spongospora subterranea
f.sp. subterranea (Sss) with the restriction enzimes Bsp143I and Hin6I
15,7% soil and tubers
18,9%
65,4%
ADN mitocondrial sequence of S. subterranea
isolated from S. tuberosum ssp. andigena (DiacolCapiro)
• 16 proteins of respiratory chain, 11 ribosomal proteins, 3 RNAs ribosomal, 24 tRNAs and 2 unknow function proteins.
• Were created the Ss_mit_segb_F/R, Ss_mit_segf_F/R y Ss_mit_segg_F/R primers, which has a divergency of 4, 5 and 9% respectively in the identity analisys.
• First report of a ADNmit genomic sequence of a Plasmodiophoridae
Mitochondrial DNA 1736: 1- 2.(2014)
What about our germoplasmresistance variability ?
Solanum phureja germplasm bank of 115 accession
Solanum tuberosum ssp andigena germplasm bank of 1500
Genes differential expression on S. phureja
Rev. Protección Veg. 29(1): 20-32.
Upper expressedgenes codify to metalotioneine(3297 times), fosfatase 2C (2128 times) pectinmetilesteraseinhibitor (2127 times).
Upperexpressed anputative gene and α-Galactosidase(+1000 times)
Management strategies evaluated• Biological control:
– Trichoderma asperellum (Rev.Fac.Nal.Agr.Medellín 62(1): 4783-4792. 2009)
– Trichoderma harzianum, Pseudomonas fluorescents, sawdust from pinus
– Bacteria with chitin and indol activity (Rev. Colomb. Biotecnol. Vol. XIV No. 1 Julio 2012 157-170 157)
• Cultural control:– Different soil type (Andisol, Entisol, Inceptisol) (ACTA
AGRONÓMICA. 61 (2) 2012, p 111-116)
– Crop rotation (Acta biol. Colomb., Vol. 18 n.o 1, 2013 121 – 136;Rev.Fac.Nal.Agr.Medellín 66(2):6987-6998. 2013)
– Resistant varieties (ICA registry, 2015)
Acknowledgements
• Politécnico Colombiano Jaime Isaza Cadavid
• Ministerio de Agricultura y Desarrollo Rural de Colombia
• Asohofrucol
• Universidad Nacional de Colombia, sedeMedellin.
Thanks you!!!Elena Paola González [email protected]