![Page 1: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/1.jpg)
As you come in
• Make two lists under the 2 headings:- ‘Features I got from my mum and
dad’- ‘Features I did not get from my mum
and dad’
![Page 2: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/2.jpg)
Learning objectives• Recall the differences between
environmental and inherited effects• What is a gene?• How does a gene code for a polypeptide
Success criteriaComplete bracelet models to describe
translation.Take away knowledge of key terms.
![Page 3: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/3.jpg)
What is a ‘gene’?What is a ‘locus’?
• Write on a post it note….Stick it on to the chromosome
I think a gene is a type of mythical creature with 3 heads…….
![Page 4: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/4.jpg)
![Page 5: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/5.jpg)
Bracelet sequencing• Decide whether you are a chimp or a
human:
CTATTTGTGGT TCTGAGTTCTTAAAACCCAGTG CTTCGAAGG
![Page 6: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/6.jpg)
Making DNA• Order the original dna sequence
using colour code.• Make a complimentary strand of DNA
(remember DNA is a double helix)
A = blue T = redC = green G = black
![Page 7: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/7.jpg)
Learning objectives• Be able to describe the genetic code• Explain and compare the structure of
RNA(t and m) and DNA• Explain the preocess of transcription
and splicing.
![Page 8: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/8.jpg)
The triplet codeGiven that there are four bases in DNA, and these code for 20 amino acids, what is the basis for the genetic code?
If three bases = one amino acid, possible aminoacids = 64 (4×4×4)
The existence of a three-base (triplet) code was confirmed by experiments by Francis Crick and his colleagues in 1961. The triplet code is degenerate, which means that each amino acid is coded for by more than one triplet.
![Page 9: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/9.jpg)
What is mRNA?When a polypeptide is required, the triplet code of its gene is converted into a molecule of messenger RNA (mRNA).
This process is called transcription and is the first stage of protein synthesis.
Like DNA, mRNA is a nucleic acid, but it differs in that:
it is single stranded, not double stranded
it contains ribose instead of deoxyribose
it contains uracil instead of thymine.
mRNA strand during
transcription
![Page 10: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/10.jpg)
U A G
tRNAmolecule
![Page 11: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/11.jpg)
Differences between DNA and RNA
• Bases• Structure• Pentose sugar• Where is it
found?• Quantity in cells• Stability?
![Page 12: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/12.jpg)
Transcription and codonsDuring transcription, the mRNA is built up by complementary base pairing, using the DNA as a template. The DNA’s base triplets are converted into mRNA codons.
What are the codons in the mRNA transcribed from this sequence of DNA base triplets?
DNA
mRNA
T A C G C A G A T T A C A U G C G U C U A A U G
The genetic code is non-overlapping: each base is only part of one triplet/codon, and each triplet/codon codes just one amino acid.
![Page 13: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/13.jpg)
OVERLAPPING
AACGTAAGCACGTTCGCACCCCAAACACAC
EACH CODON CODES FOR ONE AMINO ACID. However these may be the same amino acid.
![Page 14: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/14.jpg)
What is tRNA?
nucleotides
amino acidattachment site
anticodon
In the cytoplasm, amino acids become attached to transfer RNA (tRNA) molecules. Each tRNA is specific for one amino acid.
Each tRNA molecule has a sequence of three bases called an anticodon. These are complementary to codons on the mRNA molecule.
3’ end
5’ end
hydrogen bond
What is the anticodon for the codon A U G
U A C
![Page 15: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/15.jpg)
What is translation?Once a molecule of mRNA has been transcribed, it moves out of the nucleus via a nuclear pore.
In the cytoplasm, the mRNA combines with a ribosome – the cellular structure on which the polypeptide chain will be built in a process called translation.
How are the correct amino acids transported to the ribosome, and how are they linked together in the correct order?
mRNA strand
ribosome
![Page 16: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/16.jpg)
![Page 17: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/17.jpg)
![Page 18: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/18.jpg)
![Page 19: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/19.jpg)
![Page 20: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/20.jpg)
![Page 21: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/21.jpg)
![Page 22: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/22.jpg)
![Page 23: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/23.jpg)
![Page 24: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/24.jpg)
![Page 25: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/25.jpg)
![Page 26: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/26.jpg)
![Page 27: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/27.jpg)
![Page 28: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/28.jpg)
![Page 29: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/29.jpg)
![Page 30: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/30.jpg)
![Page 31: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/31.jpg)
![Page 32: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/32.jpg)
![Page 33: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/33.jpg)
![Page 34: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/34.jpg)
![Page 35: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/35.jpg)
![Page 36: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/36.jpg)
![Page 37: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/37.jpg)
![Page 38: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/38.jpg)
![Page 39: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/39.jpg)
![Page 40: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/40.jpg)
![Page 41: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/41.jpg)
![Page 42: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/42.jpg)
![Page 43: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/43.jpg)
![Page 44: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/44.jpg)
![Page 45: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/45.jpg)
![Page 46: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/46.jpg)
![Page 47: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/47.jpg)
![Page 48: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/48.jpg)
![Page 49: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/49.jpg)
![Page 50: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/50.jpg)
![Page 51: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/51.jpg)
![Page 52: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/52.jpg)
![Page 53: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/53.jpg)
![Page 54: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/54.jpg)
![Page 55: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/55.jpg)
![Page 56: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/56.jpg)
![Page 57: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/57.jpg)
![Page 58: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/58.jpg)
![Page 59: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/59.jpg)
![Page 60: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/60.jpg)
![Page 61: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/61.jpg)
![Page 62: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/62.jpg)
![Page 63: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/63.jpg)
Next step in the polypeptide process
• Unwind your double helix• You are going to write the mRNA
sequence to your original DNA strand on your strip of card.
AGCUGUCUAGUAB
C
![Page 64: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/64.jpg)
Next is the tRNA• Write on your tRNA molecules the
anticodons which are complimentary to the codons on your mRNA sequence.
• Next, write down the Amino Acids which are attatched to the specific amino acids.
![Page 65: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/65.jpg)
AMINO ACID LINKED TO tRNA ANTICODONS
Valine - CAU/ CACAspargine – UUGSerine – AGAGlutamate - CUCPhenylalanine – AAA/AAGLeucine - AAUArganine - GAAProline - GGU
![Page 66: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/66.jpg)
What happens during translation?tRNA molecules attach to the ribosome, and their anticodons pair up with the appropriate codons on the mRNA.
The amino acids transported by the tRNA link together, and the tRNA molecules then return to the cytoplasm.
The ribosome moves along the mRNA, and amino acids continue to join together until all the codons have been translated and the polypeptide is complete.
![Page 67: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/67.jpg)
Draw a chromosome
SIMILARITIES
DIFFERENCES
![Page 68: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/68.jpg)
mRNAANDtRNA
![Page 69: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/69.jpg)
CODONAND
ANTICODON
![Page 70: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/70.jpg)
DNAANDRNA
![Page 71: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/71.jpg)
Extension ‘ how do genes code for polypeptides?’
Answer this question using the following key words:
Gene complimentary transcribe Ribosome tRNA Amino acids peptide bonds DNA translate mRNA
![Page 72: As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad](https://reader035.vdocuments.net/reader035/viewer/2022062311/5a4d1b7b7f8b9ab0599b9414/html5/thumbnails/72.jpg)
Learning objectives• What is a gene?• How does a gene code for a
polypeptide
Success criteriaComplete bracelet models to describe
translation.Take away knowledge of key terms.