![Page 1: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/1.jpg)
By RABIA DURRANI
Department of MicrobiologyQUAID-I-AZAM UNIVERSITY, ISLAMABAD.
![Page 2: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/2.jpg)
Results
Materials and Methods
Introduction
Objectives of Study
![Page 3: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/3.jpg)
INTRODUCTIONINTRODUCTION
Focus of the study
Disease and it’s causative agents
![Page 4: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/4.jpg)
Focus of the studyFocus of the study
1. Livestock and Poultry sectors are among the major
contributors in the economic growth of Pakistan
2. Both sectors are facing serious problems; among
them are some dangerous diseases like Hemorrhagic
Septicemia (HS) which are posing a huge risk to the
economic development in these sectors
3. The focus of the research was to study the disease
and identify the agents responsible for.
![Page 5: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/5.jpg)
Disease and it’s causative agent(s)Disease and it’s causative agent(s)
Pasteurella multocida is Gram negative, Non-spore forming, cocobacillus bacterium
Commensals of upper respiratory tract of livestock and Poultry
Causes severe Hemorrhagic septicemia (HS)
HS occurs as catastrophic epizootics in Asia and Africa
![Page 6: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/6.jpg)
Several cases of HS reported in Wild animals also.
Common serotypes are Asian B:2 and African E:2
In wild animals B:2,5 strain is most common.
Vaccination is achieved by Whole cell preparations.
Common Vaccines are alum precipitated and Oil adjuvant.
Disease and it’s causative agent(s) (Continued….)
![Page 7: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/7.jpg)
Live Intranasal Vaccine B:3,4 serotype of deer origin found successful in South East Asia. (Muneer and Afzal, 1989).
Common cause of HS disease is Vaccination Failure and that is why death rate of animals is High in South East Asia.
Disease and it’s causative agents (Continued….)
![Page 8: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/8.jpg)
Objectives of StudyObjectives of Study
Comparisons of isolates from clinically diseased animal (animal suffering from Hemorrhagic Septicemia) for their microbiological profiles to explore any gross difference.
Study of molecular profiles to elucidate further proteomics.
To collate and analyze the data obtained and to examine perception of the scientific workers that Pasteurella multocida is an opportunistic pathogen.
![Page 9: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/9.jpg)
MATERIALS AND METHODSMATERIALS AND METHODS
Sample collection & Identification of clinical
isolates
Antibiogram analysis of Pasteurella multocida
Molecular Characterization of P. multocida
P. multocida species specific PCR
HS-associated type B serotype specific PCR
Protein Profile Analysis of P. multocida by SDS-PAGE
Whole Cell Profile of P. multocida
Envelop profile of P. multocida
Restriction enzyme analysis of P. multocida
![Page 10: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/10.jpg)
Samples were collected from National Veterinary Labs Islamabad that were brought into the lab from different cities
Nature of the samples were lungs and spleen tissues of animals.
Gram staining of Organism
Subculturing and Purification
Biochemical characterization Catalase test Oxidase test Growth in the absence of CO2
Sample Collection and Identification of clinical isolates
![Page 11: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/11.jpg)
Urease production test H2S Production Test Nitrate reduction test Motility test
Injecting mice with clinical isolates of clinical Isolate
API 20 NE Test (Biomeurix )
Hyaluronidase Enzyme test for Pasteurella multocida (Smith et al., 1968)
Identification of clinical isolates (Continued….)
![Page 12: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/12.jpg)
Antibiogram analysis of Pasteurella multocida
Differentiation of clinical isolates by microbiological staining dyes:
◦ Crystal violet
◦ Malachite Green
◦ Safranin
◦ Congo Red
![Page 13: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/13.jpg)
Molecular Characterization of Pasteurella multocida
Crude method of DNA extraction
Amplification of Extracted DNA of Pasteurella multocida by Polymerase Chain Reaction (PCR)
P. multocida species specific PCR assay
![Page 14: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/14.jpg)
Primer sequences were:
KMT1SP6 5’ - GCTGTAAACGAACTCGTCGTCGCCAC3-3’
KMT1T7 5’- ATCCGCTATTTACCCAGTGG-3’
P. multocida species specific PCR
![Page 15: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/15.jpg)
PCR Master Mix Preparation
PCR master mix about 20µl was prepared as follows: H2O 13µl MgCl2 02µl dNTPs 01µl Primer 1 01µl Primer 2 01µl PCR Buffer 1.5µl Taq Polymerase 0.5µl
Total Volume: 20µl
Then 5µl –extracted DNA was added, and makes the final volume upto 25µl.
![Page 16: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/16.jpg)
The thermal cycling parameters were as follows:
The initial denaturation at 94°C for 5minutes;
30cycles of:◦ 94°C for 1minute◦ 53°C for 1minute (for primer annealing)◦ 72°C for 1minute (extension)
Final extension at 72°C for 9minutes.
![Page 17: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/17.jpg)
Analysis of PCR product
About 8µl of PCR product were separated by
electrophoresis on 2% High melting Agarose gel in 1X
Tris-Boric acid running buffer (TBE) at 4V/cm for 1
hour .The gel was stained with 1% ethidium bromide
and DNA fragments were viewed by Gel documentation
system.
![Page 18: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/18.jpg)
PCR assay for HS-associated type B serotype Pasteurella multocida
PCR analysis for HS –associated type B serotype P.
multocida identification was performed.
◦ Primer pair used:
KTSP61
KTT72
These primers specifically amplify a product of
approximately 560 base pair (bp) in all HS causing
serotype of P. multocida.
![Page 19: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/19.jpg)
Primer sequences were:
KTT72 5’- AGGCTCGTTTGGATTATGAAG-3’
KTSP61 5’ – ATCCGCTAACACACTCTC-3’
HS causing Type B gene specific PCR test
![Page 20: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/20.jpg)
PCR master mix preparation
PCR master mix about 20ul was prepared as follows:
◦ H2O 13µl◦ MgCl2 02µl◦ dNTPs 01µl◦ Primer 1 01µl◦ Primer 2 01µl◦ Buffer 1.5µl◦ Taq Polymerase 0.5µl◦ Total Volume: 20µl
Then 5ul of extracted DNA was added, and make the final volume upto 25µl.
![Page 21: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/21.jpg)
The thermal cycling parameters were as follows:
The initial denaturation at 94°C for 5minutes;
30cycles of:◦ 94°C for 1minute
◦ 53°C for 1 minute
◦ 72°C for 1minute
Final extension at 72°C for 9minutes.
![Page 22: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/22.jpg)
Protein Profile Analysis of P. multocida by SDS-PAGE
Harvesting of Culture
Washing of Cells
Sonication (Disruption) of Cells for Whole Cell
Preparation
Preparation of Whole-cell for SDS-PAGE
Preparation of Envelope
Staining and Destaining of Gel
Determination of Molecular Weight of Proteins
![Page 23: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/23.jpg)
For the extraction of proteins, thick growth of pure P.
multocida were taken with the help of Pasteur pipette
and dipped in the ependorff tube containing 200µl-
distilled water.
Then they were vortexed with the help of (IKA USA
mixer) thoroughly to dissolve completely.
After dissolving the samples were sonicated in
(dr.hielscher, type UP 400S).
Whole Cell Profile of Pasteurella multocida
![Page 24: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/24.jpg)
Sonicated for: - ◦ 30 second stroke ◦ 30 second cooling ◦ Amplitude 80 to 100◦ Cycle 0.5 to 1
After sonication:◦ centrifugation at 12,000 rpm◦ Time 5 min
The microcentrifuge was used to remove intact cells. The supernatant was taken as whole cell and boiled in boiling water along with 4X sample loading buffer for 5minutes at 100°C before loading on gel
![Page 25: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/25.jpg)
High Energy Probe Sonicator (DR. HEILSCHER Type 2005, Germany)
![Page 26: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/26.jpg)
Envelop profile of Envelop profile of P.multocidaP.multocida
Preparation of Envelope (Irfan et al.,2008)
Thick growth of P. multocida culture was:
◦ Suspended in 2ml of distilled water in eppendorff tube
◦ Centrifuged at 20,000rpm for 30minutes at 8˚C.
◦ The pellet was resuspended in 20mM Tris-HCl buffer and again
centrifuged at 20,000rpm for 30minutes.
◦ The final pellet rich in envelop was resuspended in 20mM Tris-
HCl buffer and stored at –20°C for further SDS-PAGE analysis.
![Page 27: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/27.jpg)
Restriction enzyme analysis of P.multocidaRestriction enzyme analysis of P.multocida
Steps Involved
10 X restriction endonuclease buffer DNA Distilled water Restriction enzyme and then gently mix the contents Centrifuge for few seconds in a microfuge and the
incubate at 37°C for 1-4 hours Heat the reaction at 65°C for 20 minutes Run the digests on gel
![Page 28: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/28.jpg)
RESULTSRESULTS
Characterization of P.multocida Cultural and microscopic
Biochemical
Analytical Profile Index (API) test
Antibiotic sensitivity
Hylouronidase production
Differentiation by microbiological staining dyes
PCR
SDS-PAGE
![Page 29: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/29.jpg)
Cultural Characterization of P.multocida
On Brain Heart Infusion (BHI) agar and Nutrient agar:◦ Convex colonies◦ Entire edges◦ Mucoid and sticky nature ◦ Approximate size of 2-3 mm diameter
On blood agar, all the pure culture showed:◦ Luxuriant growth◦ Translucent grayish or yellowish green colonies◦ No haemolysis
On MacConkey agar:◦ No growth
Staining of P.multocida The Gram staining shows:
◦ Pleomorphic, gram negative, coccobacilli◦ 0.2-0.4 mm in size
![Page 30: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/30.jpg)
Colony morphology of P.multocida
![Page 31: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/31.jpg)
Gram staining of P.multocida
![Page 32: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/32.jpg)
Biochemical test results of P.multocida
![Page 33: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/33.jpg)
Table 1. Common biochemical properties of Table 1. Common biochemical properties of Pasteurella Pasteurella multocidamultocida
![Page 34: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/34.jpg)
API test results of P.multocida
![Page 35: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/35.jpg)
API test results of P.multocida
![Page 36: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/36.jpg)
Table 2. Analytical Profile Index (API) test results of Table 2. Analytical Profile Index (API) test results of Pasteurella Pasteurella multocidamultocida
![Page 37: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/37.jpg)
Antibiotic sensitivity test for P.multocida
![Page 38: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/38.jpg)
Antibiotic sensitivity test for P.multocida
![Page 39: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/39.jpg)
Table 3. Number of clinical isolates sensitive to the Table 3. Number of clinical isolates sensitive to the antibioticsantibiotics
![Page 40: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/40.jpg)
Rapid plate screening test for Hyaluronidase production of P.multocida
![Page 41: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/41.jpg)
Table 4. Results of Hylouronidase production by Table 4. Results of Hylouronidase production by P.multocidaP.multocida
S.No Name of City Number of Isolates
Appearance of white precipitate
Hyaluronidase (+)
Hyaluronidase (-)
01 18 06 12
02 Kahutta 06 04 2
03 Badin 04 03 1
04 05 including B:3,4
04 1
05 Taxila 02 02 0
06 06 04 2
07 Toba Tek Singh 06 05 1
08 04 03 1
09 07 04 3
10 Samundri 03 02 1
11 Faislabad 09 08 1
![Page 42: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/42.jpg)
Differentiation of Clinical strains of P.multocida by different staining dyes
![Page 43: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/43.jpg)
Table 5. Differentiation of Clinical isolates by Table 5. Differentiation of Clinical isolates by Microbiological staining dyesMicrobiological staining dyes
S.No Name of CityNo. of Isolates
Name of Dye (Conc. in µg) Observed zone of Inhibition(mm)
Crystal Violet
Safranin Malachite Green
Congo Red
0.1,1,5 0.1,1,5 0.1,1,5 0.1,1,5
01 37 0 0 0 0 0 0 0 0 0 0 0 0 No zone02 Badin 04 0 0 0 0 0 0 0 0 0 0 0 0 No zone03 Tando Jam 07 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 04 Taxila 05 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 05 12 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 06 Samundri 04 0 0 0 0 0 0 0 0 0 0 0 0 No Zone07 Khurrianwala 03 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 08 Toba Tek Singh 03 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 09 Jaranwala 15 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 10 Bakkar 11 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 11 15 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 12 12 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 13 10 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 14 15 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 15 Abbotabad 05 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 16 Khushab 06 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 17 Kahutta 08 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 18 Faislabad 03 0 0 0 0 0 0 0 0 0 0 0 0 No Zone
![Page 44: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/44.jpg)
PCR results of P.multocida
![Page 45: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/45.jpg)
Amplification of Extracted DNA of Pasteurella multocida by PCR
All samples when run on Agarose Gel Electrophoresis
showed:◦ Bands of base pairs 560 and 750
◦ The DNA ladder started from 100 base pairs.
![Page 46: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/46.jpg)
Table 6. PCR results of P.multocida
![Page 47: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/47.jpg)
Whole cell profiles of P.multocida HS and Non-HS (Badin)
![Page 48: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/48.jpg)
Conclusions & Future Prospect
Organism was genetically conserved and there is no demostratable diversity with in the number of samples tested.
Isolates from wild life be included in such studies.
This organisms maintains harmlessly inhealthy animals and causes disease as an opportunistic pathogen in extreme stress to animals.
By further studies we can devise better methods for control against disease caused by this organism.
![Page 49: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/49.jpg)
THANK YOU
![Page 50: By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD](https://reader036.vdocuments.net/reader036/viewer/2022062407/56649d6c5503460f94a4b972/html5/thumbnails/50.jpg)
YOUR QUESTIONS ????