Cloning and Expression of Phytase (PhyA) Gene for supplementation of
Poultry
:By Dalia Abu Issa
Supervisor:
Dr.Fawzi Razem
Outlines:
• Introduction• Statement of problem• Aim of study • Material and Methods• Results and Discussion• Conclusion• Future work
IntroductionPoultry
• Because poultry products are in demand around the world;
• and because chickens and other poultry can be reared in almost any part of the world,
• a renewed interest in poultry projects in all fields.
Poultry in Palestine
• There is a large commercial chicken industry in palestine
• We depend on chicken that provides us as a first supply with eggs and meat.
Poultry Food
• Feed for poultry mostly consists of grain.
• Which consist of P , Ca , zinc ,magnesium and iron ,
What is the problem?
Statement of problem
• plant especially bran and seeds store 80% of P as Phytic acid
• The problem is poultry have not the enzyme phytase that can librate P from its storage as phytic acid.
Statement of problem
• So farmers add inorganic P to the poultry feed in order to utilize it
• result in execration of all Inorganic P in their manure to cause environment P pollution especially in water resources at animal production areas
Aim of study
• to provide phytase gene (phyA) suitable for protein expression into phytase enzyme to
supplement poultry feed in Palestine
Materials and Methods
• Aspergillus niger strain 103 isolation• RNA Extraction from Aspergillus niger cell
Collection and • cDNA Synthesis from mRNA that Extracted
from Aspergillus niger
• Amplification and Visualization of a phytA Gene from Aspergillus niger cDNA
• To amplify the cDNA phytA gene, DNAMAN software was used to design primers based on the phytA sequence NCBI accession number AB022700 as follows:
• Phytase F 5`- ATGGGTGTCTCTGCCGTTCTAC -3` • phytase R 5`- CTAAGCGAAACACTCCCCCC -3`
• Sequencing of purified plasmid• Subsequent Cloning of phytA Gene into p
PROEXH-Tb Expression Vector
• Successful cloning of phytA gene in p GEM-T-Easy cloning vector ,
• Cloning was verified by PCR
1500 bp
Conclusion
• We have now a clone of phyA gene which is 98% homology to aspergillus niger phytase
gene at NCBI