Transcript
Page 1: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre - lox Technology and Breeding Schemes for Research

Emily L. Jocoy, PhDTechnical Information Scientist

GeneX

GeneX

(promoter) Cre

loxPGeneXloxP

loxPGeneXloxP

X

Page 2: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Leading provider of genetically defined mice and services including

pre-clinical research

World renowned non-profit genetics research institute and international

training center

Bar Harbor, Maine

Sacramento, California

The Jackson Laboratory

Page 3: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

The Jackson Laboratory

Research: investigating genetics and biology of human disease

Resources: JAX® Mice & Services, bioinformatics data, technical

publications and more…

Education: world-class courses, internships and other programs

www.courses.jax.orghttp://jaxmice.jax.org/webinar/index.html

Page 4: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

• NIH funded resource • 5,000 strains and growing

– 2.7 million mice shipped annually– 16,000 investigators globally

• Unsurpassed genetic quality & animal health• Best characterized & referenced ~100 new pubs/week• Common inbred strains (C57BL/6J, BALB/cJ, DBA/2J) support

development/collection of specialty strains and other valuable community research resources

JAX® MiceThe Gold Standard for Biomedical Research

Page 5: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Online Resources

• JAX® Mice Databasewww.jax.org/jaxmice

• Technical Support Onlinewww.jaxmice.jax.org/support

• Mouse Genome Informaticswww.informatics.jax.org

• Mouse Phenome Database www.jax.org/phenome

• And many more unique resources

Page 6: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

C57BL/6J – Most Characterized

http://phenome.jax.org/pub-cgi/phenome/mpdcgi?rtn=strains/details&stocknum=000664

Page 7: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Baseline Blood Pressure

Strain Surveys

Page 8: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

JAX® Services

• Breeding & colony management• Revolutionary cryopreservation & recovery• Phenotyping & efficacy testing• Genetic research services• Surgical & preconditioning services• Use of innovative technologies and state-of-the-art equipment• Flexibility to develop customized approaches

JAX® Mice & Services

[email protected] • 1-800-422-6423 • 1-207-288-5845 • www.jax.org/jaxmice

Page 9: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Presentation Overview

• Basic Cre-lox mechanism

• Strain types and breeding schemes – Tissue-specific knockouts– General knockouts– Inducible knockouts– Reporters

• Cre-lox web resources (finding mice, Cre activity data, and more)

Page 10: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

A Revolutionary Genetic Tool

Cre-lox system• Natural part of P1 bacteriophage

viral life cycle• Viral DNA injected into bacteria,

circularized using Cre-lox, and replicated for development of new viruses

Cre

Bacteriophage

Page 11: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre-lox Successfully Engineered in Other Organisms

• Yeast• Plants• Mammalian cell cultures• Mice

Allows• Alteration & deletion of DNA• Regulation of location and

timing of gene recombination

Page 12: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

A Simple, Two Component System

Cre recombinase• Site-specific enzyme, catalyzes recombination

between two loxP sites

loxP site• 34 base pair DNA sequence• Location and orientation determines recombination result:

– Deletion– Inversion– Translocation

Reviewed in Nagy A. 2000. Genesis 26(2):99-109. PMID: 10686599

ATAACTTCGTATAGCATACATTATACGAAGTTAT

Cre

Abundant possibilities for genome manipulation!

Page 13: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre - lox DeletionFloxed target gene

Knockout allele

X

GeneX loxP

GeneX

loxP loxPGeneX

loxP

Cre excision

Page 14: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre

loxP loxPGeneX

loxP loxP

GeneX

Cre - lox Inversion

Page 15: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre

Chr 3

Chr 6 loxP

loxP

Reciprocal Translocation (3;6) loxP

loxP

Cre - lox Translocation

Page 16: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

xAlb cre

GeneX

GeneX

loxPGeneXloxP

GeneXloxP loxP

Liver-specific cre transgeneEx: B6.Cg-Tg(Alb-Cre)21Mgn/J

(Stock No. 003574)

homozygous loxP (“floxed”) mouse

Cre - lox Tissue-Specific Knockout

Page 17: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

xAlb cre

GeneX

GeneX

loxPGeneXloxP

GeneXloxP loxP

Liver-specific cre transgeneEx: B6.Cg-Tg(Alb-Cre)21Mgn/J

(Stock No. 003574)

homozygous “floxed” mouse

Cre - lox Tissue-Specific Knockout

loxPGeneXloxP

Alb cre

GeneX

Cre-lox mouse: heterozygous for geneX conditional knockout after 1 generation

Page 18: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

x

GeneX

Alb cre

loxPGeneXloxP

GeneXloxP loxP

homozygous “floxed” mouse

GeneX

loxP loxP

loxPloxP

Cre - lox Tissue-Specific Knockout (cont.)

25% homozygous for geneX conditional knockout after 2 generations

Alb cre

GeneX

loxPGeneXloxP

hemizygous creheterozygous “floxed” gene

Page 19: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Improving Conditional Knockout Efficiency

xAlb cre

GeneX

loxPGeneXloxP

loxPGeneXloxP

Alb cre

hemizygous creheterozygous “floxed” gene

12.5% conditional GeneX knockouts

heterozygous null mouse(traditional knockout)

GeneX

Page 20: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Improving Conditional Knockout Efficiency

x

loxPGeneXloxP

Alb cre

loxPGeneXloxP

GeneXloxP loxP

homozygous “floxed” mouse

25% conditional GeneX knockouts

(cont.)

hemizygous creheterozygous null mouse

GeneX

Alb cre

Page 21: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre-lox Germline Knockouts

xhomozygous

“floxed” mouse

GeneX

loxPGeneXloxP

oocyte-specific cre expression Ex: C57BL/6-Tg(Zp3-cre)93Knw/J

(Stock No. 003651)

ZP3 cre

OvaryZP3 cre

Oocytes

2 more generations to produce homozygote null mouse

Page 22: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre - lox Knockout Breeding Scheme

xhomozygous loxP mouse Cre mouse – cre transgene (Tg)

early, widespread expression promoterFVB/N-Tg(EIIa-Cre)C5379Lmgd/J

(Stock No. 003314)

EIIa Cre

Offspring: 50% heterozygous knockout after 1 generation

loxPGeneXloxP

loxPGeneXloxP

GeneX

GeneX

GeneX

Page 23: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre - lox Knockout Breeding Scheme

Offspring 2nd generation: 25% homozygous knockout

GeneX GeneX

X

Page 24: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre-lox SummaryTissue-specific deletion• 2 generations of breeding• Cre required to maintain line

for future generations• Genotype of whole mouse:

homozygous flox; Cre• Tissue-specific genotype:

homozygous flox-deleted; Cre

loxPGeneXloxP

loxPGeneXloxP

Alb Cre

Germline/Embryonic deletion• 2-3 generations of breeding• Cre not required after germline

deletion (can breed it out)• Genotype of whole mouse,

germplasm, organs & tissues: homozygous flox-deleted (knockout) for gene of interest

Page 25: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Inducible Cre Mouse Models

xhomozygous loxP mouse Inducible Cre mouse –

tamoxifen dependent Cre functionEx: B6.Cg-Tg(Cre/Esr1)5Amc/J

(Stock No. 004682)

Induce homozygous knockout of GeneX with tamoxifen

+ Tamoxifen

2 Generations

loxPGeneXloxP

loxPGeneXloxP

Page 26: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Considerations

• Mosaicism: some target cells may not express Cre, or loxP sites may not recombine– May be integration site specific; evaluate multiple

cre transgenic founders• loxP site recombination efficiency affected by position• Cre could be active in ectopic locations (including

germline)• Cre may produce a phenotype by itself

– Insertion site effects– “Cre toxicity”

Consider using the Cre transgenic line itself as a control

Cre mosaicism in mouse mammary

gland epithelial cells

Schmidt-Supprian M and Rajewsky K. 2007. Nat Immunol 8(7):665-8. PMID: 17579640

Page 27: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Considerations (cont.)

• Target gene may be expressed prior to Cre recombination• If possible, have cre transgene on a different chromosome

than the floxed allele• Often good idea to breed out cre transgene after germline

deletion• Consider that genetic background may affect phenotype

Page 28: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Reporter Strains

Blue(LacZ)

Green (GFP or ZsGreen)

Yellow(YFP)

Red(RFP or tdTomato)

Cyan(CFP)

Page 29: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Reporter Strains• Used to assess Cre activity in tissue(s) of interest• Only one generation of breeding needed• Ex: B6.129S4Gt(ROSA)26Sortm1Sor/J (Stock No. 003474)

Promotor loxP loxP lacZ

X

Promotor loxP lacZ

STOP

Page 30: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Reporter DataB6.129S4-Gt(ROSA)26Sortm1Sor/J (Stock No. 003474)

ControlLacZ expression following widespread Cre recombination

Soriano P. 1999. Nat Genet 21(1):70-1.

Page 31: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Reporter Breeding SchemeB6.129S4-Gt(ROSA)26Sortm1Sor/J (003474)

xB6.129S4-Gt(ROSA)26Sortm1Sor/J

Cre reporter strainEx: heart-specific cre transgenic

**Could be any Cre recombinase strain

Cre

LacZ stain confirms Cre activity in expected tissues

loxPloxP LacZ

loxPloxP LacZ

Myh6

1 Generation

loxP LacZ

CreMyh6

Page 32: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Other Cre Reporter VariationsReporter switching

STOCK Tg(ACTB-Bgeo/GFP)21Lbe/J (Stock No. 003920)

Promotor loxP loxP GFPlacZ

Promotor loxP GFP

STOP

Page 33: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre - lox Disease ModelB6.129S4-Krastm4Tyj/J (Stock No. 008179)

Promoter loxP loxP Kras G12D oncogeneSTOP

X

Promoter loxP Kras G12D oncogene

Tuveson DA et al. 2004. Cancer Cell 5(4):375-87. PMID: 15093544

Page 34: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

xMMTV Cre

Only one round of breeding needed

loxP STOP Kras G12D

STOCK Tg(MMTV-cre)4Mam/J(Stock No. 003553)

Cre - lox Disease ModelsB6.129S4-Krastm4Tyj/J (Stock No. 008179)

loxP

loxP Kras G12D

Tuveson DA et al. 2004. Cancer Cell 5(4):375-87. PMID: 15093544

Page 35: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Other Cre - lox VariationsConditional Transgene with Reporter

Promotor loxP loxP TransgeneXLacZ

Promotor loxP TransgeneX

STOP

Page 36: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Other Cre - lox VariationsConditional Transgene with Fusion Protein Reporter

Promotor loxP loxP TransgeneX

Promotor loxP

GFP

TransgeneX GFP

STOP

Page 37: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Promotor loxP loxP

Promotor loxP

STOP TransgeneX GFPIRES

TransgeneX GFPIRES

Other Cre - lox VariationsConditional transgene with reporter

Page 38: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Other Cre reporter Variations:“Brainbow” Mice

• Multiple fluorescent protein sequences

• Pairs of incompatible loxPsites

• loxP sites alternated to create mutually-exclusive recombination events

• Following cre excision, one of 3 outcomes (colors) possible in cre expressing cells/tissues

Livet J et al. 2007. Nature 450(7166):56-62. PMID: 17972876

Page 39: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

“Brainbow” Mice

• Tamoxifen-inducible CAG-Cre transgenic

• Cell autonomous expression of RFP, YFP & CFP

• Neurons & some astrocytes of the dentate gyrus in the hippocampus

Livet J et al. 2007. Nature 450(7166):56-62. PMID: 17972876

Page 40: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

“Brainbow” Mice

B6.Cg-Tg(Thy1-Brainbow1.0)HLich/J (007901)8 transgene copies & 90 color variations

B6;CBA-Tg(Thy1-Brainbow1.0)LLich/J (007910)>8 transgene copies & 166 color variations

Multiple copies & multiple integrations of the Brainbow transgene

Like pixels on a TV screen—combinations of fluorophores produce expanded color palettes

3 transgene copies & 10 color variations

Livet J et al. 2007. Nature 450(7166):56-62. PMID: 17972876

Page 41: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Improved Fluorescent Cre Reporters

B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J (007903)B6.Cg-Gt(ROSA)26Sortm2(CAG-EYFP)Hze/J (007920)B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (007905)B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (007909)B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (007914)B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J (007906)

Dr. Hongkui Zeng, Allen Institute for Brain ScienceMadisen L et al. 2010 Nat Neurosci 13(1): 133-40. PMID: 20023653

http://transgenicmouse.alleninstitute.org/

Page 42: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Allen Institute for Brain ScienceNew cre reporters x brain-specific cre transgenics

http://transgenicmouse.alleninstitute.org/

B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (007909) x B6.Cg-Tg(Camk2a-cre)T29-1Stl/J (005359)

Page 43: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Allen Institute for Brain Science

http://transgenicmouse.alleninstitute.org/

B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J (007906) x FVB-Tg(GFAP-cre)25Mes/J (004600)

Page 44: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

JAX Cre Repository

Largest collection of Cre – lox strains • 250+ cre-expressing • 80+ inducible Cre strains• 310+ floxed genes• 60+ floxed Stop Cre reporters• Importing over 200 new neuronal specific Cre strains

http://cre.jax.org/NeuroCres.html

http://cre.jax.org

Page 45: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

http://cre.jax.org

JAX Cre Repository

Page 46: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Search by keyword within

browser

Page 47: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

http://cre.jax.org/data

Cre Expression Data

Page 48: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Portal @ MGI

www.creportal.org

Page 49: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Cre Portal Search ResultsLink to Phenotypic Data, Images, & References

Page 50: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Tg(ACTA1-cre)79Jme Strain Details

Page 51: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX

Thank you!

Would you like to create multiple tissue-specific knockouts but lack the vivarium space to do more than one cross at a time? We can help. Contact us today.

JAX® Mice & Services

[email protected] • 1-800-422-6423 • 1-207-288-5845 • www.jax.org/jaxmice


Top Related