Download - Diff. beta cells
![Page 1: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/1.jpg)
Beta cells Progenitors and its
Differentiation in Zebrafish
By,
Dorisa Jenifer .W
![Page 2: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/2.jpg)
A brief overview
• Diabetes is a disease of high blood sugar. In India, more than 62 million
individuals are currently diagnosed with diabetes. In 2013 it was estimated that
over 382 million people throughout the world had diabetes.
•Researchers demonstrate that 70 per cent of protein-coding human genes are
related to genes found in the zebrafish and that 84 per cent of genes known to be
associated with human disease have a zebrafish counterpart.
•Thus, studying zebrafish behaviour in response to a drug or compound can
give us a better understanding of what the drug effects might be on humans as
well
![Page 3: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/3.jpg)
A Drug Discovery Model
![Page 4: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/4.jpg)
![Page 5: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/5.jpg)
![Page 6: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/6.jpg)
![Page 7: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/7.jpg)
Alternatives for Insulin Production
• Beta (β) cells are unique cells in the pancreas that produce, store
and release the hormone insulin located in the area of the pancreas known
as the Islets of Langerhans.
• The appropriate function of insulin-producing pancreatic beta-cells is
crucial for the regulation of glucose homeostasis, and its impairment leads
to diabetes mellitus, the most common metabolic disorder in man.
• Even though insulin is a life saver, it does not cure the disease. Insulin
injections themselves are not without risk. Improvements in the
treatment of diabetes will come from a better understanding of how
insulin is made in the pancreas and released into the bloodstream, and
how it promotes uptake of circulating glucose by tissues including
muscle and fat.
![Page 8: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/8.jpg)
Organs of Zebrafish
![Page 9: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/9.jpg)
![Page 10: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/10.jpg)
![Page 11: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/11.jpg)
• The pancreas serves two major functions
(i) production of digestive enzymes by exocrine cells
(ii) Regulation of blood sugar by endocrine cells
• The mature exocrine part of pancreas consist of acinar cells connected to the intestine via a highly branched ductal tree.
• The endocrine part of pancreas is comprised of islets of Langerhans that are primarily scattered through the central regions of the organ. Several cells comprise the islet:
1. β cells (50-80%) and tend to segregate the islet core,
2. Glucagon producing alpha cells are the next most common type.
3. δ cells that produce somatostatin,
4. PP cells that produce pancreatic polypeptides, and
5. ϵ cells that produce ghrelin
• The zebrafish main pancreas is located on the right side of the adult fish, attached to the lateral aspect of the duodenum by the pancreatic duct. Typically, one large islet and 3–6 smaller islets occupy the main pancreas of the adult zebrafish. The tail of the pancreas is embedded with single β-cells.
![Page 12: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/12.jpg)
![Page 13: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/13.jpg)
Pancreatic Transcription Factors
• Transcription factor is a protein molecule which specifically binds to DNA
sequences, and hence controls the rate of transcription of genetic data’s from DNA
to messenger RNA.
• During pancreatic developmental stage, transcription factors require certain
sequential regulated expression to produce regular organogenesis.
• Some specific transcription factors are activated during pancreatic development at
early stage and β-cell differentiation, which may be switched off as the β-cell
matures slowly. Some transcription factors like, Pdx-1, Pax 4, Ptf1a are involved in
both early β-cell differentiation and mature β-cell function.
• In this research, the focus is on Transcription factors Pdx1, and Ptf1a.
![Page 14: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/14.jpg)
![Page 15: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/15.jpg)
Cell fate choices
![Page 16: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/16.jpg)
![Page 17: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/17.jpg)
![Page 18: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/18.jpg)
β-cells expressing Pdx1
![Page 19: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/19.jpg)
Pancreatic lineages
![Page 20: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/20.jpg)
Mechanism of Insulin Secretion
![Page 21: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/21.jpg)
Routes of β cells
![Page 22: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/22.jpg)
![Page 23: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/23.jpg)
Strategies to generate new β-cells
![Page 24: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/24.jpg)
β cells in 18 somite stage
![Page 25: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/25.jpg)
CONDITION NUMBER OF BETA CELLS ( 7 dpf)
Ganciclovir (GCV) treated 40±1
Untreated 30±2
RATE OF BETA CELL REPLIATION:
While performing beta cell nuclei counting through confocal analysis, E. Moro et all
has found out a linear growth in number of beta cell nuclei, with an average of 15%
per day in larval stages of zebrafish. (2009)
![Page 26: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/26.jpg)
Collectrin/ TMEM27
• In the pancreas, TMEM27 is produced in beta cells specifically.
• Studies has shown a potential positive role of TMEM27 in glucose-stimulated
insulin exocytosis, another study linked TMEM27 production to beta cell
proliferation.
• The latter study also hypothesised that TMEM27, which is cleaved and shed into
the extracellular space, might be used as a beta cell mass biomarker.
• It plays the role of controlling insulin exocytosis by regulating formation
of the SNARE (soluble N-ethylmaleimide-sensitive-factor attachment protein
receptor) complex in pancreatic beta cells.
• Streptozotocin (STZ), a nitrosourea causes DNA damage after entering β-cells
through the Glut2 receptor. This is used to induce diabetes and can be used as a
control.
![Page 27: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/27.jpg)
Developmental Stages
![Page 28: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/28.jpg)
Ensembl data of Pdx1
![Page 29: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/29.jpg)
Genome sequence of Pdx1
•ACGCTCAGACTGCAGGTAGAGCAGAGGTCCTGATCAGGGGCAGGG
CGCTGGCTCATGTGCTCGTGTACGGCACGGTTTCCCCGGTCTATGG
CAATCATGAATCGGGAAGAGCATTACTATCCGCCTAACCACCTGTAC
AAGGACTCTTGTGCCTTCCAGAGACACCCCAACGAAGACTACAGCC
AAAACCCTCCACCGTGTCTTTATATGAGACAGGCACATTCAGTATAC
GCCTCACCATTGGGCGCACAGGACCAGCCAAATCTTACCGACATTAC
TTCTTATAACATGTCGAGCCGGTATGATCTGGCAGGGCCTCATCTTC
ACCTTCCCCAAACTTCACAGACATCTCTACAGTCGCTCGGGGGTTAC
GGAGACTCTCTGGACCTCTGCGGGGATCGGAACAGATACCATCTCC
CATTTCCGTGGATGAAGTCAACCAAATCTCACACGCACGCATGGAAA
GGACAGTGGACAG
•These are the exon sequences of pdx1 gene obtained from ensembl.
![Page 30: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/30.jpg)
Imaging β cells
![Page 31: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/31.jpg)
![Page 32: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/32.jpg)
![Page 33: Diff. beta cells](https://reader034.vdocuments.net/reader034/viewer/2022051414/55a5b2961a28ab937b8b469f/html5/thumbnails/33.jpg)