Download - Dna Genes Chromosomes 2011[1]
-
7/31/2019 Dna Genes Chromosomes 2011[1]
1/65
INTRODUCTION
Genetic diseases occur because of mutations in DNA. Many of
these mutations affect the repair of other mutations that occur
during DNA replication or at other times, which in turn affect
the flow of genetic information from DNA to RNA(transcription and processing) and from RNA to protein
synthesis (translation). Many of these mutations also affect the
structures of the resulting proteins, affecting their functions.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
2/65
THE FLOW OF GENETIC INFORMATION
DNA RNA PROTEIN
DNA
1
2 3
1. REPLICATION (DNA SYNTHESIS)2. TRANSCRIPTION (RNA SYNTHESIS)3. TRANSLATION (PROTEIN SYNTHESIS)
-
7/31/2019 Dna Genes Chromosomes 2011[1]
3/65
DNA Structure and Chemistry
a). Evidence that DNA is the genetic informationi). DNA transformation know this termii). Transgenic experiments know this processiii). Mutation alters phenotype be able to define
genotype and phenotype
b). Structure of DNAi). Structure of the bases, nucleosides, and nucleotidesii). Structure of the DNA double helixiii). Complementarity of the DNA strands
c). Chemistry of DNAi). Forces contributing to the stability of the double helixii). Denaturation of DNA
-
7/31/2019 Dna Genes Chromosomes 2011[1]
4/65
DNA transformation experiments show that DNA is the carrier of the genetic
information. These experiments have been carried out both in vivo (in animals) and
in vitro (in cell culture). The in vivo experiments were carried out by injecting mice
with both a heat-killed virulent strain of Streptococcus and a non-heated, non-
virulent strain of Streptococcus. The experiments showed that something (DNA)from the heat-killed virulent strain of Streptococcus was able to alter the (still
viable) non-virulent strain, converting some of the cells to virulent bacteria and
killing the host. We now know that purified DNA confers this virulence. In vitro
experiments have shown that purified DNA from Type S (smooth colony) Strep
cells is able to be taken up by Type R (rough colonies) Strep cells. The process of
getting functionally active DNA into cells is called DNA transformation.Transformation by Type S DNA alters the "genotype" of host cells, since new
genes are introduced into these cells thus altering their genetic constitution. The
expression of this Type S DNA changes the "phenotype of the transformed cells,
making their colonies look "smooth" instead of "rough. Genotype is an organisms
genetic constitution. Phenotype is the observed characteristics of an organism as
determined by the genetic makeup and the environment.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
5/65
Transgenic experiments, which are usually
carried out in mice, involve the transfer of a
specific gene into the nucleus of a fertilized
egg. The gene integrates randomly into
chromosomal DNA and can be engineered to
be expressed in every cell, or only in certain
cells at certain times. For example,
introduction of the growth hormone gene into
transgenic mice alters their genotype and
confers a phenotype characterized by increase
growth and therefore size. Transgenic
experiments show that specific phenotypic
traits can be conferred by specific genes, and
thus that DNA is the carrier of genetic
information. Other types of transgenic
experiments involve mutation of specific
genes in the mouse to determine the functionsof those genes and to create mouse models of
human genetic disease. The mutation of a gene
in a transgenic mouse that eliminates the
gene's function, is called a knockout mutation
and the mouse carrying that mutation is called
a knockout mouse.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
6/65
Phenotypic differences between individuals are due in large
measure to differences between genes. Evidence suggests that at
least one-third of our genes are polymorphic, in other words that
there are differences in the nucleotide sequences in one-third of
our genes when these genes are compared from one individual to
another individual. It is most likely that these differences
occurred by mutation of DNA over many hundreds of thousands
of years of human evolution. It is also clear that new DNA
mutations give rise to phenotypic differences between individuals,the most dramatic being those that give rise to genetic diseases.
All of this evidence indicates that DNA is the carrier of the
genetic information. Genetic differences between individuals can
have a myriad of clinical implications. Some inherited differences,
which may be less severe, can confer a predisposition to certain
medical problems. Other examples are individual rates of aging orindividual rates of drug metabolism, both of which probably have
an underlying genetic basis. More severe genetic differences can
be the causes of debilitating inherited diseases.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
7/65
Thymine (T)
Guanine (G) Cytosine (C)
Adenine (A)
Structures of the bases
Purines Pyrimidines
5-Methylcytosine (5mC)
-
7/31/2019 Dna Genes Chromosomes 2011[1]
8/65
Be familiar with the structures of the purine bases, adenine (A)
and guanine (G); and the pyrimidine bases, thymine (T) and
cytosine (C). A common base modification in DNA results from
the methylation of cytosine, giving rise to 5-methylcytosine
(5mC). As we shall see subsequently, 5mC is highly mutagenic.
It is believed that this methylation functions to regulate geneexpression because 5-methylcytosine (5mC) residues are often
clustered near the promoters of genes in so-called "CpG islands.
(Along one strand of DNA the nucleotides are sometimes
indicated by the base followed by a phosphate or p such as
ApTpCpCpGpApCpTpGpGp - this sequence contains one CpG
site.) The problem that arises from these methylations is that
subsequent deamination of a 5mC results in the production of
thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites
(or mCpG sites) are "hot-spots" for mutation, and when mutated
are a common cause of cancer.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
9/65
[structure of deoxyadenosine]
Nucleoside
Nucleotide
-
7/31/2019 Dna Genes Chromosomes 2011[1]
10/65
This table lists the common bases and theircorresponding names when in the nucleoside or
nucleotide form. Hypoxanthine (inosine) is seen in
DNA following deamination of adenine
(adenosine). It is also seen in transfer RNA as a
common, functionally important posttranscriptionalmodification. Uracil (uridine) is found in RNA,
instead of thymine (thymidine), which is specific
for DNA.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
11/65
Nomenclature
Purines
adenine adenosineguanine guanosine
hypoxanthine inosine
Pyrimidinesthymine thymidinecytosine cytidine
+ribose
uracil uridine
Nucleoside NucleotideBase +deoxyribose +phosphate
-
7/31/2019 Dna Genes Chromosomes 2011[1]
12/65
When a base, such as adenine, is linked to a deoxyribose sugar
through a glycosidic bond, the structure is a nucleoside, in this
case deoxyadenosine. The deoxyribose sugar lacks a hydroxyl
group on the 2' carbon, hence deoxy. This is in contrast to the
presence of a hydroxyl at that position in the ribose sugar found
in RNA. When the deoxyribose sugar is phosphorylated, on
either the 3' or the 5' position (or both), the structure is a
nucleotide, in this case deoxyadenosine-5'-phosphate. The
precursors of DNA synthesis are deoxynucleoside-5'-
triphosphates or dNTPs.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
13/65
polynucleotide chain
3,5-phosphodiester bond
ii). Structure of the
DNA double helixStructure of the DNApolynucleotide chain
5
3
-
7/31/2019 Dna Genes Chromosomes 2011[1]
14/65
A-T base pair
G-C base pair
Chargaffs rule: The content of A equals the content of T,and the content of G equals the content of Cin double-stranded DNA from any species
Hydrogen bonding of the bases
-
7/31/2019 Dna Genes Chromosomes 2011[1]
15/65
The DNA double helix requires that the two
polynucleotide chains be base-paired to each other. This
slide shows an adenine-thymine (A-T) base pair (which
is the A and which is the T?); and a guanine-cytosine(G-C) base pair (which is the G and which is the C?).
Because of base pairing, the polynucleotide chains in
double-stranded DNA are complementary to each other.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
16/65
Double-stranded DNA
Major groove
Minor groove
5 3
5 33 5B DNA
-
7/31/2019 Dna Genes Chromosomes 2011[1]
17/65
This slide shows double-stranded DNA,
which is composed of two base-paired,
complementary polynucleotide chains. Base-
pairing between the complementary strands
is required for two important functions of
DNA: 1) DNA replication involves an
unwinding of the double helix (right)
followed by synthesis of a complementary
strand from each of the unpaired template
strands, and 2) DNA serves as a template for
RNA synthesis by utilizing the information inone strand to code for a complementary RNA
strand.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
18/65
DNA in the "B" form has a major groove and a minor groove, and has 10 basepairs per one turn of the double helix. DNA that is overwound or underwound,
with fewer than or more than 10 base pairs per turn, is said to be "supercoiled".
It should also be noted that the complementary strands in double helical DNA
are antiparallel with respect to each other. Each polynucleotide chain has a 5' end
and a 3' end. Deoxyribonucleases (or DNases) are enzymes that cleave
phosphodiester bonds. Some are used for constructive purposes, such asproofreading during DNA replication, whereas others are used to degrade DNA.
There are two basic classes of DNases: exonucleases and endonucleases.
Exonucleases remove only the terminal nucleotide, whereas endonucleases
cleave anywhere within the DNA double helix.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
19/65
Chemistry of DNA
Forces affecting the stability of the DNA double helix
hydrophobic interactions - stabilize- hydrophobic inside and hydrophilic outside
stacking interactions - stabilize- relatively weak but additive van der Waals forces
hydrogen bonding - stabilize- relatively weak but additive and facilitates stacking
electrostatic interactions - destabilize- contributed primarily by the (negative) phosphates
- affect intrastrand and interstrand interactions- repulsion can be neutralized with positive charges
(e.g., positively charged Na+ ions or proteins)
-
7/31/2019 Dna Genes Chromosomes 2011[1]
20/65
Three types of forces contribute to maintaining the
stability of the DNA double helix: 1) hydrophobic
interactions, 2) stacking interactions, and 3)
hydrogen bonding. The base pairs in the interior
of the DNA molecule create a hydrophobic
environment, with the negatively charged
phosphates along the backbone being exposed to
the solvent. Thus, in an aqueous environment, the
double-stranded structure is stabilized by the
hydrophobic interior. Reagents that solubilize the
DNA bases (e.g., methanol) destabilize the double
helix. Stacking interactions and hydrogen
bonding interactions are relatively weak butadditive. Reagents that disrupt hydrogen bonding
[e.g., formamide, urea, and solutions with very
low pH (pH 10)]
destabilize the double helix.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
21/65
Electrostatic replusion by negatively charged
phosphates along the DNA backbone destabilize
the double helix. For example, if the phosphates
are left unshielded, as when DNA is dissolved in
distilled water, the DNA strands will separate at
room temperature. Neutralizing these negativecharges by the addition of NaCl (which
contributes positively charged sodium ions) to the
DNA solution will prevent strand separation. In
the cell, the phosphates also interact with
positively charged (magnesium, potassium, or
sodium) ions and with positively charged (basic)
proteins.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
22/65
Stacking interactions
Charge repulsion
Charger
epulsion
-
7/31/2019 Dna Genes Chromosomes 2011[1]
23/65
Model of double-stranded DNA showing three base pairs
-
7/31/2019 Dna Genes Chromosomes 2011[1]
24/65
This slide shows a side view of three
base pairs in the DNA double helix.
Note the base-pair stacking
interactions, the hydrophobic interior,
and the phosphates on the exterior
-
7/31/2019 Dna Genes Chromosomes 2011[1]
25/65
Denaturation of DNA
Double-stranded DNA
A-T rich regions
denature first
Cooperative unwindingof the DNA strands
Extremes in pH or
high temperature
Strand separationand formation of
single-strandedrandom coils
-
7/31/2019 Dna Genes Chromosomes 2011[1]
26/65
The forces stabilizing the DNA double helix can be overcome by heating the DNA in solution
or by treating it with very high or very low pH (low pH will also damage the DNA, whereas
high pH will simply separate the polynucleotide chains). When the strands of DNA separate,
the DNA is said to be denatured (when high temperature is used to denature DNA, the DNA issaid to be melted). Because some of the forces stabilizing the DNA double helix are
contributed by base pairing interactions, and because A-T base pairs have only two hydrogen
bonds in contrast to G-C base pairs which have three hydrogen bonds, regions of the DNA
duplex that are A-T rich will denature first. Once denaturation has begun, there is a
cooperative unwinding of the double helix that ultimately results in complete strand
separation.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
27/65
Electron micrograph of partially melted DNA
A-T rich regions melt first, followed by G-C rich regions
Double-stranded, G-C richDNA has not yet melted
A-T rich region of DNAhas melted into asingle-stranded bubble
-
7/31/2019 Dna Genes Chromosomes 2011[1]
28/65
This slide shows an electron micrographtracing of a DNA molecule that is only
partially melted. The thicker regions are
double-stranded and probably more G-C rich.
The A-T rich regions are more prone to
denaturation, and as seen here, form single-
stranded "bubbles."
H h i it
-
7/31/2019 Dna Genes Chromosomes 2011[1]
29/65
Hyperchromicity
The absorbance at 260 nm of a DNA solution increaseswhen the double helix is melted into single strands.
260
Absorbance
Absorbance maximum
for single-stranded DNA
Absorbancemaximum fordouble-stranded DNA
220 300
-
7/31/2019 Dna Genes Chromosomes 2011[1]
30/65
Hyperchromicity can be used to follow the denaturation of DNA as a function of
increasing temperature. As the temperature of a DNA solution gradually rises above
50 degrees C, the A-T regions will melt first giving rise to an increase in the UVabsorbance. As the temperature increases further, more of the DNA will become
single-stranded, further increasing the UV absorbance, until the DNA is fully
denatured above 90 degrees C. The temperature at the mid-point of the melting
curve is termed "melting temperature" and is abbreviated Tm. The Tm for a DNA
depends on its average G+C content: the higher the G+C content, the higher the Tm.
Note: G+C content, G-C content, and GC content are equivalent terms.
DNA melting curve
-
7/31/2019 Dna Genes Chromosomes 2011[1]
31/65
100
50
0
7050 90
Temperature oC
Percenth
yperchromicit
y
DNA melting curve
Tm is the temperature at the midpoint of the transition
-
7/31/2019 Dna Genes Chromosomes 2011[1]
32/65
When a solution of double-stranded DNA is
placed in a spectrophotometer cuvette and theabsorbance of the DNA is determined across the
electromagnetic spectrum, it characteristically
shows an absorbance maximum at 260 nm (in the
UV region of the spectrum). If the same DNA
solution is melted, the absorbance at 260 nm
increases approximately 40%. This property is
termed "hyperchromicity." The hyperchromic
shift is due to the fact that unstacked bases absorb
more light than stacked bases.
T i d d t th G C t t f th DNA
-
7/31/2019 Dna Genes Chromosomes 2011[1]
33/65
Average base composition (G-C content) can bedetermined from the melting temperature of DNA
50
7060 80
Temperatureo
C
Tm is dependent on the G-C content of the DNA
Percenthyperchromicity
E. coli DNA is50% G-C
-
7/31/2019 Dna Genes Chromosomes 2011[1]
34/65
This slide shows the dependence of Tm on average G+C content of three
different DNAs. Under the conditions used in this experiment, E. coli DNAwhich has an average G+C content of about 50%, melted with a Tm of 69
degrees C. The curve on the left represents a DNA with a lower G+C content
and the curve on the right represents a DNA with a higher G+C content. Tm
is dependent on the ionic strength of the solution. At a fixed ionic strength
there is a linear relation between Tm and G+C content.
Genomic DNA, Genes, Chromatin
-
7/31/2019 Dna Genes Chromosomes 2011[1]
35/65
, ,
a). Complexity of chromosomal DNAi). DNA reassociationii).Repetitive DNA and Alu sequencesiii). Genome size and complexity of genomic DNA
b). Gene structure
i). Introns and exonsii). Properties of the human genomeiii). Mutations caused by Alu sequences
c). Chromosome structure - packaging of genomic DNAi). Nucleosomes
ii). Histonesiii). Nucleofilament structureiv). Telomeres, aging, and cancer
DNA reassociation (renaturation)
-
7/31/2019 Dna Genes Chromosomes 2011[1]
36/65
DNA reassociation (renaturation)
Double-stranded DNA
Denatured,single-stranded
DNA
Slower, rate-limiting,second-order process offinding complementarysequences to nucleate
base-pairing
k2
Faster,zipperingreaction toform long
moleculesof double-strandedDNA
DNA reassociation kinetics for human genomic DNA
-
7/31/2019 Dna Genes Chromosomes 2011[1]
37/65
Cot1/2
DNA reassociation kinetics for human genomic DNA
Cot1/2 = 1 /k2 k2 = second-order rate constant
Co = DNA concentration (initial)t1/2 = time for half reaction of each
component or fraction
50
100
0
%D
N
Areassociated
I I I I I I I I I
log Cot
fast (repeated)intermediate(repeated)
slow (single-copy)
Kinetic fractions:
fastintermediateslow
Cot1/2
Cot1/2
-
7/31/2019 Dna Genes Chromosomes 2011[1]
38/65
This illustrates the concept of how sequence complexity affects the rate of DNA
reassociation. Imagine two different DNA sequences in a genome, one present
one time per haploid genome (right) and the other present 1,000,000 times per
haploid genome (left). They would be present at a 1:1,000,000 ratio with respect
to each other. If these sequences were mixed together (which is what would
happen if total genomic DNA was isolated for analysis), then fragmented,
denatured and allowed to reassociate, the repeated sequences would reassociate
much more rapidly because it would be much easier for them to find
complementary strands to base pair with. The repeated sequences would
reassociate with a very low Cot1/2 and therefore with a very high k2, consistentwith a rapid rate of reassociation.
106 copies per genome of 1 copy per genome of
-
7/31/2019 Dna Genes Chromosomes 2011[1]
39/65
high k2
p p ga low complexity sequence
of e.g. 300 base pairs
py p ga high complexity sequence
of e.g. 300 x 106 base pairs
low k2
-
7/31/2019 Dna Genes Chromosomes 2011[1]
40/65
The human genome consists of three populations of DNA: the fast and intermediate fractions
make up about 10% and 15% of the genome, respectively, and the slow fraction makes up
about 75% of the genome. Most of the genes in the human genome are in the single-copy
fraction. As shown in the next slide, repeated sequences can be of two types: those that are
interspersed throughout the genome or those that are tandemly repeated satellite DNAs.
Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about300 base pairs in length and are repeated about 300,000 times in the genome. They can be
found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to
the occasional disruption of genes. The interspersed repetitive sequences also include VNTRs
(variable numbers of tandem repeats), which are comprised of short repeated sequences of
only a few base-pairs, but of variable lengths. They, too, are interspersed throughout the
genome, and are quite useful as landmarks for mapping genes because they are highlypolymorphic (they differ in length or number of repeats from individual to individual).
Type of DNA % of Genome Features
-
7/31/2019 Dna Genes Chromosomes 2011[1]
41/65
Single-copy (unique) ~75% Includes most genes 1
Repetitive
Interspersed ~15% Interspersed throughout genome between
and within genes; includes Alu sequences 2and VNTRs or mini (micro) satellites
Satellite (tandem) ~10% Highly repeated, low complexity sequences
usually located in centromeres
and telomeres
2Alu sequences areabout 300 bp in lengthand are repeated about300,000 times in thegenome. They can be
found adjacent to orwithin genes in intronsor nontranslated regions.
1 Some genes are repeated a few times to thousands-fold and thus would be in
the repetitive DNA fraction
50
100
0
I I I I I I I I I
fast ~10%intermediate
~15%
slow (single-copy)~75%
Classes of repetitive DNA
-
7/31/2019 Dna Genes Chromosomes 2011[1]
42/65
Interspersed (dispersed) repeats (e.g., Alu sequences)
TTAGGGTTAGGGTTAGGGTTAGGG
Tandem repeats (e.g., microsatellites)
GCTGAGG GCTGAGGGCTGAGG
-
7/31/2019 Dna Genes Chromosomes 2011[1]
43/65
. Knowing the complete sequence of the human genome will allow medical researchers to more easily
find disease-causing genes. In addition, it should become possible to understand how differences in
our DNA sequences from individual to individual may affect our predisposition to diseases and our
ability to metabolize drugs. Because the human genome has ~3 billion bp of DNA and there are 23
pairs of chromosomes in diploid human cells, the average metaphase chromosome has ~130 million bp
DNA.
Genome sizes in nucleotide pairs (base-pairs)
-
7/31/2019 Dna Genes Chromosomes 2011[1]
44/65
viruses
plasmids
bacteriafungi
plants
algae
insects
mollusks
reptilesbirds
mammals
104 108105 106 107 10111010109
The size of the humangenome is ~ 3 X 109 bp;almost all of its complexity
is in single-copy DNA.
The human genome is thoughtto contain ~30,000 to 40,000 genes.
bony fish
amphibians
Gene structure
-
7/31/2019 Dna Genes Chromosomes 2011[1]
45/65
5 3
promoterregion
exons (filled and unfilled boxed regions)
introns (between exons)
transcribed region
translated region
mRNA structure
+1
-
7/31/2019 Dna Genes Chromosomes 2011[1]
46/65
This slide shows the structure of a typical human gene and its corresponding messenger
RNA (mRNA). Most genes in the human genome are called "split genes" because they are
composed of "exons" separated by "introns." The exons are the regions of genes that
encode information that ends up in mRNA. The transcribed region of a gene (double-
ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all ofthe exons and introns (initiation of transcription is regulated by the promoter region of a
gene, which is upstream of the +1 site). RNA processing (the subject of a another lecture)
then removes the intron sequences, "splicing" together the exon sequences to produce the
mature mRNA. The translated region of the mRNA (the region that encodes the protein) is
indicated in blue. Note that there are untranslated regions at the 5' and 3 ends of mRNAs
that are encoded by exon sequence but are not directly translated.
The (exon-intron-exon)n structure of various genes
-
7/31/2019 Dna Genes Chromosomes 2011[1]
47/65
-globin
HGPRT(HPRT)
total = 1,660 bp; exons = 990 bp
histone
factor VIII
total = 400 bp; exon = 400 bp
total = 42,830 bp; exons = 1263 bp
total = ~186,000 bp; exons = ~9,000 bp
-
7/31/2019 Dna Genes Chromosomes 2011[1]
48/65
This figure shows examples of the wide variety of gene structures seen in the human genome.
Some (very few) genes do not have introns. One example is the histone genes, which encode the
small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. Shown here is a histone
gene that is only 400 base pairs (bp) in length and is composed of only one exon. The beta-
globin gene has three exons and two introns. The hypoxanthine-guanine phosphoribosyl
transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone
gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon
length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually
relatively short. An extreme example of this is the factor VIII gene which has numerous exons
(the blue boxes and blue vertical lines).
Properties of the human genome
-
7/31/2019 Dna Genes Chromosomes 2011[1]
49/65
Properties of the human genome
Nuclear genome
the haploid human genome has ~3 X 109 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes
most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from 2,300,000 bp Alu sequences are present throughout the genome
Mitochondrial genome
circular genome of ~17,000 bp contains
-
7/31/2019 Dna Genes Chromosomes 2011[1]
50/65
Familial hypercholesterolemia autosomal dominant
LDL receptor deficiency
From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.
-
7/31/2019 Dna Genes Chromosomes 2011[1]
51/65
The rather common (~1 in 500) autosomal dominant disease, familial hypercholesterolemia
(FH), is caused by mutations in the LDL (low density lipoprotein) receptor gene (for more
information about FH, look at pages 218-222 of Thompson & Thompson and at Case 9).
Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the
LDL receptor on liver cells and is internalized. Normal plasma cholesterol levels average
below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have
approximately double this amount, and those with two defective genes (homozygous) have
approximately four times this amount. Heterozygous individuals are predisposed to
cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50. There
are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal.
As shown in the next figure, one mechanism has involved Alu sequences.
LDL receptor gene
Al t t ithi i t
-
7/31/2019 Dna Genes Chromosomes 2011[1]
52/65
Alu repeats present within introns
Alu repeats in exons
4
4
4
5
5
5 6
6
6
Alu Alu
AluAlu
X
46
Alu
unequalcrossing over
one product has adeleted exon 5
(the other product is not shown)
-
7/31/2019 Dna Genes Chromosomes 2011[1]
53/65
Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu
sequences are present within three of the introns and two of the exons. Because of the
close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing
over can occur during meiosis. Crossing over (the topic of a future lecture) requires
homologous sequences, which base pair with each other during the process of meiosis.The homologous sequences can be provided by the Alu repeats, which can cause an out-
of-register misalignment and subsequent crossing over deleting exon 5 from one of the
two products of crossing over. This exon 5 in-frame deletion can be inherited and is
currently a cause of FH. This deletion affects the LDL binding region of the receptor.
Thus, while Alu sequences have no known function in our genomes, there are a lot of
them scattered throughout our genomes, within and around genes, and they can be quitedisruptive.
Chromatin structure
-
7/31/2019 Dna Genes Chromosomes 2011[1]
54/65
Chromatin structure
EM of chromatin shows presence of
nucleosomes as beads on a string
-
7/31/2019 Dna Genes Chromosomes 2011[1]
55/65
Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A,
H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative
supercoiling as a consequence of being wound around the core histones. Histones are
positively charged proteins and thus interact with the negatively charged phosphates along the
backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome
proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer
lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic
chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.
Nucleosome structure
-
7/31/2019 Dna Genes Chromosomes 2011[1]
56/65
Nucleosome structure
Nucleosome core (left)
146 bp DNA; 1 3/4 turns of DNA
DNA is negatively supercoiled
two each: H2A, H2B, H3, H4 (histone octomer)Nucleosome (right)
~200 bp DNA; 2 turns of DNA plus spacer
also includes H1 histone
-
7/31/2019 Dna Genes Chromosomes 2011[1]
57/65
Histones are small, positively charged proteins that can be extensively modified
posttranslationally, in general to make them less positively charged. Histone
deacetylases (HDACs) are associated with transcriptional repression because they
make histones better able to bind DNA, thus making DNA less accessible to the
transcription machinery. Histone deacetylases are recruited to the chromosome by
transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of
another lecture). Histone acetylases are recruited to chromosomes by transcription
factors (TFs). Histone acetylases reduce the positive charges on histones, causing
them to loosen their grip on the DNA to allow transcription factors to bind.
Histones (H1, H2A, H2B, H3, H4)small proteins
-
7/31/2019 Dna Genes Chromosomes 2011[1]
58/65
small proteins arginine or lysine rich: positively charged
interact with negatively charged DNA can be extensively modified - modifications in
general make them less positively chargedPhosphorylationPoly(ADP) ribosylation
MethylationAcetylation
Hypoacetylation
by histone deacetylase (facilitated by Rb)tight nucleosomesassoc with transcriptional repression
Hyperacetylationby histone acetylase (facilitated by TFs)loose nucleosomesassoc with transcriptional activation
-
7/31/2019 Dna Genes Chromosomes 2011[1]
59/65
The orderly packaging of DNA in the cell is essential for the process of DNA
replication, as well as for the process of transcription. Packaging of DNA into
nucleosomes is only the first step, foreshortening chromosomal DNA somewhat
by virtue of its being wrapped around the core histones 1 3/4 times. However, if
the average human genomic DNA molecule is ~130 million bp in length, its
length would be an astounding 44 mm. All this DNA X 23 chromosomes has to
packaged in the nucleus of a cell that is too small to be seen with the unaided eye.
Thus, the DNA needs to be packaged in higher-order structures such as shown
above, first into closely packed arrays of nucleosomes called nucleofilaments,which are then coiled into thicker and thicker filaments.
Nucleofilament structure
-
7/31/2019 Dna Genes Chromosomes 2011[1]
60/65
-
7/31/2019 Dna Genes Chromosomes 2011[1]
61/65
The interphase nucleus contains loosely
packed, filamentous chromosomes, whoseDNA is available for gene transcription.
During each round of cell division, the
chromosomal DNA is replicated and then
condensed into metaphase chromosomes for
segregation into the daughter cells, followed
by decondensation as the interphase nucleus
is formed.
Condensation and decondensationof a chromosome in the cell cycle
-
7/31/2019 Dna Genes Chromosomes 2011[1]
62/65
-
7/31/2019 Dna Genes Chromosomes 2011[1]
63/65
The chromosome contains a single, long molecule of double stranded DNA, and thus has two
ends. These ends create two problems: they are difficult to replicate and they have a tendency
to fuse with other chromosome ends causing karyotypic rearrangements. To prevent these
problems, chromosomes have protective ends called "telomeres" that are composed of tandemly
repeated, 5-8 bp sequences up to 12 kb in length. In germline cells and in the cells of youngindividuals, telomeres are of maximal length, but with every round of somatic cell division
telomeres get a little shorter. After many rounds of replication and cell division, telomeres
become too short to protect the chromosome ends from fusing with other chromosomes. At this
stage, cells are said to be "senescent." Telomere length is maintained in germline cells by an
enzyme called "telomerase," which can restore any shortening that has occurred. Tumor cells
also have telomerase and thus are immortal and can grow indefinitely.
Telomeres and agingTelomeres are protectivecaps on chromosomeends consisting of short5-8 bp tandemly repeated
-
7/31/2019 Dna Genes Chromosomes 2011[1]
64/65
Metaphase chromosome
centromere telomeretelomere
telomere structure
young
senescent
5 8 bp tandemly repeatedGC-rich DNA sequences,that prevent chromosomes
from fusing and causingkaryotypic rearrangements.
(TTAGGG)many
(TTAGGG)few
telomerase (an enzyme) is required to maintain telomere length ingermline cells
most differentiated somatic cells have decreased levels of telomeraseand therefore their chromosomes shorten with each cell division
12 kb
-
7/31/2019 Dna Genes Chromosomes 2011[1]
65/65
Class Assignment (for discussion on Sept 9th)
Botchkina GI, et al.
Noninvasive detection of prostate cancer byquantitative analysis of telomerase activity.Clin Cancer Res. May 1;11(9):3243-3249, 2005
PDF of article is accessible on the website