Epigenetic mechanisms silence a disintegrin andmetalloprotease 33 expression in bronchial epithelial cells
Youwen Yang, PhD, Hans Michael Haitchi, MD, Julie Cakebread, PhD, David Sammut, MD, Anna Harvey, BSc,
Robert M. Powell, PhD, John W. Holloway, PhD, Peter Howarth, MD, PhD, Stephen T. Holgate, MD, DSc,
and Donna E. Davies, PhD Southampton, United Kingdom
Background: A disintegrin and metalloprotease 33 (ADAM33)polymorphism is strongly associated with asthma and bronchialhyperresponsiveness. Although considered to be a mesenchymalcell–specific gene, recent reports have suggested epithelialexpression of ADAM33 in patients with severe asthma.Objectives: Because dysregulated expression of ADAM33 cancontribute to disease pathogenesis, we characterized themechanism or mechanisms that control its transcription andinvestigated ADAM33 expression in bronchial biopsy specimensand brushings from healthy and asthmatic subjects.Methods: The ADAM33 promoter and CpG island methylationwere analyzed by using bioinformatics, luciferase reporters, andbisulfite sequencing of genomic DNA. Epithelial-mesenchymaltransition was induced by using TGF-b1. ADAM33 mRNA wasscrutinized in bronchial biopsy specimens and brushings byusing reverse transcriptase–quantitative polymerase chainreaction, melt-curve analysis, and direct sequencing.Results: The predicted ADAM33 promoter (2550 to 187) hadpromoter transcriptional activity. Bisulfite sequencing showedthat the predicted promoter CpG island (2362 to 180) washypermethylated in epithelial cells but hypomethylated inADAM33-expressing fibroblasts. Treatment of epithelial cellswith 5-aza-deoxycytidine caused demethylation of the CpGisland and induced ADAM33 expression. In contrast,phenotypic transformation of epithelial cells through a TGF-b–induced epithelial-mesenchymal transition was insufficient toinduce ADAM33 expression. ADAM33 mRNA was confirmed inbronchial biopsy specimens, but no validated signal wasdetected in bronchial brushings from healthy or asthmaticsubjects.Conclusion: The ADAM33 gene contains a regulatory CpG islandwithin its promoter, the methylation status of which tightlycontrols its expression in a cell type–specific manner. ADAM33repression is a stable feature of airway epithelial cells, irrespectiveof disease. (J Allergy Clin Immunol 2008;121:1393-9.)
Key words: Promoter, CpG island, methylation, expression,ADAM33, epithelial-mesenchymal transition
A disintegrin and metalloprotease 33 (ADAM33) was origi-nally identified as an asthma-susceptibility gene by means of po-sitional cloning.1 It is found on chromosome 20p13, and severalsingle nucleotide polymorphisms (SNPs) in ADAM33 have beenlinked with the asthma subphenotype of bronchial hyperrespon-siveness (BHR) and not atopy.1 A syntenic region on mouse chro-mosome 2 overlying an ortholog of ADAM33 that exhibitsapproximately 70% homology with its human counterpart isalso linked to BHR.2 Recent studies have shown that SNPs inADAM33 predict poor lung function in early childhood3 and amore rapid decrease in lung function in patients with chronic ob-structive pulmonary disease and in a healthy population.4 SeveralADAM33 protein isoforms occur in adult bronchial smooth mus-cle and in human embryonic lungs, where it is expressed in undif-ferentiated mesenchymal cells, strongly suggesting a role insmooth muscle development, function, or both.5 This mightexplain its genetic association with BHR and asthma.1
The ADAM family is defined by the presence of 7 functionaldomains: pro-domain, metalloprotease (MP) domain, disintegrindomain, cysteine-rich domain, epidermal growth factor (EGF)domain, transmembrane domain, and cytoplasmic tail domain.6
However, alternatively spliced variants lacking some of the do-mains have been identified.7 Initial reports demonstrated thatADAM33 is expressed in airway fibroblasts, myofibroblasts,and smooth muscle but not epithelial cells, T lymphocytes, or in-flammatory cells that infiltrate the airway wall in asthma.1 How-ever, 2 recent articles report expression of ADAM33 in theepithelium of subjects with severe asthma.8,9 Although the bio-chemical and molecular mechanisms underlying the contributionof ADAM33 to asthma pathogenesis are currently uncertain, itsaberrant expression in epithelial cells might contribute to diseasepathogenesis.
Multiple mechanisms are responsible for regulation of geneexpression. Among these, promoter DNA methylation is anepigenetic modification that can play an important role in genesilencing.10 Although not extensively studied as a regulatorymechanism for ADAM genes, hypermethylation of the promoterof a disintegrin and metalloprotease with thrombospondin type1 motif (ADAMTS8), a protease with antiangiogenic properties,results in a reduction in the gene expression in neoplastic tis-sues,11 whereas hypomethylation of the ADAMTS4 promoterand induction of gene expression has been observed in late-stageosteoarthritis chondrocytes.12 Therefore we postulated thatADAM33 promoter methylation regulates the gene expressionin bronchial fibroblasts and epithelial cells. Because aberrantexpression of ADAM33 might help explain its contribution toasthma pathogenesis, we examined ADAM33 expression in
From the Brooke Laboratories, Division of Infection, Inflammation and Repair, School of
Medicine, University of Southampton.
Supported by the Rayne Foundation, United Kingdom; the Asthma, Allergy and
Inflammation Research Charity; the Medical Research Council (United Kingdom);
and the Wellcome Trust (United Kingdom).
Disclosure of potential conflict of interest: The authors have declared that they have no
conflict of interest.
Received for publication July 19, 2007; revised February 25, 2008; accepted for publica-
tion February 26, 2008.
Available online April 23, 2008.
Reprint requests: Donna E. Davies, PhD, Allergy and Inflammation Research, Level F
South Block (810), Southampton General Hospital, Southampton SO16 6YD, United
Kingdom. E-mail: [email protected].
0091-6749/$34.00
� 2008 American Academy of Allergy, Asthma & Immunology
doi:10.1016/j.jaci.2008.02.031
1393
J ALLERGY CLIN IMMUNOL
JUNE 2008
1394 YANG ET AL
Abbreviations used
ADAM33: A disintegrin and metalloprotease 33
ADAMTS8: A disintegrin and metalloprotease with
thrombospondin type 1 motif
aSMA: a-Smooth muscle actin
5-Aza-dC: 5-Aza-29-deoxycytidine
BHR: Bronchial hyperresponsiveness
Ct: Cycle threshold
DMEM: Dulbecco’s modified Eagle’s medium
DNMT: DNA methyltransferase
EGF: Epidermal growth factor
EMT: Epithelial-mesenchymal transition
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
MMP: Matrix metalloprotease
MP: Metalloprotease
PBEC: Primary bronchial epithelial cell
PBF: Primary bronchial fibroblast
RT-qPCR: Reverse transcriptase quantitative polymerase
chain reaction
SNP: Single nucleotide polymorphism
UBC: Ubiquitin C
bronchial brushings from asthmatic subjects and exploredwhether the process of epithelial-mesenchymal transition(EMT)13 can result in induction of ADAM33 in epithelial cells.
METHODS
Bronchoscopy, human primary bronchial cell
culture, and cell linesBronchial biopsy specimens and bronchial epithelial brushings were
obtained by means of fiberoptic bronchoscopy in accordance with standard
guidelines.14 The clinical characteristics of the volunteers are provided in
Tables E1 through E3 (available in the Online Repository at www.jacionli
ne.org). All procedures were performed after informed consent and approval
by the Southampton and South West Hampshire Ethics Committee were ob-
tained. The detailed methods for clinical characterization, growth of primary
bronchial epithelial cell (PBEC) and fibroblast (PBF) cultures, and treatments
of cell lines are described in the Methods section of the Online Repository at
www.jacionline.org.
Extraction and purification of total RNA
and RT–qPCR assaysTotal RNA was extracted from bronchial biopsy specimens, brushings,
PBECs, PBFs, and H292, A549, and MRC5 cell lines by using the Trizol
reagent kit (Invitrogen, Paisley, United Kingdom). RT–qPCR assays and
sequence verification were undertaken as described in the Methods section of
the Online Repository.
Assessment of promoter activity with a luciferase
reporter assayA luciferase reporter plasmid was constructed by using the pGL3 basic
vector (Promega, Southampton, United Kingdom). The 59 flanking region of
human ADAM33, spanning 2550 to 187 and containing a putative promoter
sequence, was obtained by means of PCR amplification.
Bioinformatic analysesThe location of CpG islands in the ADAM33 promoter was determined
by using the CpGPlot software (http://www.ebi.ac.uk/emboss/cpgplot), and
putative transcription factor–binding sites were predicted by using the
Matlnspector software (http://www.genomatix.de/products/MatInspector/
index.html).
Analysis of DNA methylationGenomic DNA from PBFs, PBECs, and H292 and A549 cells was extracted
by using the Wizard Genomic DNA purification kit (Promega, Southampton,
United Kingdom). The DNA was digested with either BamHI (NEB, Herts,
United Kingdom), which flanked the region to be analyzed by bisulfite
sequencing,15 or with HpaII, which located the amplicon to be analyzed by
means of methylation-sensitive PCR.15
StatisticsNormally distributed data were analyzed by using the Student t test,
whereas those that were not normally distributed were analyzed by using
the Mann-Whitney U test.
Details of all methods used can be found in the Methods section of the
Online Repository.
RESULTSBecause aberrant cellular localization can contribute to disease
pathogenesis, we investigated the mechanism underlying thesuppression of ADAM33 in epithelial cells. We first validatedprevious studies of ADAM33 expression by using RT-PCRprimers (Fig 1, A) applied to a panel of human PBECs andPBFs, the H292 bronchial epithelial cell line, and MRC5 fibro-blasts. No expression of ADAM33 was detected in PBECs fromhealthy or asthmatic subjects or the epithelial cell line H292,but expression was observed in PBFs from healthy or asthmaticsubjects (Fig 1, B and C) and the embryonic fibroblast cell lineMRC5 (Fig 1, B), which is consistent with previous publishedresults.1,16
To confirm the transcriptional activity of the putative ADAM33promoter, a 637-bp genomic sequence located 2550 to 187relative to the transcriptional start site of the ADAM33 gene(GenBank accession no. NT_086908.1) was selected (Fig 1, A).This fragment contained 88 transcription factor–binding sitespredicted with Matlnspector software (data not shown). Thissequence was expected to include the basal promoter and wastested for its ability to drive transcription of plasmid-based lucif-erase reporter gene assays. The promoter region was PCR ampli-fied and directionally cloned into a plasmid vector upstream of aluciferase reporter gene. The construct was cotransfected intoMRC5 fibroblasts with a plasmid expressing Renilla luciferaseto control for transfection efficiency. The results indicated thatthe selected DNA sequence at the 59 end of the ADAM33 genedid possess promoter activity (Fig 2, A), as evidenced by theincrease in luciferase activity compared with that of an emptyvector control.
In mammals DNA methylation at CpG dinucleotides in the 59
region of genes is frequently associated with mechanisms thatrepress gene expression.17 Therefore we investigated whetherany CpG islands lay within the ADAM33 promoter region andwhether CpG island methylation might explain the silencingof ADAM33 expression in epithelial cells. Bioinformatic anal-ysis of the ADAM33 promoter sequence showed that the region2362 to 180 was a CpG island that contained 47 CpGs,74% G1C content, and an observed/expected ratio of 0.79(Fig 2, B). Thus we focused on methylation of this CpG islandas a potential regulatory mechanism controlling ADAM33expression.
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1395
Sodium bisulfite–treated genomic DNA from epithelial cellsand fibroblasts was sequenced to assess ADAM33 promotermethylation. Treatment of DNA with the bisulfite reagentconverts unmethylated cytosine residues to uracils that areamplified as thymine during subsequent PCR, whereas themethylated cytosine residues remain unconverted during bisul-fite treatment and amplify as cytosines during subsequentPCR.18 The ADAM33 promoter region from bisulfite-treatedDNA was amplified, and the PCR products cloned and se-quences were analyzed. Comparison of clones from each ofthe epithelial cell and fibroblast DNA samples showed thatthe CpG dinucleotides were hypermethylated in the ADAM33promoter of PBECs and H292 cells (Fig 3, A, upper panel,and Fig 4, B, left). In contrast, CpG dinucleotides were hypome-thylated in this region of the ADAM33 promoter in PBFs (Fig 3,A, lower panel). Differential methylation of the ADAM33 pro-moter in asthma-derived PBECs and PBFs was confirmed by us-ing a methylation-sensitive PCR assay that amplified a sequenceacross the ADAM33 promoter containing an HpaII recognitionsequence. HpaII is a methylation-sensitive restriction endonu-clease that cuts only unmethylated CCGG DNA sequenceswhile leaving methylated DNA intact. Thus failure of thePCR to amplify the ADAM33 promoter sequence comparedwith the control sequence, as seen in the asthmatic fibroblastDNA compared with epithelial DNA (P < .001; Fig 3, B andC), is indicative of ADAM33 promoter hypomethylation infibroblasts.
To test whether methylation of the ADAM33 promoter inepithelial cells was responsible for silencing its expression, thedemethylating agent 5-aza-29-deoxycytidine (5-aza-dC)19,20
was applied to H292 epithelial cells. As shown by means of RT-PCR, expression of ADAM33 was not detected in H292 cells
but could be clearly induced by 5-aza-dC treatment (Fig 4, A). Bi-sulfite sequencing confirmed that the ADAM33 promoter wasdemethylated in the 5-aza-dC–treated cells (Fig 4, B, right).Treatment of PBECs with 5-aza-dC also induced ADAM33 ex-pression (Fig 4, C), and methylation-sensitive PCR showed thatthis was associated with demethylation of the ADAM33 promoter(Fig 4, D). These results strongly implicate hypermethylation ofthe promoter for the nonexpression of ADAM33 in epithelialcells.
We further investigated the regulation of ADAM33 expres-sion during the phenotypic change involved with EMT that hasbeen linked to fibrosis in chronic inflammatory conditions. Weselected the A549 cell line for study because it undergoes awell-characterized EMT in response to TGF-b.21 After 5 daysof TGF-b1 treatment, loss of cell-cell contact and cellular elon-gation was observed (Fig 5, A), and there was reduced expres-sion of the epithelial phenotypic marker E-cadherin (CDH1)and the mucin MUC2 and increased expression of mesenchy-mal markers, such as collagen I (COL1A1) and matrix metal-loprotease (MMP) 2 (Fig 5, B). Even though there was amarked phenotypic change, the EMT did not induce expressionof ADAM33 (Fig 5, B), and there was no change in the meth-ylation status of the ADAM33 promoter (Fig 5, C). Extension ofthe treatment period to 17 days also failed to induce ADAM33expression. Thus although TGF-b induced a phenotypic switchto a ‘‘fibroblastic’’ phenotype, the continued silencing of
FIG 2. A, Promoter activity of ADAM33. The luciferase reporter plasmid was
constructed by using a 637-bp 59 flanking fragment of the ADAM33 gene.
Luciferase activity using the ADAM33 promoter in MRC5 fibroblasts was
compared with that using the negative control (No insert) plasmid; activi-
ties were normalized by using Renilla luciferase activity. Data are from 3 in-
dependent experiments. B, Prediction of CpG islands between 21000 and
1400 of the ADAM33 gene by using CpGPlot software (http://www.ebi.
ac.uk/emboss/cpgplot).
FIG 1. Organization of the 59 region of the ADAM33 gene and analysis of its
expression. A, The predicted promoter region, CpG island, Sp1-binding
sites (boxed), RT-PCR primer location, and methylation sequence. B and
C, ADAM33 expression in MRC5 and H292 cells, bronchial fibroblasts,
and epithelial cells from healthy (Fig 1, B) or asthmatic (Fig 1, C) donors
was assessed by means of RT-PCR, with GAPDH as a housekeeping gene.
J ALLERGY CLIN IMMUNOL
JUNE 2008
1396 YANG ET AL
ADAM33 expression suggests that the epithelial cells were notcompletely reprogrammed to mesenchymal cells in theseexperiments.
Having obtained evidence that ADAM33 expression is consis-tently repressed in bronchial epithelial cells because of promotermethylation, we used 3 probe-based reverse transcriptase–quan-titative polymerase chain reaction (RT-qPCR) assays forADAM33 to evaluate mRNA in 14 individual bronchial brushingsamples taken from 6 healthy subjects and 20 samples taken from9 patients with severe asthma. These assays were validated byusing recombinant HEK293 cells stably transfected with a cDNAencoding full-length ADAM33, where both the MP and EGFdomain assays provided equivalent signals (see Fig E1, A, in theOnline Repository at www.jacionline.org), but no signal was de-tectable in any of the epithelial samples (see Fig E2, A, in the On-line Repository at www.jacionline.org). To determine whether thelack of consistency between our findings and those of Foley et al,9
who detected low levels of ADAM33 mRNA in PBECs, might bedue to differences in the RT-qPCR primers used in our assays, wewent on to evaluate the exact ADAM33 and S9 rRNA housekeep-ing gene assays used in the previous study. In these assays wedetected a strong ADAM33 signal in recombinant ADAM33-ex-pressing HEK cells and fibroblasts and lower levels of signal in
the bronchial brushings (see Figs E3 and E4 in the Online Repos-itory at www.jacionline.org), which is consistent with the findingsof Foley et al.9 Because the published protocol was a SYBRGreen–based assay in which detection of the PCR product is mon-itored by measuring the increase in fluorescence caused by bind-ing of SYBR Green to double-stranded DNA, we also performedmelt-curve analysis to assess the homogeneity of the productformed. This analysis showed that the PCR products from epithe-lial cells were highly heterogeneous, suggesting misprimingrather than true amplification of ADAM33 cDNA (see Fig E5 inthe Online Repository at www.jacionline.org). This conclusionwas further supported by gel electrophoresis (see Fig E6 in theOnline Repository at www.jacionline.org), cloning, and sequenc-ing of the PCR products; no ADAM33 sequence was detectable inproducts derived from epithelial cells (see Table E4 in the OnlineRepository at www.jacionline.org).
To further investigate whether ADAM33 expression is in-creased in patients with severe asthma, we used the 3 probe-basedRT-qPCR assays for ADAM33 to evaluate mRNA in bronchialbiopsy specimens from 15 patients with severe asthma and 8healthy control subjects. Contrary to the recent report,9 we foundno significant difference between ADAM33 expression in biopsyspecimens from healthy subjects or patients with severe asthma
FIG 3. A, Cytosine methylation of the ADAM33 promoter from 3 normal PBECs and PBFs. Each row repre-
sents the methylation pattern for individual clones from bisulfite-treated DNA; unmethylated CpG sites
(open circles) and methylated CpG sites (filled circles) are shown. B, Methylation-sensitive PCR with
HpaII-digested genomic DNA from PBECs and PBFs from patients with asthma. C, Densitometric analysis
of ADAM33 promoter methylation; peak intensity, a measure of uncut (ie, methylated) ADAM33 DNA,
was normalized to control DNA. *P < .001).
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1397
(Fig 6). This could not be accounted for by differences in smoothmuscle content of the biopsy specimens because a-smoothmuscle actin (aSMA) expression was similar in both groups(Fig 6). Comparable data were also obtained by using theSYBR Green assays (see Fig E7 in the Online Repository atwww.jacionline.org).
DISCUSSIONIn this study we addressed the involvement of epigenetic
mechanisms in the cell type–selective expression of ADAM33.We identified the ADAM33 basal promoter (2550 to 187 bp) andconfirmed transcriptional activity using a luciferase reporter sys-tem. Because this region contains a predicted CpG island (2362to 180), on the basis of its size, GC content, and CpG dinucleo-tide frequency,22,23 we hypothesized the possible role of methyl-ation in silencing expression of ADAM33 in epithelial cells. Inmammals DNA methylation at CpG dinucleotides in the 59 regionof genes is a major epigenetic mechanism that regulates gene ex-pression.17 Approximately 50% of mammalian gene promotersand first exons are associated with 1 or more CpG islands.24,25
The absence of methylation at CpG islands is indicative of thepresence of transcriptionally active genes,15 whereas methylationof cytosines within the island results in gene silencing.26 Cytosinemethylation has long been speculated to be involved in the estab-lishment and maintenance of cell type–specific expression of reg-ulated genes,27,28 and 5-methylcytosine is known to be involvedin processes crucial to mammalian development, such as X-chro-mosome inactivation and gene imprinting.29-31 In a study of oste-oarthritis, increased synthesis of several cartilage-degradingenzymes, including MMP-3, MMP-9, MMP-13, and ADAMTS-4, was observed in late-stage osteoarthritis chondrocytes. This
was associated with hypomethylation of CpG sites in the pro-moter regions of these enzymes and was proposed to contributeto the development of osteoarthritis.12 In contrast, hypermethyla-tion of the promoter of ADAMTS8, a protease with antiangiogenicproperties,11 results in a reduction in its expression in neoplastictissues, providing the tumor cells with a consequent growth ad-vantage. Similarly, hypermethylation of the ADAM23 CpG-richpromoter leads to loss of this ADAM’s function and might be afactor in gastric carcinogenesis.32 By using bisulfite genomicDNA sequencing to detect the existence of methylation at theADAM33 promoter region, our results indicated that low levelsof methylation could be detected in fibroblasts that clearly expressADAM33. In contrast, epithelial cells that did not expressADAM33 showed a very high level of promoter methylation.The identified methylation sequence spans the transcriptionalstart site that usually overlaps the basic promoter, where com-plexes of universal transcriptional factors and RNA polymerasesbind. The sequence contains several predicted cis-actingregulatory DNA elements for transcription factor binding,such as Sp1 sites (59-AGGCGG-39, 59-TGCAC-39, and 59-GGGCGG-39; boxed in Fig 1, A; http://thr.cit.nih.gov/molbio/signal/). It has recently been demonstrated that DNA methylationof the murine Abcc6 proximal promoter region inhibits Sp1-dependent transactivation and controls tissue specific expressionof Abcc6.33 Thus epigenetic mechanisms are also likely to beimportant for cell type–specific ADAM33 regulation.
DNA methylation is a postsynthetic modification that normalDNA goes through after each replication. Of the 4 types of basepairs, only the CG base pair is methylated. Because DNA
FIG 4. Induction of ADAM33 expression after 5-aza-dC treatment. After 7
days’ treatment with 5-aza-dC, expression of ADAM33 in H292 cells (A) or
PBECs from asthmatic patients (C) was analyzed by means of RT-PCR (Fig
4, A) or RT-qPCR (Fig 4, C), with GAPDH as a housekeeping gene. Demeth-
ylation of the ADAM33 promoter by 5-aza-dC was confirmed in H292 cells
by means of bisulphate sequencing (B) and in PBECs from asthmatic pa-
tients by means of methylation-sensitive PCR with HpaII-digested genomic
DNA (D).
FIG 5. TGF-b–induced EMT does not affect ADAM33. A, The morphologic
appearance of A549 cells after TGF-b–induced EMT. B, mRNA expression
of EMT markers was quantified by using RT-qPCR. Data were normalized
by using the DDCt method, taking the lower expression level for each
gene as the normalizing value. Data are from 3 experiments. ND, Not de-
tected. C, Methylation-sensitive PCR for ADAM33 by using HpaII-digested
genomic DNA from control and TGF-b1–treated A549 cells.
J ALLERGY CLIN IMMUNOL
JUNE 2008
1398 YANG ET AL
replication is semiconservative, one strand of the new DNA isalready methylated, and the other strand remains to be methyl-ated by DNA methyltransferases (DNMTs).34 DNMT1 is be-lieved to perform most of the maintenance and de novomethylation activities that occur in somatic cells of mammals.35
Studies have shown that DNMT1 can also establish repression oftranscription complexes consisting of DNMT1, histone deacety-lase 2, and DNMT1-associated protein.36 DNMT1 is thought todirectly target transcriptionally repressed chromatin duringS-phase DNA replication. 5-Aza-dC induces selective degrada-tion of DNMT1 and serves as a strong demethylating agent.19,20
Thus we used 5-aza-dC to assess whether the demethylatingagent could restore ADAM33 expression in H292 epithelial cells.The RT-PCR results show that ADAM33 was derepressed by thisprocedure, thereby confirming that hypermethylation of theADAM33 promoter is responsible repression of gene expressionin epithelial cells.
It has been proposed that EMT might contribute to idiopathicpulmonary fibrosis, which involves increased production of inter-stitial collagen in the lung parenchyma.13 Because asthma is char-acterized by deposition of interstitial collagen in the subepithelialbasement membrane region, we considered whether epithelial ex-pression of ADAM33 might be induced by an EMT and whetherthis might make a subsequent contribution to subepithelial fibro-sis. Treatment of A549 lung epithelial cells with TGF-b induceda marked phenotypic transformation from a cobblestone epithelialmorphology to a fibroblastic phenotype characterized by loss ofcell-cell contact and cell spreading. Although we observed charac-teristic changes indicative of an EMT, such as increased expres-sion of collagen I, ADAM33 mRNA expression was not induced.
From our studies, we conclude that ADAM33 promoter meth-ylation silences gene expression in epithelial cells, irrespectiveof disease status. Assuming that there are no differences inADAM33 expression and regulation linked to ethnic background,our epigenetic findings, together with our mRNA data from bron-chial brushings and PBECs, suggest that the low level of signalpreviously detected in PBECs by means of RT-qPCR9 might beartifactual. The fact that ADAM33 expression remains silenced
in epithelial cells also raises doubts over the specificity of the an-tibody used to detect ADAM33 in the study by Lee et al.8 In ourown previous study we found some immunostaining of the epithe-lium; however, this could not be blocked by the immunizing pep-tide, suggesting a nonspecific interaction (eg, with epithelialcytokeratins).5 Similarly, we found nonspecific bands in Westernblots of mock-transfected HEK293 cells, where no ADAM33expression was detectable by means of RT-qPCR (see Fig E3).Even though Foley et al9 undertook their immunohistochemistrystudy with care and were able to block the majority of signal withthe immunizing peptide, this does not eliminate the possibilitythat other tissue proteins might cross-react with the antisera.37
Where claims are made for epithelial expression of ADAM33,it will be important to demonstrate independently that the immu-noreactivity detected in the epithelium is indeed ADAM33(eg, by obtaining peptide sequence data for the immunoreactiveprotein by means of mass spectrometry).
Because we failed to detect ADAM33 mRNA in bronchialbrushings, we wished to confirm whether ADAM33 expressionwas increased in bronchial biopsy specimens from subjects withsevere asthma, where the presence of ADAM33 would be due toits expression in bronchial smooth muscle and fibroblasts.However, we found no difference in expression levels comparedwith those of healthy subjects by using the 3 probe-basedADAM33 RT-qPCR assays, as well as the SYBR Green assay.Thus our comprehensive data are not consistent with the recentreport by Foley et al,9 who found increased expression ofADAM33 in airway samples from severe asthmatic subjects.One possible explanation for the difference between the pub-lished data and our findings lies in biopsy sampling and tissueheterogeneity. Because ADAM33 is expressed in smooth muscle,the level of expression will reflect the proportion of smooth mus-cle in each biopsy specimen. In this and our previous study,5 wealso analyzed aSMA expression as a marker of smooth musclecontent and expressed ADAM33 mRNA relative to aSMAmRNA. Because Foley et al9 did not take this into account, theoccurrence of more smooth muscle in their asthma sampleswould result in detection of a larger signal that might not reflect
FIG 6. Quantitation of ADAM33 mRNA in bronchial biopsy specimens from healthy subjects and patients
with severe asthma. Quantitative RT-PCR was performed by using primers and probes targeting the a
(ADAM33-EGF-Alpha) and b (ADAM33-Beta) isoforms of ADAM33, as well as exons G and H in the metal-
loprotease domain (ADAM33-GH). For comparison, the levels of aSMA in each biopsy specimen are also
provided. Data were analyzed by using the Mann-Whitney U test, and no significant differences were
detected between the groups.
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399
a true increase in transcription. Our findings suggest thatADAM33 expression is strictly silenced in epithelial cells regard-less of asthma, supporting our previous conclusion that increasedexpression of ADAM33 in asthmatic airways is unlikely toaccount for its contribution to disease pathogenesis.5 This suppo-sition is supported by genetic studies that have failed to show anygenetic association of SNPs in the ADAM33 promoter withasthma or BHR.1
In conclusion, we have demonstrated that the cell type–selective expression of ADAM33 is epigenetically controlled byDNA methylation. Failure to induce ADAM33 during the phe-notypic reprogramming that occurs during a TGF-b–inducedEMT and lack of evidence of ADAM33 mRNA in any samples ofbronchial epithelium strongly suggest that ADAM33 repression isa stable feature of airway epithelial cells. Furthermore, we couldfind no evidence of increased ADAM33 mRNA expression insevere asthma.
We thank Synairgen Research Ltd for provision of PBFs.
Clinical implications: It is unlikely that dysregulated expressionof ADAM33 in epithelial cells underlies its contribution toasthma pathogenesis.
REFERENCES
1. Van Eerdewegh P, Little RD, Dupuis J, Del Mastro RG, Falls K, Simon J, et al. As-
sociation of the ADAM-33 gene with asthma and bronchial hyper-responsiveness.
Nature 2002;418:426-30.
2. De Sanctis GT, Merchant M, Beier DR, Dredge RD, Grobholz JK, Martin TR, et al.
Quantitative locus analysis of airway hyperresponsiveness in A/J and C57BL/6J
mice. Nat Genet 1995;11:150-4.
3. Simpson A, Maniatis N, Jury F, Cakebread JA, Lowe LA, Holgate ST, et al. Pol-
ymorphisms in a disintegrin and metalloprotease 33 (ADAM33) predict impaired
early-life lung function. Am J Respir Crit Care Med 2005;172:55-60.
4. van Diemen CC, Postma DS, Vonk JM, Bruinenberg M, Schouten JP, Boezen HM.
A Disintegrin A Metalloprotease 33 polymorphisms and lung function decline in
the general population. Am J Respir Crit Care Med 2005;172:329-33.
5. Haitchi HM, Powell RM, Shaw TJ, Howarth PH, Wilson SJ, Wilson DI, et al.
ADAM33 expression in asthmatic airways and human embryonic lungs. Am J
Respir Crit Care Med 2005;171:958-65.
6. Blobel CP. Remarkable roles of proteolysis on and beyond the cell surface. Curr
Opin Cell Biol 2000;12:606-12.
7. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE. The splicing and fate
of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir Cell
Mol Biol 2004;31:13-21.
8. Lee JY, Park SW, Chang HK, Kim HY, Rhim T, Lee JH, et al. A disintegrin and
metalloproteinase 33 protein in patients with asthma: relevance to airflow limita-
tion. Am J Respir Crit Care Med 2006;173:729-35.
9. Foley SC, Mogas AK, Olivenstein R, Fiset PO, Chakir J, Bourbeau J, et al. In-
creased expression of ADAM33 and ADAM8 with disease progression in asthma.
J Allergy Clin Immunol 2007;119:863-71.
10. Razin A, Kantor B. DNA methylation in epigenetic control of gene expression.
Prog Mol Subcell Biol 2005;38:151-67.
11. Dunn JR, Reed JE, du Plessis DG, Shaw EJ, Reeves P, Gee AL, et al. Expression of
ADAMTS-8, a secreted protease with antiangiogenic properties, is downregulated
in brain tumours. Br J Cancer 2006;94:1186-93.
12. Roach HI, Yamada N, Cheung KS, Tilley S, Clarke NM, Oreffo RO, et al. Asso-
ciation between the abnormal expression of matrix-degrading enzymes by human
osteoarthritic chondrocytes and demethylation of specific CpG sites in the pro-
moter regions. Arthritis Rheum 2005;52:3110-24.
13. Willis BC, duBois RM, Borok Z. Epithelial origin of myofibroblasts during fibrosis
in the lung. Proc Am Thorac Soc 2006;3:377-82.
14. Hurd SZ. Workshop summary and guidelines: investigative use of bronchoscopy,
lavage, and bronchial biopsies in asthma and other airway diseases. J Allergy
Clin Immunol 1991;88:808-14.
15. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methyl-
ated cytosines. Nucleic Acids Res 1994;22:2990-7.
16. Umland SP, Garlisi CG, Shah H, Wan Y, Zou J, Devito KE, et al. Human ADAM33
mRNA expression profile and post-transcriptional regulation. Am J Respir Cell
Mol Biol 2003;29:571-82.
17. Bird A. The essentials of DNA methylation. Cell 1992;70:5-8.
18. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, et al. A
genomic sequencing protocol that yields a positive display of 5-methylcytosine
residues in individual DNA strands. Proc Natl Acad Sci U S A 1992;89:
1827-31.
19. Ferguson AT, Evron E, Umbricht CB, Pandita TK, Chan TA, Hermeking H, et al.
High frequency of hypermethylation at the 14-3-3 sigma locus leads to gene silenc-
ing in breast cancer. Proc Natl Acad Sci U S A 2000;97:6049-54.
20. Ghoshal K, Datta J, Majumder S, Bai S, Kutay H, Motiwala T, et al. 5-Aza-deox-
ycytidine induces selective degradation of DNA methyltransferase 1 by a proteaso-
mal pathway that requires the KEN box, bromo-adjacent homology domain, and
nuclear localization signal. Mol Cell Biol 2005;25:4727-41.
21. Kasai H, Allen JT, Mason RM, Kamimura T, Zhang Z. TGF-beta1 induces human
alveolar epithelial to mesenchymal cell transition (EMT). Respir Res 2005;6:56.
22. Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomes. J Mol Biol
1987;196:261-82.
23. Takai D, Jones PA. Comprehensive analysis of CpG islands in human chromo-
somes 21 and 22. Proc Natl Acad Sci U S A 2002;99:3740-5.
24. Ioshikhes IP, Zhang MQ. Large-scale human promoter mapping using CpG islands.
Nat Genet 2000;26:61-3.
25. Larsen F, Gundersen G, Lopez R, Prydz H. CpG islands as gene markers in the
human genome. Genomics 1992;13:1095-107.
26. Roder K, Latasa MJ, Sul HS. Silencing of the mouse H-rev107 gene encoding a
class II tumor suppressor by CpG methylation. J Biol Chem 2002;277:
30543-50.
27. Holliday R, Pugh JE. DNA modification mechanisms and gene activity during
development. Science 1975;187:226-32.
28. Futscher BW, Oshiro MM, Wozniak RJ, Holtan N, Hanigan CL, Duan H, et al.
Role for DNA methylation in the control of cell type specific maspin expression.
Nat Genet 2002;31:175-9.
29. Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene
results in embryonic lethality. Cell 1992;69:915-26.
30. Li E, Beard C, Jaenisch R. Role for DNA methylation in genomic imprinting.
Nature 1993;366:362-5.
31. Beard C, Li E, Jaenisch R. Loss of methylation activates Xist in somatic but not in
embryonic cells. Genes Dev 1995;9:2325-34.
32. Takada H, Imoto I, Tsuda H, Nakanishi Y, Ichikura T, Mochizuki H, et al.
ADAM23, a possible tumor suppressor gene, is frequently silenced in gastric can-
cers by homozygous deletion or aberrant promoter hypermethylation. Oncogene
2005;24:8051-60.
33. Douet V, Heller MB, Le SO. DNA methylation and Sp1 binding determine the
tissue-specific transcriptional activity of the mouse Abcc6 promoter. Biochem
Biophys Res Commun 2007;354:66-71.
34. Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu Rev Biochem
2005;74:481-514.
35. Yen RW, Vertino PM, Nelkin BD, Yu JJ, el Deiry W, Cumaraswamy A, et al. Iso-
lation and characterization of the cDNA encoding human DNA methyltransferase.
Nucleic Acids Res 1992;20:2287-91.
36. Rountree MR, Bachman KE, Baylin SB. DNMT1 binds HDAC2 and a new co-re-
pressor, DMAP1, to form a complex at replication foci. Nat Genet 2000;25:269-77.
37. Saper CB. An open letter to our readers on the use of antibodies. J Comp Neurol
2005;493:477-8.
J ALLERGY CLIN IMMUNOL
JUNE 2008
1399.e1 YANG ET AL
METHODS
Clinical characterization of subjectsSubjects were characterized according to symptoms, lung function, med-
ication, and skin prick test responses to common aeroallergens. Their clinical
characteristics are summarized in Tables E1 through E3. Asthma severity was
assessed according to the Global Initiative for Asthma guidelines.E1 All
volunteers were nonsmokers and free from respiratory tract infections for a
minimum of 4 weeks before inclusion into the study. Written informed consent
was obtained from all volunteers before participation, and ethical approval for
the study was obtained from the Joint Ethics Committee of Southampton
University Hospital Trust.
Bronchoscopy, human primary bronchial cell
culture, and cell linesAll procedures were performed after informed consent and approval by
the Southampton and South West Hampshire Ethics Committee. Fiberoptic
bronchoscopy was performed according to current guidelines. Surface
epithelial cells were obtained by means of gentle bronchial brushing, and
bronchial biopsy specimens were taken from the subcarinae of the lower and
middle lobes with alligator forceps. Cells from brushings and biopsy
specimens were either homogenized immediately into TRIZOL reagent for
RNA extraction or were used for primary cell culture. PBEC culture and
characterization was performed as described previously.E2,E3 PBFs were
obtained by outgrowth from bronchial biopsy specimens and cultured as
previously described.E4,E5 PBEC and PBF cultures from 4 healthy and 12 asth-
matic individuals were used in this study. H292 bronchial epithelial cells,
A549 alveolar epithelial cells, and MRC5 fetal fibroblasts were routinely cul-
tured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% heat-
inactivated FBS. Recombinant HEK293 cells were generated by means of
lipid (Effectene) transfection with the pcDNA3 vector containing full-length
ADAM33 cDNA or empty vector as a control. Stable transfectants were se-
lected by using G418 and cell lines generated by 2 rounds of cloning by means
of limiting dilution. HEK293 cells were routinely cultured in DMEM supple-
mented with 10% vol/vol FBS and antibiotics.
Treatment with 5-aza-dCH292 cells or PBECs were plated in DMEM/10% FBS or bronchial
epithelial growth medium and treated with a freshly prepared solution of 2, 5,
or 10 mmol/L 5-aza-dC (Sigma, Dorset, United Kingdom) for 7 days. The me-
dium and the drug were replaced every 24 hours. At the end of the treatment
period, the medium was removed, and then DNA and RNA were extracted for
sodium bisulfite genomic DNA sequencing or methylation-sensitive PCR and
RT-PCR, respectively.
Epithelial mesenchymal transitionA549 alveolar epithelial cells were seeded into 24-well plates at 40,000
cells per well and cultured for 48 hours in DMEM with 10% FBS. The cells
were then exposed to 2.5 ng/mL TGF-b1 for up to 5 days.
Extraction and purification of total RNA and
RT–PCR assayRNA was extracted according to the manufacturer’s protocol, and samples
were treated with RNase-free DNase (Ambion, Huntingdon, United King-
dom) to eliminate contaminating genomic DNA. Total RNA (0.2 mg), random
hexamers (100 ng), and M-MLV reverse transcriptase (120 U; Promega,
Southampton, United Kingdom) were used for cDNA production. cDNA was
amplified by means of standard PCR with primers detecting ADAM33 and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences
were as follow: ADAM33: forward GTTGCTGCTGCTGCTACTACTG,
reverse GGAGCTCCTGGCCTTCAG; GAPDH: forward GAAGGTGAAG-
GTCGGAGT, reverse GAAGATGGTGATGGGATTTC. The products were
electrophoresed on 2% agarose gel and visualized by using a GENE GENIUS
Bio Imaging System.
For quantitative analysis of ADAM33, the epithelial markers E-cadherin
(CDH1) and MUC2, and the mesenchymal markers COL1A1 and MMP-2,
real-time PCR was performed by using gene-specific primers with either a
gene-specific fluorogenic probe or SYBR Green (if no probe sequence is
indicated) with an Icycler (BioRad, Hercules, Calif), with GAPDH and
ubiquitin C (UBC) as normalizing genes (kits obtained from PrimerDesign,
Southampton, United Kingdom). Analysis of RT-qPCR data was performed
by using the DDCt method. The primers sequences were as follows:
ADAM33 EGF a (exons Q1R)—forward CTGCCACAGCCACGGGGTTTG,
reverse TGTCCATGCTGCCACCAA, probe CCACCCTTCTGTGACAAGC
CAGGCT; ADAM33 b (exons P1R)—forward ACCCAGTGTGGACCT
AGAATGGTTTGCAAT, reverse TGTCCATGCTGCCACCAA, probe:
CCACCCTTCTGTGACAAGCCAGGCT; ADAM33 MP (exons
G1H)—forward CCTGGAACTGTACATTGTGGCA, reverse GTCCACGT
AGTTGGCGACTTC, probe CCACACCCTGTTCTTGACTCGGCAC; AD
AM33 a-isoform (Foley)—forward GACCTAGAATGGTGTGCCAGA,
reverse AGCCTGGCTTGTCACAGAAG; rRNA S9 (Foley)—forward TGC
TGACGCTTGATGAGAAG, reverse CGCAGAGAGAAGTCGATGTG; MU
C2—forward CTGGATTCTGGAAAACCCAACTTT, reverse GGTGGCTC
TGCAAGAGATGTT, probe CCAATCAATTCTGTGTCTCCACCTGGT; CD
H1—forward CATGAGTGTCCCCCGGTATC, reverse CAGTATCAGCCG
CTTTCAGA; MMP2—forward CCAAGTGGTCCGTGTGAAGT, reverse
CATGGTGAACAGGGCTTCAT; COL1A1—forward AGACAGTGATTGA
ATACAAAACCA, reverse GGAGTTTACAGGAAGCAGACA.
Assessment of promoter activity with a luciferase
reporter assayA luciferase reporter plasmid was constructed by using the pGL3 basic
vector (Promega). The 59 flanking region of human ADAM33, spanning 2550
to 187 and containing a putative promoter sequence, was PCR amplified
by using the forward primer gcggtaccTGCTGCATCGCCTTTGCC and the
reverse primer caagatctGCTGTGAGCTCCTCGGCCTCTAG. The reverse
primer was adjacent to but did not include the translation start site. The for-
ward primer was tagged with KpnI (59) and the reverse primer was tagged
with BglII (39) restriction sites (lower case) for cloning into the vector. Result-
ing constructs were verified by means of sequencing. Transfections were per-
formed with the Qiagen Effectene kit (Qiagen, Sussex, United Kingdom).
MRC5 fetal lung fibroblasts were transfected according to the manufacturer’s
protocol with 1 mg of reporter plasmid and 300 ng of Renilla luciferase (pRL;
Promega) as an internal control for transfection efficiency. Cells were har-
vested 48 hours after transfection, and promoter activities were analyzed by
using the Dual-luciferase Reporter assay system, according to the manufac-
turer’s instructions (Promega). Activities were normalized to Renilla lucifer-
ase activity. Experiments were performed in triplicate, and results presented
are the mean of 3 independent experiments.
Treatment of genomic DNA for analysis
of methylation statusGenomic DNA from PBFs, PBECs, and H292 cells was extracted by using
the Wizard Genomic DNA purification kit (Promega) and digested with
BamHI (NEB), which flanks the region analyzed by means of bisulfite se-
quencing, or HpaII, which locates the amplicon analyzed by means of meth-
ylation-sensitive PCR.E6 After BamH1 digestion, DNA was purified by means
of phenol-chloroform extraction and resuspended in 50 mL of TE buffer. For
bisulfite sequencing, 2 mg of digested genomic DNA was denatured in 20 mL
of 0.3 M NaOH for 20 minutes at 378C and then placed on ice. A 220-mL al-
iquot of fresh 3.5 M sodium bisulfite with 1 mM hydroquinone was added, and
the solution was covered with liquid wax. The solution was incubated at 08C
overnight and then 508C for 8 hours in a water bath. The resulting bisulfite-
treated DNA was purified with the QIAEX II Extraction Kit (Qiagen) and re-
suspended in 50 mL of water; 1 mL of this was used for each subsequent PCR
analysis. For methylation-sensitive PCR analysis, 2 mg of genomic DNA was
digested overnight at 378C with 5 units of HpaII (a methylation-sensitive
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399.e2
restriction enzyme that has a recognition site within the target sequence of the
ADAM33 promoter) and PstI (NEB) in a total volume of 20 mL. PstI is a meth-
ylation-insensitive restriction enzyme that flanks the region to be analyzed by
means of methylation-sensitive PCR and was used to digest the DNA to ensure
that HpaII cleavage was efficient. The following morning, an additional 3 U of
HpaII was added and incubated for a further hour. They were then diluted to a
final concentration of 25 ng/mL for PCR analysis.
Cloning and sequencing of bisulfite-treated DNAThe bisulfite-treated DNAwas amplified by means of PCR with the primers
GGTGGGAGGTGGGGGYGGGAAGGTT and ACCCATAACTATAAACT-
CCTCRACCTCTA, cloned, and sequenced to determine the methylation
status of cytosines in the CpG island of the ADAM33 promoter. Each PCR was
performed in 9 mL and covered with liquid wax. Reactions contained 40 ng of
treated DNA, 0.1 mM of appropriate primers, 50 mM of deoxynucleoside tri-
phosphate, and 0.4 U of Taq DNA Polymerase (NEB). PCR conditions were
958C for 1 minute, followed by 36 cycles of 958C for 20 seconds, 668C for
1 minute, and 728C for 30 seconds and finally 728C for 7 minutes. Before clon-
ing, amplification was confirmed by running a portion of the PCR products on
a 2% agarose gel with ethidium bromide to verify that products were of the
expected size. Two independent PCRs from each sample were mixed together
and cloned into the pCR 2.1-TOPO vector to decrease the chance of stochas-
tically amplified PCR products, according to the manufacturer’s recommenda-
tion (Invitrogen). Ten clones were selected at random from each DNA sample;
plasmid DNA was isolated by using the QIApre Spin Mini-prep kit (Qiagen)
and sequenced with T7 primer by using an ABI 3730xl DNA Analyzer (Ap-
plied Biosystems, Foster City, Calif). Sequencing was done with Macrogen
(Seoul, Korea). In the alignment process vector and primer sequences were
removed, and cloned sequences were aligned.
For methylation-sensitive PCR, the HpaII-cut DNAwas amplified by using
2 pairs of primers: the first pair, GCGGTCCTCCAAGAACCTTCC and
TGCGGCCCCTCGGATGAC, spanned an amplicon containing an HpaII
recognition site in the ADAM33 promoter, and the second pair, TGAAA-
CGCCTCTCTGAGGTT and GGCAAATAGACGGCACTCTC, amplified a
sequence that did not contain an HpaII-cutting site and served as an internal
control. Each PCR was performed in 20 mL containing 50 ng of digested
DNA, 0.6 mM of appropriate primers, 200 mM of deoxynucleoside triphos-
phate, and 0.4 U of Taq DNA Polymerase (NEB). PCR conditions were
958C for 3 minutes, followed by 30 cycles of 958C for 30 seconds, 608C for
30 seconds, and 728C for 20 seconds and finally 728C for 7 minutes. PCR pro-
ducts were run on a 3% agarose gel with ethidium bromide.
Western blot analysisLysates of HEK293 cells expressing recombinant ADAM33 or mock-
transfected control cells were solubilized, separated by means of SDS gel
electrophoresis, and Western blotted with an affinity-purified rabbit antibody
raised against the cytoplasmic domain of ADAM33 (RP3; Triple Point
Biologics, Inc, Forest Grove, Ore), as previously described.E7
RESULTS
Validation of the ADAM33 qPCR assaysWe used 3 probe-based assays to quantify ADAM33 expression
in our airway-derived samples. These assays allowed assessmentof the a and b isoforms of ADAM33, which vary in the EGFdomain (the b isoform lacks exon Q), whereas the third assayenabled quantitation of exons G and H, which lie in the ADAM33metalloprotease domain. This region was targeted for studybecause we have previously shown that only approximately 5%to 10% of ADAM33 transcripts contain the MP domain.E4 Wefirst validated these assays by using HEK293 cells, which weretransfected with a cDNA encoding full-length ADAM33. This al-lowed us to show that the ADAM33 EGF a and MP domain assayswere of comparable efficiency (Fig E1, A). We were unable to test
the ADAM33-EGF-b assay in the cells because the recombinantcells expressed only the full-length a isoform of ADAM33. How-ever, the efficiency of this assay was 97.8%, and when tested withcDNA from human bronchial fibroblasts, this splice variantwas relatively poorly expressed compared with the a isoform(Fig E1, B), as previously reported.E4
These assays were used to evaluate ADAM33 mRNA in 14bronchial brushings from 6 healthy subjects and 16 bronchialbrushings from 9 patients with severe asthma; however, nopositive signal was detectable, even though a strong signal wasdetected by using fibroblasts as a positive control (Fig E2, A).Failure to detect a positive signal for ADAM33 mRNA was notdue to poor quality or quantity of RNA extracted from the brush-ings because strong signals were detected for the housekeepinggenes (average cycle threshold (Ct) values of 20 to 21) and theepithelial-specific gene MUC5AC, whereas low signals weredetected for the myofibroblast marker aSMA (Fig E2, B). Todetermine whether the lack of consistency between our findingsand those of Foley et alE8 might be due to differences in theRT-qPCR primers used in our assays, we went on to evaluatethe exact ADAM33 and S9 rRNA housekeeping gene assaysused in the previous study. These assays differed from ourprobe-based assays in that detection of the PCR product usedSYBR Green. In these assays we detected a strong ADAM33signal in recombinant ADAM33-expressing HEK cells and fibro-blasts and lower levels of signal in mocked-transfected HEK293cells and even less in RT minus and water controls (Fig E3, leftpanel). The S9 rRNA housekeeping gene assay gave strong sig-nals for all samples except the RT minus and water controls. Be-cause the published protocol used SYBR Green to detect the PCRproduct by measuring the increase in fluorescence caused bybinding of SYBR Green to double-stranded DNA, this systemwill detect not only gene-specific product but also any productsarising because of mispriming. This contrasts with probe-basedassays, in which detection is dependent on the increase in fluores-cence arising from cleavage of a quenched probe that is comple-mentary to the target gene PCR product, resulting in a muchhigher level of specificity. Recognizing the limitations of theSYBR Green protocol, we also performed melt-curve analysisto assess the homogeneity of the product formed in every assay.For the HEK cells expressing recombinant ADAM33 and humanbronchial fibroblasts, a homogeneous PCR product melting at918C was detected (Fig E3, right panel). In contrast, cDNAfrom the mock-transfected HEK cells, which resulted in Ct valuesof 28 to 30, suggestive of low-level ADAM33 expression, yieldedheterogeneous PCR products, as evidenced by the melting of mul-tiple peaks over a range of temperatures, none of which occurredat 918C, indicating the absence of ADAM33 expression. Of inter-est, the antibody against the cytoplasmic tail of ADAM33 (RP3),which has previously been used to detect ADAM33 proteinexpression by immunostaining,E8,E9 recognized full-lengthADAM33 in the transfected HEK293 cells as expected but alsodetected protein bands between 75 and 50 kd in mock-transfectedcells that lacked ADAM33 expression (Fig E3, far right). Thissuggests that other tissue proteins might cross-react with theADAM33 antibodies, as has been observed with other unrelatedantibodies in studies using knockout mice.E10 Furthermore, it isunlikely that this antibody can detect epithelial deposition of se-creted ADAM33 protein produced by smooth muscle and fibro-blasts because it recognizes an epitope in the cytoplasmicdomain of ADAM33.
J ALLERGY CLIN IMMUNOL
JUNE 2008
1399.e3 YANG ET AL
When bronchial brushings from healthy or asthmatic volun-teers were analyzed, the amplification curves for ADAM33yielded Ct values in the region of 30 to 36 (Fig E4, left panel).Although many of the ADAM33 signals were earlier than theRT minus controls, melt-curve analysis (Fig E4, right panel)showed that the products of these reactions were heterogeneous,strongly suggesting that the PCR products formed were due tomispriming. In all cases the housekeeping gene produced strongsignals, showing that the quantity of input cDNA was similarbetween groups (Fig E4, bottom panels).
Fig E5 shows a summary of the data obtained for bronchialbrushings and bronchial biopsy specimens from healthy subjectsand patients with severe asthma. In all cases biopsy specimens re-sulted in a relatively homogeneous product consistent with thepresence of ADAM33 in the samples. Analysis of these datarevealed that there was no significant difference in ADAM33expression in bronchial biopsy specimens from healthy subjectsand patients with severe asthma (Fig E7). In contrast with the find-ings for the biopsy specimens, the data for the brushings werestrongly suggestive that the majority of the signal detected in thesamples was not due to the presence of an ADAM33-specific pro-duct. There was no difference in the quality or quantity of the sig-nal obtained from brushings from healthy and asthmatic subjects.
To confirm the findings of the melt-curve analysis on bronchialepithelial brushings, we further analyzed the PCR products dyedwith SYBR Green by means of 4% agarose gel electrophoresis(Fig E6). This showed a single band at 160 bp for ADAM33-ex-pressing HEK cells, fibroblasts, and biopsy specimens, whereasmultiple bands were observed in products derived from bronchialbrushings. Because some of these bands were of a similar size tothe ADAM33 products, we wished to be absolutely certain thatthis was not due to very low levels of ADAM33 expression.Consequently, the bands were cut from the gel, cloned, and
sequenced. As shown in Table E4, this revealed that none of thebands from the bronchial brushings gave rise to clones containingany ADAM33 sequence. In contrast, PCR products from fibro-blasts and biopsy specimens generated positive clones. Thus al-though some of the PCR products in the bronchial brushingshad the anticipated size, this appeared to have arisen by chancebecause of mispriming during the PCR reaction. We thereforeconclude that bronchial epithelial brushings do not expressADAM33.
REFERENCES
E1. Bousquet J. Global initiative for asthma (GINA) and its objectives. Clin Exp
Allergy 2000;30(suppl 1):S2-5.
E2. Bucchieri F, Puddicombe SM, Lordan JL, Richter A, Buchanan D, Wilson SJ,
et al. Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis. Am J Respir Cell Mol Biol 2002;27:179-85.
E3. Lordan JL, Bucchieri F, Richter A, Konstantinidis AK, Holloway JW, Puddi-
combe SM, et al. Co-operative effects of Th-2 cytokines and allergen on normal
and asthmatic bronchial epithelial cells. J Immunol 2002;169:407-14.
E4. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE. The splicing and
fate of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir
Cell Mol Biol 2004;31:13-21.
E5. Richter A, Puddicombe SM, Lordan JL, Bucchieri F, Wilson SJ, Djukanovic R,
et al. The contribution of interleukin (IL)-4 and IL-13 to the epithelial-mesenchy-
mal trophic unit in asthma. Am J Respir Cell Mol Biol 2001;25:385-91.
E6. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methyl-
ated cytosines. Nucleic Acids Res 1994;22:2990-7.
E7. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE. The splicing and
fate of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir
Cell Mol Biol 2004;31:13-21.
E8. Foley SC, Mogas AK, Olivenstein R, Fiset PO, Chakir J, Bourbeau J, et al. In-
creased expression of ADAM33 and ADAM8 with disease progression in
asthma. J Allergy Clin Immunol 2007;119:863-71.
E9. Haitchi HM, Powell RM, Shaw TJ, Howarth PH, Wilson SJ, Wilson DI, et al.
ADAM33 expression in asthmatic airways and human embryonic lungs. Am J
Respir Crit Care Med 2005;171:958-65.
E10. Saper CB. An open letter to our readers on the use of antibodies. J Comp Neurol
2005;493:477-8.
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399.e4
FIG E1. A, Validation of probe-based qPCR assays for ADAM33. cDNA from HEK293 cells expressing recom-
binant ADAM33 cells was tested for equivalence by using primers in the EGF domain (ADAM33-EGF-a) and
the metalloprotease domain (ADAM33-GH); mock-transfected cells were used as control. B, Comparison of
the ADAM33-EGF-a, ADAM33-b, and ADAM33-GH assays by using cDNA from PBFs. Data are presented as
means 6 SDs.
J ALLERGY CLIN IMMUNOL
JUNE 2008
1399.e5 YANG ET AL
FIG E2. A, Analysis of ADAM33 expression in bronchial brushings. cDNA from bronchial epithelial brush-
ings was tested for ADAM33 expression by using the 3 validated probe-based assays, with fibroblast
cDNA being used as a positive control. B, The quantity and quality of the RNA from bronchial brushings
was assessed by using primers to MUC5AC, with aSMA to control for the signal from fibroblasts. Data
are presented as means 6 SDs.
J ALLERGY CLIN IMMUNOL YANG ET AL 1399.e6
FIG E3. Validation of the SYBR Green assays for the ADAM33-a isoform and S9 rRNA. The upper 2 plots in
the left panel show amplification curves for ADAM33 expression in HEK293 cells expressing recombinant
ADAM33 (red) and mock-transfected cells (orange; upper panel) and fibroblasts (green) and RT2 (purple)
and water (blue) controls (lower panel). The lower 2 plots show amplification curves for S9 rRNA by using
the same samples as used for ADAM33. The right panel shows the corresponding melt curves for each sam-
ple, and on the far right, a Western blot using an anti-ADAM33 antibody against cell lysates prepared from
ADAM33-transfected or mock-transfected HEK293 cells is shown.
VOLUME 121, NUMBER 6
J ALLERGY CLIN IMMUNOL1399.e7 YANG ET AL
FIG E4. Analysis of mRNA in bronchial epithelial brushings by using the SYBR Green assays for ADAM33-a
isoform and S9 rRNA. The left panel shows (in descending order) the amplification curves obtained for
ADAM33 expression in bronchial brushings from healthy control volunteers (green), patients with severe
asthma (red), and the RT minus and water controls (purple and blue). The bottom plots shows curves for
S9 rRNA. The right panel shows the corresponding melt curves for each sample.
JUNE 2008
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399.e8
FIG E5. Melt curve analysis of PCR products obtained in assays of bronchial epithelial brushings and
bronchial biopsy specimens by using the SYBR Green assays for the ADAM33-a isoform. The upper 2
panels show melt curves obtained for PCR products from bronchial brushings (upper panels) and bronchial
biopsy specimens (lower panels) from healthy subjects (left) and asthmatic patients (right). The bottom 2
panels are the same on both the left and right and show control data for comparison. These comparative
data are melt curves obtained for PCR products from expression fibroblasts (green), the RT minus and water
controls (purple and blue), and HEK293 cells expressing ADAM33-transfected (red) or mock-transfected
cells (yellow).
J ALLERGY CLIN IMMUNOL
JUNE 2008
1399.e9 YANG ET AL
FIG E6. Agarose gel electrophoresis of PCR products from the SYBR Green assays for the ADAM33-a iso-
form. The plate shows a typical gel for the PCR products from bronchial brushings (B), fibroblasts (F),
HEK293 cells expressing ADAM33 (H1), and the RT minus control. The region of the gel that was selected
for excision and cloning of the PCR products is indicated.
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399.e10
FIG E7. Quantitation of ADAM33 expression in bronchial biopsy specimens from healthy subjects and pa-
tients with severe asthma by using the SYBR Green assays for the ADAM33-a isoform. cDNA from the bi-
opsy specimens used in the probe-based ADAM33 assays was reanalyzed by using the SYBR Green
assay. The data were normalized by using S9 rRNA, as described by Foley et al.9 Data were analyzed by
using the Mann-Whitney U test; no significant differences were detected between the groups.
J ALLERGY CLIN IMMUNOL
JUNE 2008
1399.e11 YANG ET AL
TABLE E1. Bronchial brushing subject characteristics
Control subjects
Subjects with
severe asthma
No. of subjects 6 9
No. of BBRs/mean per subject 14/2.3 16/1.8
Sex (F/M) 1/5 6/3
Age (y), mean (range) 42 (19-64) 47 (17-63)
FEV1 (% predicted), range 106 (90-134) 64 (30-119)*
Atopy (yes/no) 3/3 5/4
ICS (BDP equivalent, mg/d) 0 2000 (50-4000)
LABA (yes/no) 0 9/0
BBR, Bronchial brushing; F, female; M, male; ICS, inhaled corticosteroids; BDP,
beclomethasone dipropionate; LABA, long-acting b-agonists.
*Significant difference (P < .05).
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399.e12
TABLE E2. Bronchial biopsy specimen subject characteristics
Control subjects
Subjects with
severe asthma
No. of subjects 8 15
No. of BBXs/mean per subject 15/1.9 23/1.5
Sex (F/M) 3/5 11/4
Age (y), mean (range) 41 (19-64) 44 (17-71)
FEV1 (% predicted), range 105 (90-134) 70 (30-125)*
Atopy (yes/no) 5/3 9/6
ICS (BDP equivalent, mg/d) 0 2000 (500-4000)
LABA (yes/no) 0 15/0
BBX, Bronchial biopsy specimens; F, female; M, male; ICS, inhaled corticosteroids;
BDP, beclomethasone dipropionate; LABA, long-acting b-agonists.
*Significant difference (P < .05).
J ALLERGY CLIN IMMUNOL
JUNE 2008
1399.e13 YANG ET AL
TABLE E3. Primary epithelial cell fibroblast subject characteristics
Control subjects
Subjects with
mild/moderate asthma
Subjects with
severe asthma
No. of subjects 4 6 6
Sex (F/M) 0/4 5/1 5/1
Age (y), mean (range) 34 (21-64) 32 (18-59) 52 (31-64)
FEV1 (% predicted), range 101 (91-112) 102 (92-103) 71 (39-89)*
Atopy (yes/no) 0/4 6/0 4/2
ICS (BDP equivalent, mg/d) 0 470 (200-2000) 980 (200-2000)
LABA (yes/no) 0 0 5/1
F, Female; M, male; ICS, inhaled corticosteroids; BDP, beclomethasone dipropionate; LABA, long-acting b-agonists.
*Significant difference (P < .05).
J ALLERGY CLIN IMMUNOL
VOLUME 121, NUMBER 6
YANG ET AL 1399.e14
TABLE E4. Aligned sequences determined from clones derived
from bands cut from agarose gels of PCR products from fibro-
blasts, bronchial brushings, bronchial biopsy specimens,
HEK293 mock-transfected cells, and negative water controls
Source of RT-qPCR
product Aligned sequence
Fibroblasts Homo sapiens ADAM33
BBX ADAM33
Homo sapiens damage-specific DNA binding
protein 1 (DDB1)
BBR Homo sapiens lymphocyte cytosolic protein
1 (LCP1)
Homo sapiens chromosome 19 genomic contig
Homo sapiens adducing 1 (a) (ADD1)
Homo sapiens AHNAK nucleoprotein
(desmoyokin) (AHNAK)
Homo sapiens chromosome 17 genomic contig
Homo sapiens procollagen-proline,
2-oxoglutarate 4-diocygenase (praline
4-hydroxylase), a polypeptide II (P4HA2)
Non-cDNA sequence
HEK293-mock LCP1
DDB1
Water Non-cDNA sequence
BBX, Bronchial biopsy specimens; BBR, bronchial brushings; HEK293-Mock, mock-
transfected HEK293 cells; Water, negative control.