lable at ScienceDirect

Crop Protection 65 (2014) 43e50

Contents lists avai

Crop Protection

journal homepage: www.elsevier .com/locate/cropro

Geographic distribution of mealybug wilt disease of pineapple andgenetic diversity of viruses infecting pineapple in Cuba

L. Hernandez-Rodriguez*, P.L. Ramos-Gonzalez 1, G. Garcia-Garcia, V. Zamora,A.M. Peralta-Martin, I. Pe~na, J.M. Perez, X. FerriolResearch Institute on Tropical Fruit Crops, 7th Ave. # 3005, P.O. Box 11 300, Playa, Havana, Cuba

a r t i c l e i n f o

Article history:Received 22 February 2014Received in revised form30 June 2014Accepted 1 July 2014Available online

Keywords:Plant virusesPineappleMealybug wilt of pineappleAmpelovirusesBadnavirusesMolecular characterization

* Corresponding author. Ave. 7ma. No. 3005 e/30 yCuba. Tel.: þ53 209 3585; fax: þ53 7 204 6794.

E-mail address: fitopatologia@iift.cu (L. Hernandez1 Current address: Centro de Citricultura Sylvio M

13490-970, Cordeiropolis, Sao Paulo (SP), Brazil.

http://dx.doi.org/10.1016/j.cropro.2014.07.0030261-2194/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

Several species of ampeloviruses and badnaviruses infect pineapple plants around the world. Pineapplemealybug wilt-associated ampeloviruses have been associated with mealybug wilt of pineapple (MWP),the major viral disease threatening this crop. Conversely, infection by the badnaviruses Pineapplebacilliform comosus virus (PBCOV) and Pineapple bacilliform erectifolius virus (PBERV) is asymptomatic.To investigate the status of infection of the pineapple crop in Cuba, a diagnostic survey was developed incommercial areas during the period 2009e2012. Incidence of MWP disease was found in up to 100% ofthe plants in some fields of Central and Eastern regions of the island. Molecular assays revealed thepresence of PMWaV-1 for the first time in the Caribbean basin and PMWaV-2, PMWaV-3, either as mixedinfections or in combination with PBCOV throughout the country. Furthermore, they revealed for the firsttime the presence of PMWaV-2 in Bromelia pinguin L., a plant commonly used in Cuba as hedgerow.Sequence analysis of partial heat shock protein 70h and complete coat protein gene of Cuban isolates ofPMWaV-1, -2 and -3 showed nucleotide identities above 97% with cognate sequences of viruses isolatedfrom other countries. This work discloses the presence of a complex of viruses associated with thepineapple crop in Cuba, highlights the potential role of B. pinguin in the PMWaV-mealybug-pineapplepathosystem and makes available diagnostic tools for the detection of viruses affecting pineapple for aseed certified production system in Cuba.

© 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Mealybug wilt of pineapple (MWP) is a devastating disease ofpineapple (Ananas comosus (L.) Merr.) and is currently present inthe major pineapple-growing areas of the world (Sether et al.,2010). Disease symptoms include severe tip dieback, leafreddening, downward curling along the leaf margins and dieback,and wilting of symptomatic leaves, all of them related to a reducedroot system size (Sether and Hu, 2002a).

AlthoughMWP etiology is not thoroughly understood, Pineapplemealybug wilt-associated virus-1 (PMWaV-1), PMWaV-2 andPMWaV-3 (genus Ampelovirus, family Closteroviridae) have beenidentified as the fundamental viral pathogens (Gambley et al.,

32, Miramar, Playa, Havana,

-Rodriguez).oreira, IAC, Caixa Postal 04

2008a). In Hawaii, MWP symptoms are caused by the simulta-neous presence of PMWaV-2 and mealybugs, but the combinationof mealybugs with either PMWaV-1 or PMWaV-3 does not elicit thedisease (Sether and Hu, 2002a). On the contrary, in AustraliaPMWaV-2 is not responsible for 100% of plants showing MWP,suggesting that either other PMWaV species, different strains ofPMWaV-2, or additional factors may be involved in the observedsymptoms (Gambley et al., 2008a).

Pineapple bacilliform comosus virus (PBCOV) and Pineapplebacilliform erectifolius virus (PBERV) (tentative members of thegenus Badnavirus, family Caulimoviridae) have also been identifiedin pineapple, but their infections are asymptomatic (Gambley et al.,2008b; Sether et al., 2012). PBCOV has been detected in pineapplesfrom Hawaii, Australia and China, and PBERV has been only iden-tified in pineapples fromAustralia (Gambley et al., 2008b;Wu et al.,2010; Sether et al., 2012). Although PBCOV and PBERV are notdirectly involved with MWP, interactions of badnaviruses with thedisease cannot be ruled out, considering the experience of badna-virus diseases in other crops (Sether and Hu, 2002a).

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e5044

Both pineapple ampeloviruses and badnaviruses are trans-mitted by mealybugs (Dysmicoccus and Pseudococcus spp.) anddisseminated by the vegetative propagation of pineapple plants(Sether et al., 1998, 2012; Gambley et al., 2008b). In pineapple fieldsD. brevipes and D. neobrevipes are generally associated with ants inan interaction of synergism assisting mealybugs population toprosper and spread the disease (Rohrbach et al., 1988).

Control of viral disease in pineapple would demand the use ofsensitive and reliable diagnostic systems (Gambley et al., 2008a).Due to clonal propagation of pineapple, healthy-appearing plantscould become a source for virus spread to new areas. Tissue blotimmunoassay (TBIA) using specific monoclonal antibodies and RT-PCR assay have contributed to the selection of seed productionfields and the assessment of ampelovirus spread (Sether et al.,2005; Gambley et al., 2008a; Hernandez et al., 2010a, 2010b). Inaddition, the presence of characteristic MWP symptoms haspermitted epidemiological studies to be carried out (Hughes andSamita, 1998; Awuah and Adzim, 2004).

Losses of pineapple crop associated with MWP fluctuate be-tween 25 and 100% of yield and, when there are outbreaks of thedisease during the first three months after planting, average fruitweight is reduced by 55% in comparison to that from PMWaV-freeplants (Sether and Hu, 2002b). Particularly, asymptomatic PMWaV-1 infection causes up to 5e15% yield reduction in the secondarycrops (ratoon crops) and losses associated with premature orasynchronous fruit ripening reached 30% of the production inHawaii (Sipes et al., 2002). The high similarity and phylogeneticrelation between PMWaV-1 and PMWaV-3 suggest that PMWaV-3could induce the same deleterious effects as PMWaV-1 on thepineapple crop (Sether et al., 2009).

Pineapple is an economically important fruit crop in Cuba. In2012, more than 37, 000 tonnes of fruits were harvested from6172 ha, mainly of the cultivar Red Spanish (Ministry of Agricultureof Cuba, Anonymous, 2012). Even though total production increasesevery year, continuous declines of yields from pineapple orchardshave been detected. Data from recent decades estimated up to 40%of yield losses associated with MWP in the pineapple crop (Borrotoet al., 2007). Closterovirus-like particles were first observed inMWP-affected pineapple plants from Ciego de Avila almost 20years ago (Borroto et al., 1998). Further molecular characterizationdemonstrated the presence of PMWaV-2 in samples gathered fromCiego de Avila and Isla de la Juventud, and PMWaV-3 in Isla de laJuventud (Borroto et al., 2007; Hernandez et al., 2010a, 2010b).Recently, PBCOV was also detected infecting pineapples showingMWP in the country (Hernandez-Rodriguez et al., 2013). Since thepresence of MWP hampers pineapple production, and taking intoaccount the limited extent of unsystematic field surveys previouslyconducted in Cuba, the aims of this work were to evaluate for thefirst time in a large scale, the distribution of MWP disease and thepresence of PMWaV-1, PMWaV-2, PMWaV-3 and PBCOV in Cubancommercial pineapple fields. This work was conducted as part of aneffort to establish a system for production of healthy certifiedpineapple seed in Cuba.

2. Materials and methods

2.1. Field inspection and plant material collection

The incidence of MWP symptomatic plants was determined bysurveys conducted in 24 commercial pineapple plantations ofcultivar Red Spanish, during 2009e2012. The number of plantsshowing characteristic MWP symptoms and total number of plantsin the plantation were recorded from each prospected field. MWPsymptoms evaluated were foliar reddening, leaves with tips curveddown and dieback, and a wilted aspect (Sether and Hu, 2002a).

Incidence of disease in a field was calculated based on the percent-age of MWP symptomatic plants. In fields with 2 ha or less, 100% ofthe plants were inspected and, in larger areas, the incidence wasestimated by examining 10% of the plants following a systematicsamplingmethodwith aW-shaped pathway (Gottwald,1995). MD2and Smooth Cayenne fields from Ciego de Avila and San Vicente,Granma, respectively,were inspected onlywith the aimof collectingdiseasedplants of those cultivars. Symptomatic plants (110 samples)from all prospected fields were randomly selected and the entireplants or vegetativepropagationmaterials fromthem (i.e. suckers orcrowns)were transplanted toplastic potskept in agreenhouseat theResearch Institute on Tropical Fruit Crops, Havana, Cuba. Asymp-tomatic Ananas ananassoides (Baker) L. B. Sm. Rank plants werecollected in private gardens in Havana and Ciego de Avila; mean-while Bromelia pinguin plants showing reddening and die back andused as hedgerows were collected in Banes, Holguin. Regular foliarapplications of deltamethrin (Decis®10 EC, Bayer CropScience)weremade in the greenhouse to prevent mealybug and ant infestationsand avoid viral transmission among plants.

2.2. Diagnosis and characterization of the ampeloviruses

For total RNA isolation, 100 mg of the basal white portion of pine-apple leaves was processed using TRIzol LS Reagent kit (Invitrogen,Scotland, UK) and following the manufacturer's instructions. RT-PCRassays for PMWaV-1, PMWaV-2 and PMWaV-3 detection were per-formed using the Titan One Tube RT-PCR System (Roche Diagnostics,Mannheim, Germany) and the 225/226, 223/224 and 263/264 primerpairs, respectively (Sether et al., 2005). ORF5 (open reading frame) ofampeloviruses, encoding the coat protein (cp gen), was amplifiedfollowing the samemethodologyusing theprimer pairs as follows: forPMWaV-1 CP227 (5'GAGCTCTTATTTGCGTCCACCCATAAAG3') andCP228 (5'GAGCTCATGGCTGATTCGAGCAAAC3'), for PMWaV-2 CP229(5'GGATCCCTACCCTGAAACAGCTCCCTGG3') and CP230 (5'GGATC-CATGGCTCAGAATTACGTAGCCG3'), and for PMWaV-3 CP231(5'AAGCTTTCATCTGCGATTACCTG3') and CP232 (5'GGATCCATGAG-TACGATTCCAGTAC3'). The annealing temperature for all the assayswas 55 �C.

2.3. Detection of Pineapple bacilliform comosus virus

Pineapple DNA purifications were done using the procedureproposed by Murray and Thompson (1980). PBCOV detection wasconducted by a non-radioactive dot blot nucleic acid hybridization(DBH) using as probe a fragment of 540 nt of the reverse tran-scriptase/RNase H region of PBCOV isolate BCuL26 (Hernandez-Rodriguez et al., 2013) and obtained using the PCR DIG labelingand detection kit (Roche). For the DBH, 10 mg of DNA were dena-tured at 95 �C for 10 min, chilled on ice and applied into nylonmembranes (Amersham Pharmacia Biotech, USA) using a com-mercial device (BIO-RAD BIO-DOT ™ apparatus, Bio-Rad, USA).Nucleic acid extracts were cross-linked to the membrane in acrosslinker device (UVITEC, Cambridge, UK). Pre-hybridization wasachieved for 2 h at 55 �C in Church buffer (Sambrook et al., 1989),and hybridized in the same solution at 60 �C for 16 h after adding100 ng of the DIG-probe denatured at 95 �C during 10 min. Afterhybridization, membranes were twice washed according to theprocedure described in Dig Luminescent Detection Kit (Roche) andthe chemiluminescent detection was performed using CPD-starsubstrate (Roche) and Omat-S film (Kodak).

2.4. PCR product cloning, nucleotide sequencing and bioinformatics

All PCR products were purified using the High Pure PCRproduct purification kit (Roche Diagnostic) and cloned into pGEM-

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e50 45

T Easy vector (Promega, Madison, WI) following standard pro-tocols (Sambrook et al., 1989). Plasmids were purified using theHigh Pure Plasmid Isolation Kit (Roche Diagnostic). Ampliconswere sequenced using pUC-M13 forward and reverse primers bythe service of Macrogen Inc., Seoul, Korea (http://www.macrogen.com). Four plasmid clones were sequenced for each amplicon andthe consensus sequence was achieved with the ContigExpress toolof VECTOR NTi v.8.0 software (Invitrogen, Carlsbad, CA, USA).Unrooted phylogenetic trees based on 1000 replications werecreated using neighbor-joining analysis of Clustal X v1.8 (Saitouand Nei, 1987). Ampelovirus sequences used for phylogenetic an-alyses were as follows: Grapevine leaf roll associated virus-1(GLRaV-1) AF195822, GLRaV-3 NP_813795/EU259806, GLRaV-5AF233934, GLRaV-9 AY297819/AY072797, GLRaV-10 AM182328,GLRaV-11 AM494935, Plum bark necrosis stem pitting-associatedvirus (PBNSPaV) EF546442, PMWaV-1 isolate Hawaii (PMWaV-1Hw) NC_010178, PMWaV-1 isolate Taiwan (PMWaV-1 Tw)EU769114/EU769113, PMWaV-1 isolate Thailand (PMWaV-1 TL)EF620774.1, PMWaV-1 isolate Australia (PMWaV-1 Au) EF467925,PMWaV-2 isolate Hawaii (PMWaV-2 Hw) AF283103, PMWaV-2isolate Taiwan (PMWaV-2 Tw) EU769116/EU769115, PMWaV-2isolate Cuba (PMWaV-2 CU CA CL) DQ225114, PMWaV-2 isolateCuba (PMWaV-2 CU IJ ER) FN825676, PMWaV-3 isolate Hawaii(PMWaV-3 Hw) DQ399259, PMWaV-3 isolate Cuba (PMWaV-3 CUIJ ER) GU563497, PMWaV-3 isolate Taiwan (PMWaV-3 Tw)FJ209048/FJ09047, PMWaV-4 isolate Hawaii (PMWaV-4 Hw)EU372003 and PMWaV-5 isolate Australia (PMWaV-5 Au)EF467920. Closterovirus sequences used were as follows: Beetyellow stunt virus (BYSV) U51931, Beet yellow virus (BYV) X73476,Citrus tristeza virus isolate T36 (CTV-T36) AY170468, GLRaV-2EF012721, Carrot yellow leaf virus (CYLV) NC013007, and Straw-berry chlorotic fleck-associated virus (SCFaV) DQ860839. Crinivirussequences used were as follows: Abutilon yellow virus (AYV)AY422070, Bean yellow disorder virus (BnYDV) NC_010560/NC_010561, Sweet potato chlorotic stunt virus (SPCSV) AJ428555,and Tomato chlorosis virus (TCV) AY903448.

3. Results

3.1. Incidence of mealybug wilt disease of pineapple in Cubancommercial fields

In this study, a total of 24 commercial pineapple fields distrib-uted throughout Cuba with distinct agro-ecological conditions

Fig. 1. Prospected plants (,), mealybug wilt of pineapple (MWP) symptoms incidences (▪) afields in Cuba, during 2009e2012. The surveyed orchards were in Isla de la Juventud (I1, I2 anand M2), Villa Clara (V1eV5), Ciego de Avila (CA), Camagüey (C1, C2 and C3), Granma (Gr)

were surveyed. Low to high incidences of plants showing MWPdistinctive symptoms were detected in all regions of Cuba, withsome of the MWP compromised areas associated to importantareas of pineapple production in Cuba (Fig. 1). Fields with incidencevalues higher than 90% were identified in Villa Clara (V1, V2 andV5), currently the largest area of pineapple production in Cuba,Habana del Este (Hv), Santiago de Cuba (S2) and Guantanamo (G1)(Fig. 2). Intermediate levels of incidence (25e90%) were observedin some fields in the western region (Isla de la Juventud, Pinar delRio and Artemisia), and Camaguey in the central region. Extensivesurveys in Villa Clara plantations showed contrasting values ofMWP symptom incidence (Fig. 2). Fields in this province as V3 andV4 displayed 2.4% and 5.4% incidence levels, while V1, V2 and V5,near in around 5 km, exhibited almost 100% of symptomatic plants(99, 98 and 90.2%, respectively). In orchardswithmiddle incidenceswere found aggregated patterns of symptomatic plants, resemblingred islands spread in green fields. In contrast, in orchards with in-cidences higher than 90%, the pattern was reversed; insulatedgreen islands were observed in a predominately red background ofdiseased plants.

3.2. Detection of ampeloviruses and PBCOV infecting bromeliaceousplants in Cuba

Presence of ampeloviruses in pineapple plantations wasanalyzed in 110 plants showing MWP symptoms and representingthe 24 surveyed fields. Primer pairs 225/226, 223/224 and 263/264used in the analyses amplify fragments of 510, 610 and 490 pbfrom the heat shock protein 70 homolog open reading frame(hsp70h gene) of PMWaV-1, PMWaV-2 and PMWaV-3, respectively(Sether et al., 2005). Amplicons of expected sizes for at least one ofthe three PMWaVs were detected in 100 of the 110 analyzed plants(Table 1). Single infection by PMWaV-2 reached the highestdetection rate (41/110), and PMWaV-2 and PMWaV-3 were thespecies more frequently found in mixed infections (33/110)(Table 1). Taking into account single and mixed infection data,PMWaV-2 was the most prevalent ampelovirus (74/110). On theother hand, PBCOV DNA was detected in 39 of the 65 samplescollected from the three geographic regions of Cuba (Table 1,Fig. 3).

Analysis of RNA extracts from two B. pinguin plants collected inthe vicinity of pineapple plantations of Banes (Holguin, easternregion) showed the presence of PMWaV-2 (data not shown). Asimilar procedure was performed using RNA extracts from two

nd plants showing MWP symptoms ( ) determined in surveys in commercial pineappled I3), Pinar del Rio (P1, P2 and P3), Artemisia (Ar), Habana del Este (Hv), Matanzas (M1, Santiago de Cuba (S1 and S2) and Guantanamo (G1 and G2).

Fig. 2. Geographic distribution of the surveyed commercial pineapple fields in Cuba in 2012 (indicated by circles) and incidence of mealybug wilt of pineapple (MWP) symptomsregistered in any area. Levels of pineapple fruit production are indicated following the gray scale. Production data were obtained from the annual report available at Ministry ofAgriculture, Cuba (2012).

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e5046

A. ananassoides plants collected in Havana and Ciego de Avila, butnegative results were obtained.

3.3. Molecular characterization of the ampeloviruses

To further characterize the molecular diversity of the ampelo-viruses found in Cuba, the hsp70h and cp amplicons of eight isolateswere selected representing different pineapple cultivars;

Table 1Presence of Pineapple mealybug wilt-associated virus-1, -2 and -3 (PMWaV-1,PMWaV-2 and PMWaV-3), mixes of PMWaVs and Pineapple bacilliform comosusvirus (PBCOV) in commercial pineapple fields of Cuba, in the period 2009e2012.Simultaneous analysis of RT-PCR (PMWaVs) and Dot Blot (PBCOV) were applied toplants collected in Isla de la Juventud (I1, I2 and I3), Pinar del Rio (P1, P2 and P3),Artemisia (Ar), Habana del Este (Hv), Matanzas (M1 and M2), Villa Clara (V1eV5),Ciego de Avila (CA), Camagüey (C1, C2 and C3), Granma (Gr), Santiago de Cuba (S1and S2) and Guantanamo (G1 and G2). In black are indicated the major frequenciesof PMWaV detection.

Orchard Viral detection

PMWaV PBCOV

1 2 3 1 & 2 2& 3 1& 3 1, 2 & 3

I1 0/4* 2/4 1/4 0/4 1/4 0/4 0/4 3/4I2 0/4 2/4 1/4 0/4 1/4 0/4 0/4 2/4I3 0/6 2/6 1/6 0/6 1/6 0/6 0/6 ntP1 0/4 0/4 0/4 1/4 1/4 0/4 2/4 ntP2 1/7 2/7 1/7 0/7 0/7 1/7 1/7 3/4P3 0/6 3/6 0/6 0/6 1/6 0/6 1/6 ntAr 2/6 1/6 0/6 0/6 1/6 0/6 0/6 ntHv 1/5 2/5 0/5 0/5 1/5 0/5 1/5 1/3M1 0/4 1/4 0/4 1/4 1/4 0/4 1/4 ntM2 0/4 2/4 0/4 0/4 1/4 0/4 1/4 ntV1 1/4 2/4 0/4 0/4 0/4 0/4 1/4 1/3V2 0/4 1/4 1/4 0/4 0/4 1/4 1/4 2/4V3 0/4 1/4 0/4 0/4 0/4 1/4 1/4 1/2V4 1/4 2/4 0/4 1/4 0/4 0/4 0/4 3/4V5 0/6 1/6 0/6 0/6 1/6 1/6 2/6 2/3CA 1/6 2/6 1/6 0/6 1/6 0/6 0/6 3/6C1 0/4 3/4 1/4 0/4 0/4 0/4 0/4 2/4C2 0/4 2/4 0/4 0/4 2/4 0/4 0/4 2/2C3 0/2 2/2 0/2 0/2 0/2 0/2 0/2 ntGr 1/4 2/4 0/4 0/4 0/4 0/4 1/4 3/4S1 0/4 2/4 0/4 0/4 0/4 2/4 0/4 1/4S2 0/6 3/6 1/6 0/6 1/6 0/6 1/6 4/6G1 0/4 0/4 0/4 1/4 0/4 0/4 2/4 3/4G2 0/4 1/4 0/4 1/4 1/4 0/4 1/4 3/4Total 8/110 41/110 8/110 5/110 15/110 6/110 17/110 39/65

*The same four plants were submitted to all the RT-PCR analysis and Dot blothybridization.

bromeliaceous species and separated geographic zones werecloned and sequenced. Two hsp70h and cp genes sequences fromPMWaV-1 isolates collected in cv. MD2 from Ciego de Avila(PMWaV-1 MD2 CA) and cv. Red Spanish pineapple plants of Ha-vana (PMWaV-1 RS H) were deposited in the GenBank databasewith accession numbers (AN): HQ129930/JX645771 and JN995531/JN995532, respectively. Four PMWaV-2 isolates were partiallycharacterized from pineapples cv. Red Spanish of Havana (PMWaV-2 RS H) and Isla de la Juventud (PMWaV-2 RS IJ); cv. MD2 fromCiego de Avila (PMWaV-2 MD2 CA) and B. pinguin from Holguin(PMWaV-2 Bp HG) (AN: JX645772, FN825676, JX508637 andJX645773 for hsp70h and JN995534, JN995533, JX645775 andJN995535 for cp genes, respectively). Besides, two PMWaV-3 iso-lates were characterized from Isla de la Juventud, cv. Red Spanish(PMWaV-3 RS IJ) and Ciego de Avila, cv. MD2 (PMWaV-3 MD2 CA)(hsp70h and cp genes sequences AN: GU563497/JX508636 andJN995536/JX645774).

Comparisons among sequences obtained in this work and thosecognates from isolates found around theworld revealed high valuesof nucleotide identities (�97%) (Table 2). However, values corre-sponding to PMWaV-1 and PMWaV-2 were superior to thoseobserved for PMWaV-3 considering the two analyzed genes. Be-sides, best nucleotide identities were invariably observed amongsequences belonging to Cuban isolates (Table 2).

Phylogenetic analysis based on the partial hsp70h and completecp genes of PMWaV sequences grouped all PMWaV in an individualbranch separated from other members of the Closterovirus andCrinivirus genera (Fig. 4). Consistently, the ampelovirus branchsplits into two secondary branches, one grouping PMWaV-2 and

Fig. 3. Dot-blot hybridization for detection of PBCOV in samples collected from: A1,A2: Isla de la Juventud; A3, A4: Pinar del Rio; A5, A6: Habana del Este; A7, A8: VillaClara; A9, A10: Guantanamo; A11, B1: Santiago de Cuba; B2, B3: Ciego de Avila; B4, B5:Camaguey; C1: DNA extract from a pineapple plant infected with PBCOV, C2eC5: DNAextracts from pineapple plants obtained by in vitro meristem culture, C7eC11:decreasing amounts of a plasmid containing the reverse transcriptase/RNase H regionof PBCOV (150; 15; 1.5; 0.15; and 0.015 ng, respectively).

Table 2Percentages of nucleotide identity and deduced aminoacid similarity among sequences of Cuban isolates of PMWaV-1, -2 and -3 obtained in this work, and cognates sequencesfrom isolates of these species around the world. Hawaii-HW; Australia-AU; Thailand-TL; Taiwan-TW; Cuba, province Ciego de Avila, cultivar MD2- CA MD2; Cuba, province LaHabana, cv. Red Spanish- LH ER; Cuba, Isla de la Juventud, cv. Red Spanish-IJ ER; Cuba, province Holguin, especie Bromelia pinguin L.- HG Bp; Cuba, province Ciego de Avila, cv.Cayenne Smooth- CA CL.

Gene Virus Isolate TL TW HW MD2 CA RS H RS IJ Bp HG CS CA

Homolog heat shock protein fragmentc PMWaV-1 AU 99.2/98a 99.5/99.5 98.8/98 100/100 99.3/98 n/a n/a n/aTL e 99/98.5 98.3/96.9 99.2/98 98.5/95.9 n/a n/a n/aTW e e 98.6/98.5 99.5/99.5 98.8/97.4 n/a n/a n/aHW e e e 98.8/98 98.1/95.9 n/a n/a n/aMD2 CA e e e e 99.3/98 n/a n/a n/aAverage 98.99/98.01 (99.3/98)b

PMWaV-2 TL n/a 99.7/100 98.4/98 99.3/100 99/99 99.3/100 98.9/99.5 n/aTW n/a e 98.7/98 99.7/100 99.3/99 99.7/100 99.2/99.5 n/aHW n/a e e 99/98 98.7/97 98.4/98 98.5/97.5 n/aMD2 CA n/a e e e 99.7/99 99.3/100 99.5/99.5 n/aRS H n/a e e e e 99/99 99.2/98.5 n/aRS IJ n/a e e e e e 98.9/99.5 n/aAverage 99.11/99 (99.27/99.25)b

PMWaV-3 TW n/a n/a 97.4/98.8 97.2/98.8 97.4/100 n/a n/a n/aHW n/a n/a e 98.8/98.2 98.4/98.8 n/a n/a n/aMD2 CA n/a n/a e e 98/98.8 n/a n/a n/aAverage 97.82/98 (98/98.8)b

Coat protein ORFd PMWaV-1 TW n/a n/a 99/98.4 98.6/98.8 98.6/98.4 n/a n/a n/aHW n/a n/a e 98.7/99.6 98.7/99.2 n/a n/a n/aMD2 CA n/a n/a e e 99.7/99.6 n/a n/a n/aAverage 98,88/99 (99.7/99.6)b

PMWaV-2 TW n/a n/a 99/99.3 98.6/98 98.5/98.3 98.9/99 98.9/98.7 99.1/99.3HW n/a n/a e 98.9/98 98.8/98.3 99.2/99 99.2/98.7 99.4/99.3MD2 CA n/a n/a e e 99/99.7 99.2/98.3 99.2/98 99.4/98.7RS H n/a n/a e e e 99.3/99.3 99.1/98.3 99.3/99RS IJ n/a n/a e e e e 99.6/99 99.6/99.7Bp HG n/a n/a e e e e 99.6/99.3Average 99.13/98.82 (99.42/99.1)b

PMWaV-3 TW n/a n/a 99.1/98.1 97.6/97 97.3/97.7 n/a n/a n/aHW n/a n/a e 98.1/98.1 98.1/99.6 n/a n/a n/aMD2 CA n/a n/a e e 98.5/98.5 n/a n/a n/aAverage 98.12/98.17 (98.5/98.5)b

n/a: comparison not available for lacking of sequences. €e€: self-comparison.a Values are expressed as percentage of nucleotide identity/percentage of deduced amino acid similarity.b In parenthesis the average values are indicated as percentage of nucleotide identity/percentage of deduced amino acid similarity among Cuban isolates.c Fragments of 590 nt for PMWaV-1, 610 nt for PMWaV-2 and 490 nt for PMWaV-3.d Complete gene containing 774 nt for PMWaV-1, 909 nt for PMWaV-2 and 784 nt for PMWaV-3.

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e50 47

Grapevine leafroll associated virus -3, type member of the genus(GLRaV-3), and another onewhich was subdivided into two tertiarybranches separating PMWaV-1 of PMWaV-3 isolates. PMWaV-4and -5 grouped in the same secondary branch of the PMWaV-1and -3 group (Fig. 4A).

4. Discussion

Surveys in commercial pineapple fields during the period2009e2012 showed widespread MWP disease throughout Cuba.Symptoms incidence was variable and in some regions with largepineapple orchards the values were extremely high (i.e. Villa Claraorchards). Several of the MWP compromised orchards are locatedin important commercial producing areas as Villa Clara, localitieswere pineapple is the only economic resource. Clusters of symp-tomatic plants were sighted in fields with high incidence values, acommon pattern also observed for MWP disease elsewhere(Hughes and Samita, 1998; Sether et al., 2010).

It has been stated that several factors like traditional vegetativepropagation (Sether and Hu, 2002a), nutritional and climatic con-ditions (Singh and Sastry, 1974), low irrigation levels (Sether andHu, 2001), interactions with other pathogens (Sipes et al., 2002),and varietal tolerance to diseases (Rohrbach and Schmitt, 1994),could contribute to the dissemination and susceptibility to MWP.Indeed, a combination of the above-mentioned factors may beaffecting the pineapple orchards in Cuba. The majority of com-mercial fields are managed without irrigation and nutritional

supplements are scarcely available (Isidr�on et al., 2003). At thesame time, a program to produce pathogen-free propagation ma-terials does not exist and pineapple seeds are interchanged amonggrowers without any sanitary inspection.

Unsystematic studies previously conducted in Cuban pineapplefields to search for the presence of viruses detected single in-fections of PMWaV-2 (Ciego de Avila, Borroto et al., 2007), PMWaV-3 (Isla de la Juventud, Hernandez et al., 2010a, 2010b), and PBCOV inthe eastern region of Cuba (Hernandez-Rodriguez et al., 2013).Molecular assays undertaken in this work on a new representativeset of samples gathered in commercial areas of the threegeographic regions of Cuba revealed that (i) PMWaV-1, -2 and -3are widely spread throughout the country, (ii) almost half ofinfected plants were affected by mixed viral infections, (iii)PMWaV-2 is the most represented in both single and mixed in-fections and (iv) PBCOV is distributed in the western and centralregions of Cuba.

Since the MWP symptoms in Hawaii are associated with thepresence of PMWaV-2 (Sether and Hu, 2002a), the high MWPsymptom incidence observed in Cuban fields could be in agreementwith the higher detection frequencies for PMWaV-2. However, thisidea should be treated with caution since MWP symptoms inAustralia are correlated with the presence of PMWaV-1 andPMWaV-3 (Gambley et al., 2008a).

The negative impact on crop yields produced by single virusinfections could be potentiated by possible synergism among vi-ruses, simultaneous infection with other pathogens and/or impact

Fig. 4. Phylogenetic relationship of PMWaV-1, -2 and -3 with members of the family Closteroviridae using a fragment of 349 nt of the hsp70h gene (A) and the complete cp gene (B).Cuban isolates of these viruses are highlighted and the tertiary branches are enlarged to the right of any tree. Trees were constructed using the neighbor-joining method and valueson the branches represent the percentage of trees containing each cluster of 1000 bootstrap replicates.

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e5048

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e50 49

of abiotic stress. In Hawaii, interaction between PMWaV-1 andRotylenchus reniformis Lindford&Oliveira has been described as thecause of low yields (Sipes et al., 2002). In this regard, the phyto-sanitary status of the commercial fields in Cuba could be consideredas unsatisfactory. Besides the presence of at least three species ofthe PMWaV complex and a badnavirus revealed in our study, yieldlosses associated with several fungi (e.g. Fusarium subglutinans,Thielaviopsis paradoxa), the oomycete Phytophthora nicotianae, andnematodes (e.g. Meloidogyne sp., Rotylenchulus sp. and Heli-cotylenchus sp.) have been described in pineapple orchards of thecountry (Isidr�on et al., 2003; Hernandez Hernandez et al., 2006;Sisne et al., 2005).

Several species of the genera Ananas (A. ananassoides, Ananaserectifolius, Ananas bracteatus and A. bracteatus var. tricolor) andPseudoananus (P. sagenarius) have been recognized as hosts forPMWaV-1 and PMWaV-2 (Sether et al., 2001). Data obtained in thisstudy confirm that the bromeliaceous B. pinguin is a new naturalhost of PMWaV-2. Indeed, this fact may have an epidemiologicalimplication in Cuba considering that B. pinguin is commonly used inhedgerows in rural communities, and that the plant is also a hostfor mealybugs and ants, two components of theMWP pathosystem.

Mealybugs are considered insects with limited mobility,showing low potential to cross long distances inside a field(Beardsley et al., 1982). However, due to the mutualism theyestablish with ants, mealybugs can be actively transported by themduring the first instar (crawler) stage (Rohrbach et al., 1988).Consequently, ants could bear viruliferous mealybugs fromB. pinguin hedgerows to nearby pineapple plantations enhancingthe virus spread. Therefore, strategies to control MWP andPMWaVs need to prevent the use of B. pinguin as hedgerows sur-rounding pineapple orchards in Cuba.

The present work constitutes the first report of PMWaV-1 in theCaribbean basin. Since a value of 75% of identity between the aminoacid sequences of relevant gene products (i.e. CP, CPm, HSP70h) isconsidered the threshold for species demarcation in the genusAmpelovirus (Martelli et al., 2011), PMWaV-1 found in Cuba couldbe considered as an isolate of PMWaV-1 previously identified inAustralia. Sequence comparisons carried out in this work showednucleotide sequence identities above 99%. In agreement with this,phylogenetic trees based on both hsp70h and cp genes grouped theCuban and Australian PMWaV-1 isolates in the same branch.

Although lowgenetic variation among geographically-separatedisolates has been reported for tobamoviruses (Rodriguez-Cerezoet al., 1989; Fraile et al., 1996), criniviruses (Rubio et al., 2001a),the flexivirus CLBV (Vives et al., 2002) and the closterovirus CTV(Rubio et al., 2001b), it is well known that geographic barriers andhost passages are factors which could affect the composition ofviral populations (Ayll�on et al., 2006). The Isla de la Juventud is asmall territory located 100 km south of Havana, separated from themainland by a stretch of open sea. Low variability observed amongsequences of PMWaV-2 isolates from Isla de la Juventud and thosefrom the other localities, and even from different hosts, mightsuggest that a similar behavior occurs with members of theAmpelovirus genus. However, the low variability observed could bebiased by the intense exchange of propagation material amonggrowers.

Finally, the presence of an ampeloviruses complex and a bad-navirus in pineapple fields revealed in this work shows thevulnerability of this important fruit crop in Cuba. Results supportthe need to implement certification procedures for pineapplepropagation materials in order to reduce the economic impact ofMWP disease in the country. The diagnostic tools used in this workfor the detection of the viruses in infected pineapples will help inthe design and implementation of a seed certified productionsystem in Cuba.

Acknowledgments

This research was co-funded by a grant (C/5032-1) from theInternational Foundation for Science (IFS), Stockholm, Sweden, andthe national projects 0578 and 2004, financed by Grupo Empresa-rial Frutícola de Cuba, GEF.

References

Anonymous, 2012. Annual Bulletin of Ministry of Agriculture, Cuba.Awuah, R.T., Adzim, E., 2004. Etiological and epidemiological studies on the red leaf

disease of pineapple in Ghana. Afr. Crop Sci. J. 12 (2), 153e162.Ayll�on, M.A., Rubio, L., Sentandreu, V., Moya, A., Guerri, J., Moreno, P., 2006. Vari-

ations in two gene sequences of Citrus tristeza virus after host passage. VirusGenes 32, 119e128.

Beardsley Jr., J.W., Su, T.H., McEwen, F.L., Gerling, D., 1982. Field investigations onthe interrelationships of the big-headed ant, the gray mealybug, and pineapplewilt disease in Hawaii. Proc. Hawaii. Entomol. Soc. 24, 51e67.

Borroto, E.G., Cintra, M., Gonzalez, J., Borroto, C., Oramas, P., 1998. First report ofclosterovirus-like particle associated with pineapple plants (Ananas comosus cv.Smooth Cayenne) affected with pineapple mealybug wilt in Cuba. Plant Dis. 82,263.

Borroto, E.G., Torres, J.A., Laimer, M., 2007. RT-PCR detection and protein-proteininteraction of viral components of Pineapple mealybug wilt-associated virus-2in Cuba. J. Plant Pathol. 89 (3), 435e439.

Fraile, A., Malpica, J.M., Aranda, M.A., Rodriguez-Cerezo, E., Garcia-Arenal, F., 1996.Genetic diversity in Tobacco mild green mosaic tobamovirus infecting the wildplant Nicotiana glauca. Virology 223, 148e155.

Gambley, C.F., Geering, A.D.W., Steele, V., Thomas, J.E., 2008b. Identification of viraland non-viral reverse transcribing elements in pineapple (Ananas comosus),including two new badnavirus species. Arch. Virol. 153, 1599e1604.

Gambley, C.F., Steele, V., Geering, A.D.W., Thomas, J.E., 2008a. The genetic diversityof ampeloviruses in Australian pineapples and their association with mealybugwilt disease. Australas. Plant Pathol. 37, 95e105.

Gottwald, T.R., 1995. Survey strategies for CTV and BCA. In: Lee, R.F., et al. (Eds.),Proceedings of the Third International Workshop Citrus Tristeza Virus and theBrown Citrus Aphid in the Caribbean Basin: Management Strategies, May 1995,Florida, Lake Alfred, Florida, pp. 32e39.

Hernandez Hernandez, R., Vallín, G., Hernandez, D., 2006. Diagn�ostico de fitone-matodos en suelos de cultivos frutales. [Diagnosis of phytonematods in fruitcrops fields]. Fitosanidad 10 (4), 261e264.

Hernandez, L., Ramos, P.L., Rodríguez, M., Pe~na, I., Perez, J.M., 2010a. First report ofPineapple mealybug wilt associated virus-3 infecting pineapple in Cuba. New Dis.Rep. 22, 18.

Hernandez, L., Ramos, P.L., Rodríguez, M., Zamora, V., Pe~na, I., Perez, J.M., 2010b.Detecci�on de ampelovirus asociados a la enfermedad de la marchitez de la pi~na(Ananas comosus (L.) Merr.) en la Isla de la Juventud, Cuba. [Detection ofampeloviruses associated to the mealybug wilt of pineapple (Ananas comosus(L.) Merr.) disease in the Island of Youth, Cuba.]. CitriFrut 27 (1), 39e46.

Hernandez-Rodriguez, L., Ramos-Gonzalez, P.L., Garcia-Garcia, G., JaverHigginson, E., Zamora-Rodriguez, V., 2013. First report of Pineapple bacilliformcomosus virus (PBCOV) and endogenous pineapple pararetrovirus-1 (ePPRV-1)in pineapple plants in Cuba. New Dis. Rep. 28, 2.

Hughes, G., Samita, S., 1998. Analyses of patterns of pineapple mealybug wilt dis-ease in Sri Lanka. Plant Dis. 82, 885e890.

Isidr�on, M., Rosales, Y., Pifferrer, A., Cisneros, A., Benega, R., Carvajal, C., 2003.Caracterizaci�on del germoplasma de pi~na colectado en Cuba mediante pros-pecci�on nacional: I. Localizaci�on, diversidad gen�etica y situaci�on actual. [Char-acterization of the pineapple germplasm collected in Cuba through nationalprospection]. Cultiv. trop. 24 (1), 65e71.

Martelli, G.P., Agranovsky, A.A., Bar-Joseph, M., Boscia, D., Candresse, T.,Coutts, R.H.A., Dolja, V.V., Hu, J.S., Jelkmann, W., Karasev, A.V., Martin, R.R.,Minafra, A., Namba, S., Vetten, H.J., 2011. Family Closteroviridae. In: King, A.,Adams, M.J., Carstens, E.B., Lefkowitz, E. (Eds.), Virus Taxonomy. Ninth Report ofthe International Committee on Taxonomy of Viruses. Elsevier-Academic Press,Amsterdam, Netherlands, pp. 987e1001.

Murray, M.G., Thompson, W.F., 1980. Rapid isolation of high molecular weight plantDNA. Nucleic Acids Res. 8, 4321e4325.

Rodriguez-Cerezo, E., Moya, A., Garcia-Arenal, F., 1989. Variability and evolution ofthe plant RNA virus Pepper mild mottle virus. J. Virol. 63, 2198e2203.

Rohrbach, K., Schmitt, D.P., 1994. Pineapple. In: Ploetz, R.C., Zentmyer, G.A.,Nishiyima, W.T., Rohrbach, K.G. (Eds.), Comendium of Tropical Fruit Diseases.APS Press, Michigan, St. Paul, pp. 45e55.

Rohrbach, K.G., Beardsley, J.W., German, T.L., Reimer, N.J., Sanford, W.G., 1988.Mealybug wilt, mealybugs, and ants on pineapple. Plant Dis. 72, 558e565.

Rubio, L., Abou-Jawdah, Y., Lin, H.X., Falk, B.W., 2001a. Geographically distant iso-lates of the crinivirus Cucurbit yellow stunting disorder virus show very lowgenetic diversity in the coat protein gene. J. Gen. Virol. 82, 929e933.

Rubio, L., Ayll�on, M.A., Kong, P., Fern�andez, A., Polek, M., Guerri, J., Moreno, P.,Falk, B.W., 2001b. Genetic variation of Citrus tristeza virus isolates from Cali-fornia and Spain: evidence for mixed infections and recombination. J. Virol. 75,8054e8062.

L. Hernandez-Rodriguez et al. / Crop Protection 65 (2014) 43e5050

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for recon-structing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406e425.

Sambrook, J., Fitsch, E.F., Maniatis, T., 1989. . Molecular Cloning: a LaboratoryManual. Cold Spring Harbor Press, Cold Spring Harbor.

Sether, D.M., Melzer, M.J., Borth, W.B., Hu, J.S., 2012. Pineapple bacilliform CO virus:diversity, detection, distribution, and transmission. Plant Dis. 96 (12),1798e1804.

Sether, D.M., Borth, W.B., Melzer, M.J., Hu, J.S., 2010. Spatial and temporal incidencesof Pineapple mealybug wilt-associated viruses in pineapple planting blocks. PlantDis. 94 (2), 196e200.

Sether, D.M., Hu, J.S., 2001. The impact of Pineapple mealybug wilt-associated vi-rus-1 and reduced irrigation on pineapple yield. Australas. Plant Pathol. 30,31e36.

Sether, D.M., Hu, J.S., 2002a. Closterovirus infection and mealybug exposure arenecessary for the development of mealybug wilt of pineapple disease. Phyto-pathology 92, 928e935.

Sether, D.M., Hu, J.S., 2002b. Yield impact and spread of Pineapple mealybug wiltassociated virus-2 and mealybug wilt of pineapple in Hawaii. Plant Dis. 86,867e874.

Sether, D.M., Hu, J.S., Ullman, D.E., 1998. Transmission of Pineapple mealybug wiltassociated virus by two species of mealybugs (Dysmicoccus spp.). Phytopa-thology 88, 1224e1230.

Sether, D.M., Karasev, A.V., Okumura, C., Arakawa, C., Zee, F., Kislan, M.M., Busto, J.L.,Hu, J.S., 2001. Differentiation, distribution, and elimination of two different

Pineapple mealybug wilt associated viruses found in pineapple. Plant Dis. 85,856e864.

Sether, D.M., Melzer, M.J., Borth, W.B., Hu, J.S., 2009. Genome organizationand phylogenetic relationship of Pineapple mealybug wilt associatedvirus-3 and other family Closteroviridae members. Virus Genes 38,414e420.

Sether, D.M., Melzer, M.J., Busto, J., Zee, F., Hu, J.S., 2005. Diversity and mealybugtransmissibility of ampeloviruses in pineapple. Plant Dis. 89, 450e456.

Singh, S.J., Sastry, K.S.M., 1974. Wilt of pineapple: a new virus disease in India. In-dian Phytopathol. 27, 298e303.

Sipes, B.S., Sether, D.M., Hu, J.S., 2002. Interactions between Rotylenchus reniformisand Pineapple mealybug wilt associated virus-1 in pineapple. Plant Dis. 86,933e938.

Sisne, L.M., Rodríguez Jim�enez, V.M., Grillo Ravelo, H., 2005. List of principal scar-abaeidae family's genus present in the pineapple plantation in Cuba. Acta Hort.(ISHS) 666, 237e240.

Vives, M.C., Rubio, L., Galipienso, L., Navarro, L., Moreno, P., Guerri, J., 2002. Lowgenetic variation between isolates of Citrus leaf blotch virus from different hostspecies and of different geographical origins. J. Gen. Virol. 83, 2587e2591.

Wu, L., Ruan, X., Shen, W., Tan, Y., Zhai, G., Li, H., 2010. Sequencing and analysis ofthe complete genomic sequence of Pineapple bacilliform comosus virus. Sci.Agric. Sin. doi: CNKI: SUN:ZNYK.0.2010-09-027.