Download - Identification of the efflux transporter of the fluoroquinolone antibiotic

Marquez et al.,Ciprofloxacin efflux transporter in macrophages -- of 34

docMarquez_et_al_ciprofloxacin_efflux_transporter_05_03_09_changes_highlighted.doc Last saved by Françoise Van Bambeke - 05/03/2009 - 04:29:15

Identification of the efflux transporter of the fluoroquinolone antibiotic 1

ciprofloxacin in murine macrophages: studies with ciprofloxacin-resistant cells. 2

3

Béatrice Marquez, Nancy E. Caceres,# Marie-Paule Mingeot-Leclercq, Paul M. Tulkens, 4

and Françoise Van Bambeke. 5

6

Unité de Pharmacologie cellulaire et moléculaire, Louvain Drug Research Institute, 7

Université catholique de Louvain, B-1200 Brussels, Belgium 8

# current affiliation : Ludwig Institute for Cancer Research, Signal Transduction Unit, B-1200 9

Brussels, Belgium 10

11

Running title: Ciprofloxacin efflux transporter in macrophages 12

13

Corresponding author: 14

Françoise Van Bambeke 15 Unité de Pharmacologie cellulaire et moléculaire, 16 UCL 7370 Avenue Mounier 73, 17 B-1200 Brussels, Belgium. 18 Phone: +32-2-764-73-78 19 Fax: +32-2-764-73-73 20 Email: [email protected] 21 22

23

Abstract word count: 214 24

Text word count: 3604 25

Number of tables :1 26

Number of figures : 6 27

Number of References: 42 28

29

Non standard abbreviations 30

Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Antimicrob. Agents Chemother. doi:10.1128/AAC.01428-08 AAC Accepts, published online ahead of print on 23 March 2009

on April 9, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



ABC, ATP-binding-cassette; BCRP, breast cancer resistance protein; MDR, multidrug 31

resistance; MRP, multidrug resistance-associated protein (Mrp refers specifically to 32

mouse transporters); PBS, phosphate buffered saline; siRNA, small interfering RNA 33


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Abstract 34

Ciprofloxacin, the most widely used totally synthetic antibiotic, is subject to active efflux 35

mediated by a MRP-like transporter in wild-type murine J774 macrophages. To identify 36

the transporter among the seven potential Mrps, we used cells made resistant to 37

ciprofloxacin obtained by long-term exposure to increasing drug concentrations (these 38

cells show a lower ciprofloxacin accumulation, and provide a protected niche for 39

ciprofloxacin-sensitive intracellular Listeria monocytogenes). In the present paper, we 40

first show that ciprofloxacin-resistant cells display a faster efflux of ciprofloxacin, which is 41

inhibited by gemfibrozil (an unspecific MRP inhibitor). Elacridar, at a concentration 42

known to inhibit P-glycoprotein and BCRP, only slightly increased ciprofloxacin 43

accumulation with no difference between resistant and wild-type cells. Analysis at the 44

mRNA (real-time PCR) and protein (Western blot) levels revealed an overexpression of 45

Mrp2 and Mrp4. Mrp4 transcripts, however, were overwhelmingly predominant (45 [wild-46

type cells] to 95 % [ciprofloxacin-resistant cells] of all Mrp's transcripts tested [Mrp1 to 47

Mrp7]). Silencing experiments of Mrp2 and Mrp4 with specific siRNAs showed that only 48

Mrp4 is involved in ciprofloxacin transport in both ciprofloxacin-resistant and wild-type 49

cells. The study, therefore, identifies Mrp4 as the most likely transporter of ciprofloxacin 50

in murine macrophages, but leaves open a possible common upregulation mechanism 51

for both Mrp4 and Mrp2 upon chronic exposure of eucaryotic cells to this widely used 52

antibiotic. 53


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Fluoroquinolones are substrates of several procaryotic and eucaryotic efflux 54

transporters (4,38). Efflux from bacteria is now recognized as a significant mechanism 55

of resistance to fluoroquinolones and a potential cause of therapeutic failures (15). In 56

eukaryotic cells, it is considered as an important factor determining their 57

pharmacokinetics, including tissue accumulation (39). Concentrating on ciprofloxacin 58

and murine J774 macrophages, we and others noted the presence of a MRP-like efflux 59

transporter for this antibiotic (8,26). MRP proteins belong to the large C subfamily of 60

ABC (ATP-binding-cassette) transporters, among which at least 8 (MRP1-MRP6 61

[ABCC1-ABCC6] and MRP7-MRP8 [ABCC10-ABCC11]) are able to transport organic 62

anions (11). To further identify the ciprofloxacin transporter among the different MRP 63

candidates, we undertook to obtain J774 macrophages resistant to concentrations of 64

ciprofloxacin causing toxicity to wild-type cells. This was achieved by long-term culture 65

in the presence of progressively increasing drug concentrations, a procedure 66

successfully used to select cells with efflux-mediated resistance to anticancer agents 67

([12]; while fluoroquinolones act as antibiotics by impairing bacterial topoisomerases at 68

low concentrations, they inhibit the eucaryotic topoisomerases II and kill mammalian 69

cells at large concentrations). The phenotype of these cells has been described in a 70

previous publication (25). They display a markedly reduced accumulation of 71

ciprofloxacin, which could be brought almost to control levels by ATP-depletion or 72

addition of typical inhibitors of MRP efflux transporters such as probenecid or MK571. 73

Additional studies comparing other quinolones in both wild-type and ciprofloxacin-74

resistant cells showed that moxifloxacin was not affected by this efflux transporter in both 75

cell types while levofloxacin and garenoxacin showed an intermediate behavior (24,25). 76

Beyond displaying a markedly reduced accumulation of ciprofloxacin, these 77


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



ciprofloxacin-resistant cells provide a protected environment against ciprofloxacin for 78

L. monocytogenes (25). Moreover, we recently showed that this eucaryotic transporter 79

can cooperate with a procaryotic ciprofloxacin transporter to make intracellular 80

L. monocytogenes still more resistant to the drug (21). In the present study, we now 81

identify the ciprofloxacin efflux transporter as being most likely Mrp4. 82


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



MATERIALS AND METHODS 83

84

Materials. All cell culture reagents were purchased from Invitrogen (Carlsbad, 85

CA). Ciprofloxacin (98% purity) was kindly provided by Bayer HealthCare A.G., 86

Leverkusen, Germany. Elacridar (GF120918) was the generous gift of GlaxoWellcome 87

Research and Development (Laboratoire Glaxo Wellcome, Les Ulis, France). 88

Gemfibrozil and all other chemicals were from Sigma-Aldrich (St. Louis, MO). 89

Cell lines and culture conditions. J774 mouse macrophage-like cells were 90

cultured and maintained as already described (26). J774 macrophages resistant to 91

ciprofloxacin and their revertants were obtained as described earlier (25). In brief, 92

selection of resistant cells was obtained by cultivating wild-type cells for about 50 93

passages (approx. 8 months) in the presence of increasing concentrations of 94

ciprofloxacin large enough to induced a selective pressure (from 0.1 mM to 0.2 mM, i.e. 95

34 to 68 mg/L) and far above serum levels reached in treated patients (human Cmax are 96

2.4 to 4 mg/L for oral doses of 500 to 750 mg [2]). Cells were then maintained in the 97

presence of 0.2 mM ciprofloxacin and used between the 60th and the 80th passage. 98

Revertants were obtained by returning resistant cells to ciprofloxacin-free medium for 90 99

passages (about 9 months), and used between the 100th and the 110th passage. 100

Accumulation and efflux of ciprofloxacin in J774 macrophages. We followed 101

the procedures described in our previous publications (25,26) for fluorometric assay of 102

ciprofloxacin (λexc = 275 nm and λem = 450 nm; limit of detection: 5 ng/mL or ~ 15 nM), 103

with appropriate controls to exclude interference by gemfibrozil and elacridar. For 104

studies with ciprofloxacin-resistant cells, which were cultivated in the continuing 105

presence of ciprofloxacin, cells were rinsed twice in PBS prior to the start of the 106


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



experiment to avoid contaminating cell extracts with extracellular drug. All experiments 107

were performed using a ciprofloxacin extracellular concentration of 50 µM (17 mg/L), 108

which, although supratherapeutic, was needed to ensure reliable assays in ciprofloxacin-109

resistant cells (see [24,26] for further details on dose-effects relationships of 110

ciprofloxacin accumulation in wild-type and ciprofloxacin-resistant cells). The cell 111

ciprofloxacin content of each sample was expressed by reference to its total protein 112

content measured by the Lowry's method. 113

Isolation of RNA and synthesis of cDNA. Total RNA was isolated from J774 cell 114

monolayers using TRIzol® reagent (Invitrogen) according to the manufacturer’s 115

instructions. Total RNA was purified with TURBO free-DNA® (Ambion, Austin, TX) and 116

concentration was measured with the Qubit® fluorimeter using the Quant-iT® RNA 117

Assay Kit (Invitrogen). cDNA was synthesized using 1 µg of total purified RNA and 118

random hexamer primers (Promega Reverse-Transcription System, Promega Co, 119

Madison, WI). 120

Real time PCR. Primer pairs for all Mrp (also referred to as Abcc) genes 121

investigated were designed using Primer 3 and Autoprime programs (41), taking into 122

account exon-intron boundaries to prevent genomic DNA amplification. The specificity of 123

each pair of primers (Table 1) was first checked in silico and then assessed in PCR 124

experiments where a single band at the expected size was obtained. Housekeeping 125

genes (Ywhaz [phospholipase A2] and Rpl13a [ribosomal protein L13a]) were selected 126

among 12 potential candidates from the mouse geNorm normalization kit (PrimerDesign 127

Ltd, Southampton, UK) using the GeNorm software (40). Real-time PCR experiments 128

were performed with a iCyclerTM iQ Multicolor Real-Time PCR Detection System 129

(BioRad, Hercules, CA) using SYBR Green SuperMix (BioRad) (see Table 1 for 130


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



amplification protocol details). Standard curves for each gene were generated by using 131

serially diluted solutions of purified PCR products. Melting curves were obtained to 132

confirm the specificity of each product in each sample. Results were analyzed using the 133

iCyclerTM iQ software (version 3.1, BioRad), and relative quantification of each Mrp gene 134

in resistant or revertant cells versus in wild-type cells was made in comparison with the 135

two selected housekeeping genes, based on the Pfaffl’s equation (30). 136

Cell crude extracts and membrane preparation. Monolayers from culture 137

dishes were rinsed, scraped and cells washed twice in ice-cold PBS. For stripped-138

membrane preparations, cells were resuspended in 10 mM Tris-HCl, pH 7.4 plus one 139

tablet of protease-inhibitor cocktail (Complete Mini EDTA free, F. Hoffmann-La Roche 140

Ltd Diagnostics Division, Basel, Switzerland) per 10 mL of buffer and homogenized with 141

a Dounce B homogenizer (glass/glass, tight pestle, 25 strokes). The homogenates were 142

layered on top of 50 % (w/v, 1.5 M) sucrose solution plus 1 mM phenylmethanesulphonyl 143

fluoride and centrifuged in a Beckman SW40 rotor at 280.000 x g for 1 h at 4°C. The 144

crude membrane fraction isolated from the interphase buoyant-sucrose was diluted to 145

8 mL with cold 100 mM Na2CO3, pH 11.0 and loaded on top of a fresh cushion and 146

ultracentrifuged in the same conditions as previously. Alkaline-stripped membranes 147

were washed in 10 mM Tris-HCl, pH 7.4 plus protease-inhibitor-cocktail and centrifuged 148

in a Type 50 Ti rotor at 100,000 x g for 20 min at 4°C. Membrane pellets were flash-149

frozen and stored at -80 °C for protein solubilization and quantification. Proteins 150

samples were solubilized in 7 M urea and quantified using the bicinchoninic acid protein 151

assay (Pierce, Rockford, IL). 152

Western Blot Analysis. Membrane fractions or whole cell extracts were loaded 153

on acrylamide gels, without boiling (to avoid altering membrane proteins mobility). After 154


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



electrophoresis, proteins were electro-transferred onto nitrocellulose membrane (0.45 155

µm, Bio-Rad) and blocked overnight at 4 °C with 5 % milk in Tris-buffered saline (20 mM 156

Tris-HCl, 500 mM NaCl pH 7.5) containing 0.05 % Tween-20. Membranes were 157

exposed to anti-MRP2 monoclonal antibody (M2III-5; 250 µg/mL; Alexis Biochemicals, 158

Lausen, Switzerland), anti-MRP4 monoclonal antibody (M4I-10; 150 µg/mL; Alexis 159

Biochemicals), or anti-actin polyclonal antibodies (Sigma-Aldrich) followed by 160

appropriate horseradish peroxidase-coupled secondary antibodies (see figure captions 161

for dilutions). Blots were then revealed by chemiluminescence assay (SuperSignal West 162

Pico, Pierce). 163

Confocal microscopy. Mrp2 and Mrp4 in wild-type and ciprofloxacin-resistant 164

macrophages were detected on cells seeded at a low density, fixed with 0.8% 165

formaldehyde in acetone and permeabilized with saponin, as previously described (26), 166

using a polyclonal anti-mouse Mrp2 antibody (37; dilution 1:60) and anti-Mrp4 antibody 167

(M4I-10; dilution 1:20) and appropriate fluorescein isothiocyanate- or Texas Red-labeled 168

secondary antibodies (Sigma-Aldrich; dilution 1:300; Santa Cruz Biotechnology, Santa 169

Cruz, CA; dilution 1:80; Unité d'immunologie expérimentale, Université catholique de 170

Louvain, Brussels, Belgium, dilution 1:80). Actin was stained with tetramethylrhodamine-171

labeled phalloidin (5 units/mL; Invitrogen). Observations were made with a MRC1024 172

confocal scanning equipment (Bio-Rad, Richmond, CA) mounted on a Zeiss Axiovert 173

confocal microscope (Zeiss, Oberkochen, Germany), using λexc = 495 and λem = 519 nm 174

for fluorescein (green signal), and λexc = 578 nm and λem = 603 nm for Texas Red and 175

tetramethylrhodamine (red signal). 176

177


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Silencing of Mrp2 and Mrp4 genes. Ciprofloxacin-resistant J774 macrophages 178

were subjected to transient silencing experiments with two specific siRNA targeting 179

either Mrp2 or Mrp4 (Silencer® Pre-designed siRNA, Ambion; Mrp2, siRNA #71770 with 180

antisense sequence UGAUGUUACAAGUAAUCCCtt [targeting exon 28], and siRNA 181

#161716 with antisense sequence UCUCCAAUCGUGUACUGCCtc [targeting exon 10]; 182

Mrp4, siRNA #284555 with antisense sequence CAGAAUCUUGGAAAUCUCCtt 183

[targeting exon 8] and siRNA #284556 with antisense sequence 184

ACUGUUAAGGCACAAAACCtg [targeting exon 31]). siRNA Negative Control # 1 185

(Ambion), the sequence of which does not target any endogenous transcript, was used 186

as a negative control. siRNAs diluted into OPTI-MEM® I Reduced Serum Medium 187

(Invitrogen) were mixed with INTERFERinTM (Polyplus Transfection, Illkirch, France) and 188

incubated for 10 min at room temperature to allow siRNA-liposome complexes to form. 189

Then 0.2 mL of the siRNA-liposome mixture was added to 6-wells culture dishes seeded 190

the day before at a density of 3x105 cells/well and containing fresh RPMI medium 191

(2 mL). Plates were rocked gently and incubated for 24h at 37°C in a 5 % CO2 – 95 % 192

air atmosphere. After 24h, the medium was removed and replaced by fresh RPMI 193

medium and the incubation was continued for 24 h, at which time Mrp2 and Mrp4 levels 194

were measured by real-time PCR, the corresponding protein contents assessed by 195

Western Blot analysis, and cells used to measure ciprofloxacin accumulation (as 196

described above). 197

Curve fittings and statistical analysis. Curve fitting analyses and calculations of 198

regression parameters were made with GraphPad Prism version 4.03 for Windows, 199

and statistical analysis with GraphPad Instat ® version 3.06 for Windows (GraphPad 200

Prism Software, San Diego, CA). 201


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



RESULTS 202

Effects of efflux pumps inhibitors (gemfibrozil, elacridar) on ciprofloxacin 203

accumulation and efflux. In a first series of experiments, we characterized the 204

phenotype of the ciprofloxacin-resistant J774 macrophages versus that of wild-type J774 205

macrophages with respect to ciprofloxacin accumulation and efflux in the presence and 206

absence of gemfibrozil, a well-known inhibitor of MRP efflux transporters shown 207

previously to modulate the accumulation and intracellular activity of ciprofloxacin in wild-208

type J774 macrophages (26,33). Figure 1 (upper panel) shows that gemfibrozil 209

increased the accumulation of ciprofloxacin (2 h incubation, 50 µM; 17 mg/L) on a 210

concentration-dependent fashion for both cell types, reaching eventually a similar value 211

at a large concentration (1 mM) but with an about 6-fold lower potency (reflected by a 212

commensurate difference in EC50) towards ciprofloxacin-resistant vs. wild-type cells. 213

Figure 1 (lower panels) shows that the efflux of ciprofloxacin from cells pre-loaded with 214

the antibiotic (after transfer to a ciprofloxacin-free medium) was much faster in 215

ciprofloxacin-resistant compared to wild-type cells in the absence of gemfibrozil (half-216

lives of 0.09 vs. 1.75 min; lower left panel). Both cell types, however, released 217

ciprofloxacin at similar, slower rate (half-lives of 4.39 and 4.35 min; lower right panel) in 218

the presence of gemfibrozil (used at a concentration of 1 mM to obtain maximal effect on 219

both cell types [see upper panel]). 220

We also examined the influence of elacridar, a well known inhibitor of two ABC 221

transporters involved in drug efflux, namely P-glycoprotein (also referred to as MDR1 or 222

ABCB1) at low concentration and of BCRP (Breast Cancer Related Protein, also referred 223

to as ABCG2) at large concentration (10). At 1 µM, no significant effect on ciprofloxacin 224

accumulation was noted, whereas at 10 µM (a concentration known to inhibit mouse 225


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Bcrp1 [18]), an increase of accumulation of 47 ± 14 % in wild type cells and of 48 ± 18 % 226

in ciprofloxacin-resistant cells was observed, indicating that the intervention of Bcrp1 227

could be minor and did not contribute to the resistance phenotype. 228

Measurement of Mrps mRNA expression. In a next step, we examined in wild-229

type, ciprofloxacin-resistant, and revertant cells the expression of the mRNAs 230

corresponding to the 7 Mrps described in the mouse and with demonstrated transport 231

activities, namely Mrp1 to 6 (encoded by Abcc1 to Abcc6), and Mrp7 (encoded by 232

Abcc10). Figure 2 (upper panel) shows that there was marked (20- to 30-fold) 233

overexpression of both Mrp2 and Mrp4 in ciprofloxacin-resistant cells compared to wild-234

type cells, with a return to much lower levels for Mrp2 and to control values for Mrp4 in 235

revertant cells. Expression of the other Mrps was not significantly or only very modestly 236

modified in ciprofloxacin-resistant cells as well as in their revertants. If data is expressed 237

as abundance of each transcript relative to the total amount of Mrp transcripts (Figure 2, 238

lower panel), it clearly appears that Mrp4 (i) accounted for about 45 % of this total in 239

wild-type cells; (ii) increased to 95 % in ciprofloxacin-resistant cells; and (iii) decreased 240

to 56 % in revertant cells. Of interest, Mrp2 expression level was only 0.08 % of total 241

Mrp transcripts in wild-type cells, so that its 20-fold increase in ciprofloxacin-resistant 242

cells still corresponded to a very minor amount (0.34 %) of the mRNA coding for Mrps. 243

Detection of Mrp4 and Mrp2 by Western Blot analysis. Whole cell lysate 244

analysis for Mrp4 (Figure 3 upper part) showed a markedly increased amount of the 245

protein in ciprofloxacin-resistant cells compared to wild-type, and, in revertant cells, a 246

considerable decrease of the signal which, however, remained somewhat more marked 247

than in wild type cells. The analysis was then repeated using enriched membrane 248

protein samples for both Mrp2 and Mrp4 (Figure 3 lower part), showing an increase in 249


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



the signal of both proteins in resistant cells, together with a marked reduction in revertant 250

cells. The subcellular localization of Mrp2 and of Mrp4 was then examined by confocal 251

laser-scanning microscopy (using anti-Mrp2 and anti-Mrp4 antibodies and appropriate 252

fluorescein-labeled secondary antibodies) in comparison with actin (detected with 253

rhodamine-labeled phalloidin; allowing us to visualize the cell cytoskeleton and to 254

determine the cell shape). Figure 4 shows for both Mrp2 and Mrp4 (i) only a faint 255

staining in wild-type cells; (ii) a much more clearly visible signal in ciprofloxacin-resistant 256

cells, with a localization at the cell periphery. The two proteins, however, co-localized 257

only partially. 258

Gene silencing experiments. To directly assess the respective involvement of 259

Mrp2 and Mrp4 in ciprofloxacin transport in ciprofloxacin-resistant cells, we performed 260

transient gene silencing experiments using small interfering RNAs (siRNAs). Two 261

specific siRNA targeting different exons were selected for each gene, and their influence 262

examined in comparison with (i) ciprofloxacin-resistant cells transfected with non-263

targeting siRNA (1); (ii) untreated ciprofloxacin-resistant cells, and (iii) wild-type cells. 264

Figure 5 shows that the two siRNA targeting Mrp4 caused (i) a marked reduction of the 265

Mrp4 mRNA (which, however, still remained more abundant than in wild-type cells); (ii) a 266

concomitant reduction of the Mrp4 cell content as detected by Western blot analysis of 267

whole cell extracts; (iii) an increase in the ciprofloxacin accumulation which, for siRNA 268

284556, was about 4-fold larger compared to untreated ciprofloxacin-resistant cells and 269

reached values about half of what was observed for wild-type cells. Transfecting wild-270

type cells with the same siRNAs caused a decrease of the cell Mrp4 mRNA content of 271

40 to 60 %, accompanied by an increase of the cell accumulation of ciprofloxacin of 272

about 1.5-fold (data not shown). These experiments were then repeated with siRNAs 273


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



targeting Mrp2. As shown in Figure 6, there was a decrease in the cell content in Mrp2 274

(as detected by Western blot analysis) in cells transfected with both siRNA targeting 275

Mrp2, but no significant change in the accumulation of ciprofloxacin by these cells. 276


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



DISCUSSION 277

The present study significantly extends our knowledge of the transport of 278

ciprofloxacin in macrophages by identifying Mrp4 as its main if not exclusive efflux 279

transporter in J774 cells. This identification stems from three convergent, mutually 280

supportive pieces of evidence obtained from studies performed with ciprofloxacin-281

resistant cells in comparison with their wild type and revertant counterparts. 282

First, we show that the ciprofloxacin resistance phenotype is associated with a 283

decreased accumulation of ciprofloxacin together with a faster drug efflux that can be 284

impaired by addition of large concentrations of gemfibrozil, a non-specific inhibitor of 285

anion transporters (33). Gemfibrozil was shown previously to increase ciprofloxacin 286

accumulation and activity in macrophages (25,26,33), and its maximal effect on 287

ciprofloxacin accumulation is similar to that of MK-571, an specific inhibitor of MRP, in 288

both wild-type and ciprofloxacin-resistant macrophages (25,26). The use of elacridar as 289

inhibitor shows also a minor basal role of Bcrp1, similar in wild-type and resistant cells: 290

Bcrp1 cannot account for the resistance phenotype of our cells towards ciprofloxacin 291

(BCRP has been described as a transporter of ciprofloxacin in polarized cells [23] but 292

ongoing studies on ABC transporters expression determined by TaqMan low-density 293

array [TLDA] showed no difference in the expression level of Bcrp1 mRNA in 294

ciprofloxacin-resistant J774 macrophages as compared to wild-type cells [E. Jacquet; 295

personal communication]). 296

Second, we demonstrate that while both Mrp2 and Mrp4 are overexpressed in 297

ciprofloxacin-resistant cells, Mrp4 is overwhelmingly predominant not only in wild-type 298

but most conspicuously in ciprofloxacin-resistant cells. Conversely, we were able to rule 299

out an overexpression of all 5 other Mrps examined, including Mrp1 (overexpressed in 300


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



probenecid-resistant macrophages (26); while probenecid is an inhibitor of ciprofloxacin 301

efflux in macrophages (8), we showed previously that probenecid-resistant cells do not 302

exhibit an increased efflux of ciprofloxacin (26)). Mrp8 and Mrp9 were not examined, 303

because no homologue of human MRP8 (encoded by ABCC11) has been identified in 304

the mouse (36), and Mrp9 (encoded by Abcc12) is restricted to the testis and unable to 305

transport any known MRP substrate (29). 306

Third, we show that transfection of ciprofloxacin-resistant cells with Mrp4-specific 307

siRNAs results in an increase in the accumulation of ciprofloxacin (in parallel with a 308

decrease in the amount of Mrp4 mRNA transcripts and of the corresponding protein), 309

while Mrp2-specific siRNAs decrease the expression of Mrp2 but do not modify 310

ciprofloxacin accumulation. This may reflect the fact that the expression of Mrp2 is too 311

low even in ciprofloxacin-resistant cells to affect ciprofloxacin accumulation, or that 312

ciprofloxacin is not substrate for Mrp2. siRNAs have already been used to reverse 313

multidrug resistance in human cancer cell lines due to overexpression of P-glycoprotein 314

(20), MRP1 (13), MRP2 (22), MRP4 (32), or BCRP (31). The incomplete decreased 315

expression observed here (about 70 %) is in line to what is commonly observed with this 316

type of approach for other transporters (13,22,42) and could be accounted for by the 317

very large amount of protein present (42) and/or its long half-life (as is the case for other 318

transporters such as P-glycoprotein [27], MRP1 [3] or MRP2 [17]), as well as the short 319

half-life of the siRNAs. 320

While the available evidence favors Mrp4 as the only effective transporter of 321

ciprofloxacin in the cells we studied, we have to explain why ciprofloxacin-resistant cells 322

also overexpress Mrp2. This probably results from the method used to select 323

ciprofloxacin-resistant cells (namely long-term culture at progressively increasing 324


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



ciprofloxacin concentrations), which is prone to select for multiple mechanisms of 325

resistance (12). Several examples document indeed the concomitant overexpression of 326

different efflux transporters in drugs resistant cell lines (P-glycoprotein and MRP1 in 327

doxorubicin- or vincristine-resistant cells [6,9]; MRP1 and MRP2 in cisplatin-resistant 328

cells [28]; or P-glycoprotein and MRP2 in colchicine-resistant cells [5]). Yet, this 329

overexpression of Mrp2 is most likely unrelated to ciprofloxacin efflux as it remains 330

slightly elevated in revertant cells (vs. wild-type cells) when ciprofloxacin accumulation 331

and Mrp4 expression have both returned to control values. Further studies will need to 332

examine whether the overexpression of Mrp2 and Mrp4 seen here is coincidental or 333

results from changes at the level of a common regulator, which molecular mechanisms 334

are involved in this overexpression, and the conditions that may trigger this 335

overexpression in pharmacologically-pertinent situations. At this stage, we can probably 336

rule out for instance that infecting macrophages by L. monocytogenes or by S. aureus 337

could affect Mrp4 expression, as the cellular concentration of ciprofloxacin is similar in 338

non-infected or infected cells (35). 339

The pharmacological and biological significance of our observations needs also 340

being underscored. MRP4 is indeed able to transport a large variety of molecules 341

involved in cell signaling and of metabolic importance (see [7,34] and references cited 342

therein), such as prostaglandins E1 and E2, leukotrienes, cyclic nucleotides. MRP4 also 343

transports a large array of important drugs, including methotrexate and topotecan, 344

mercaptopurine metabolites, non-steroidal anti-inflammatory agents, cephalosporins, 345

and the antiviral drug adefovir ([phosphonylmethoxyethyl]adenine). While the transport 346

of these molecules by Mrp4 in macrophages remains to be demonstrated, we may 347

nevertheless draw attention to what may become important but unanticipated drug 348


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



interactions (as suggested by an ongoing work demonstrating a competition between 349

ciprofloxacin and non-steroidal anti-inflammatory agents for efflux in macrophages; [14]). 350

In this context, it is important to note that a MRP4 transcript is detected in human 351

macrophages (19), but also in blood cells or in hepatocytes, enterocytes, kidney 352

proximal cells, brain capillaries endothelial cells and cells from the choroids plexus, 353

suggesting it plays a major role in regulating drug absorption, distribution and elimination 354

(34). Further studies are warranted however to examine the role of MRP4 in 355

ciprofloxacin handling by these cells and to determine whether it is as effective in other 356

mammalian species, including in humans. Because ciprofloxacin-resistant cells also 357

overexpress Mrp2, we may also suspect additional interferences, since this transporter 358

confers resistance to several anti-cancer drugs (cisplatin, anthracyclines, vinca alkaloids 359

and methotrexate) and is detected in peripheral blood mononuclear cells (16). Long-360

term consequences of ciprofloxacin use on drug handling and other functions of 361

phagocytic cells may, therefore, need to be carefully addressed in relation to efflux. This 362

may now be facilitated by the identification of its most likely and effective transporter in 363

macrophages. 364


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



ACKNOWLEDGMENTS 365

We thank Eric Jacquet (Institut de Chimie des Substances Naturelles, Gif-sur-Yvette, 366

France) for communicating us unpublished results about ABC transporters expression 367

assessed by TaqMan low-density array in wild type and ciprofloxacin-resistant J774 368

macrophages, J.-M. Fritschy (Institute of Pharmacology and Toxicology, University of 369

Zurich, Zurich, Switzerland) for the kind gift of the polyclonal rabbit anti-mouse Mrp2 370

antibody, and M. C. Cambier, C. Misson, V. Mohymont, and M. Vergauwen for skillful 371

technical assistance. This research was supported by the Belgian Fonds de la 372

Recherche Scientifique Médicale (grants no. 3.4.542.02, 3.4.639.04, 3.4.597.06, and 373

3.4.583.08), the Belgian Fonds de la Recherche Scientifique (grant no. 1.5.195.07), the 374

Belgian Federal Science Policy Office (Research project P5/33 [research action P5] and 375

P6/19 [research action P6]), and a grant-in-aid from the French Association 376

Mucoviscidose: ABCF. B.M. and N.E.C. were recipients of short-term and post-doctoral 377

fellowships, and F.V.B. is Maître de Recherches of the Belgian Fonds de la Recherche 378

Scientifique (F.R.S.-FNRS). 379


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



References 380

1. 2003. Whither RNAi? Nat. Cell Biol. 5:489-490. 381

2. Cipro Package insert. http://www.univgraph.com/bayer/inserts/ciprotab.pdf; last 382 updated: 2007, last accessed: July 9, 2008 383

3. Almquist, K. C., D. W. Loe, D. R. Hipfner, J. E. Mackie, S. P. C. Cole, and R. 384 G. Deeley. 1995. Characterization of the Mr 190,000 Multidrug Resistance 385 Protein (MRP) in Drug-selected and Transfected Human Tumor Cells. Cancer 386 Res 55:102-110. 387

4. Alvarez, A. I., M. Perez, J. G. Prieto, A. J. Molina, R. Real, and G. Merino. 388 2008. Fluoroquinolone efflux mediated by ABC transporters. J. Pharm. Sci. 389 97:3483-3493. 390

5. Annereau, J. P., G. Szakacs, C. J. Tucker, A. Arciello, C. Cardarelli, J. 391 Collins, S. Grissom, B. R. Zeeberg, W. Reinhold, J. N. Weinstein, Y. 392 Pommier, R. S. Paules, and M. M. Gottesman. 2004. Analysis of ATP-binding 393 cassette transporter expression in drug-selected cell lines by a microarray 394 dedicated to multidrug resistance. Mol. Pharmacol. 66:1397-1405. 395

6. Baran, Y., B. Gur, P. Kaya, A. U. Ural, F. Avcu, and U. Gunduz. 2007. 396 Upregulation of multi drug resistance genes in doxorubicin resistant human acute 397 myelogeneous leukemia cells and reversal of the resistance. Hematology. 398 12:511-517. 399

7. Borst, P., C. de Wolf, and K. van de Wetering. 2007. Multidrug resistance-400 associated proteins 3, 4, and 5. Pflugers Arch - Eur J Physiol 453:661-673. 401

8. Cao, C., T. H. Steinberg, H. C. Neu, D. Cohen, S. B. Horwitz, S. Hickman, and 402 S. C. Silverstein. 1993. Probenecid-resistant J774 cell expression of enhanced 403 organic anion transport by a mechanism distinct from multidrug resistance. Infect. 404 Agents Dis. 2:193-200. 405

9. Cao, J. G., X. Q. Tang, and S. H. Shi. 2004. Multidrug resistance reversal in 406 human gastric carcinoma cells by neferine. World J. Gastroenterol. 10:3062-407 3064. 408

10. de Bruin, M., K. Miyake, T. Litman, R. Robey, and S. E. Bates. 1999. Reversal 409 of resistance by GF120918 in cell lines expressing the ABC half-transporter, 410 MXR. Cancer Lett. 146:117-126. 411

11. Deeley, R. G., C. Westlake, and S. P. Cole. 2006. Transmembrane transport of 412 endo- and xenobiotics by mammalian ATP-binding cassette multidrug resistance 413 proteins. Physiol Rev. 86:849-899. 414


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



12. Gottesman, M. M., C. Cardarelli, S. Goldenberg, T. Licht, and I. Pastan. 1998. 415 Selection and maintenance of multidrug-resistant cells. Methods Enzymol. 416 292:248-258. 417

13. Hammond, C. L., R. Marchan, S. M. Krance, and N. Ballatori. 2007. 418 Glutathione Export during Apoptosis Requires Functional Multidrug Resistance-419 associated Proteins. J. Biol. Chem. 282:14337-14347. 420

14. Huyghe, F., Mingeot-Leclercq, M. P., Marquez-Garrido, B., Tulkens, P. M., 421 and Van Bambeke, F. Competition between Ciprofloxacin (CIP) and Non-422 Steroidal Anti-Inflammatory Drugs (NSAID) for Efflux Transporters in J774 423 Macrophages. 47th Interscience Conference on Antimicrobial Agents and 424 Chemotherapy, Chicago, Il , A-1441. 2007. 425

Ref Type: Abstract 426

15. Jacoby, G. A. 2005. Mechanisms of resistance to quinolones. Clin. Infect. Dis. 427 41 Suppl 2:S120-S126. 428

16. Janneh, O., A. Owen, B. Chandler, R. C. Hartkoorn, C. A. Hart, P. G. Bray, S. 429 A. Ward, D. J. Back, and S. H. Khoo. 2005. Modulation of the intracellular 430 accumulation of saquinavir in peripheral blood mononuclear cells by inhibitors of 431 MRP1, MRP2, P-gp and BCRP. AIDS 19:2097-2102. 432

17. Jones, B. R., W. Li, J. Cao, T. A. Hoffman, P. M. Gerk, and M. Vore. 2005. The 433 role of protein synthesis and degradation in the post-transcriptional regulation of 434 rat multidrug resistance-associated protein 2 (Mrp2, Abcc2). Mol. Pharmacol. 435 68:701-710. 436

18. Jonker, J. W., J. W. Smit, R. F. Brinkhuis, M. Maliepaard, J. H. Beijnen, J. H. 437 Schellens, and A. H. Schinkel. 2000. Role of breast cancer resistance protein in 438 the bioavailability and fetal penetration of topotecan. J. Natl. Cancer Inst. 439 92:1651-1656. 440

19. Jorajuria, S., N. Dereuddre-Bosquet, K. Naissant-Storck, D. Dormont, and P. 441 Clayette. 2004. Differential Expression Levels of MRP1, MRP4, and MRP5 in 442 Response to Human Immunodeficiency Virus Infection in Human Macrophages. 443 Antimicrob. Agents Chemother. 48:1889-1891. 444

20. Lage, H. 2006. MDR1/P-glycoprotein (ABCB1) as target for RNA interference-445 mediated reversal of multidrug resistance. Curr. Drug Targets. 7:813-821. 446

21. Lismond, A., P. M. Tulkens, M. P. Mingeot-Leclercq, P. Courvalin, and F. 447 Van Bambeke. 2008. Cooperation between prokaryotic (Lde) and eukaryotic 448 (MRP) efflux transporters in J774 macrophages infected with Listeria 449 monocytogenes: studies with ciprofloxacin and moxifloxacin. Antimicrob. Agents 450 Chemother. 52:3040-3046. 451


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



22. Materna, V., A. Stege, P. Surowiak, A. Priebsch, and H. Lage. 2006. RNA 452 interference-triggered reversal of ABCC2-dependent cisplatin resistance in 453 human cancer cells. Biochem. Biophys. Res. Commun. 348:153-157. 454

23. Merino, G., A. I. Alvarez, M. M. Pulido, A. J. Molina, A. H. Schinkel, and J. G. 455 Prieto. 2006. Breast cancer resistance protein (BCRP/ABCG2) transports 456 fluoroquinolone antibiotics and affects their oral availability, pharmacokinetics, 457 and milk secretion. Drug Metab Dispos. 34:690-695. 458

24. Michot, J. M., C. Seral, F. Van Bambeke, M. P. Mingeot-Leclercq, and P. M. 459 Tulkens. 2005. Influence of efflux transporters on the accumulation and efflux of 460 four quinolones (ciprofloxacin, levofloxacin, garenoxacin, and moxifloxacin) in 461 J774 macrophages. Antimicrob. Agents Chemother. 49:2429-2437. 462

25. Michot, J. M., M. F. Heremans, N. E. Caceres, M. P. Mingeot-Leclercq, P. M. 463 Tulkens, and F. Van Bambeke. 2006. Cellular Accumulation and Activity of 464 Quinolones in Ciprofloxacin-Resistant J774 Macrophages. Antimicrob. Agents 465 Chemother. 50:1689-1695. 466

26. Michot, J. M., F. Van Bambeke, M. P. Mingeot-Leclercq, and P. M. Tulkens. 467 2004. Active Efflux of Ciprofloxacin from J774 Macrophages through an MRP-468 Like Transporter. Antimicrob. Agents Chemother. 48:2673-2682. 469

27. Muller, C., G. Laurent, and V. Ling. 1995. P-glycoprotein stability is affected by 470 serum deprivation and high cell density in multidrug-resistant cells. J. Cell Physiol 471 163:538-544. 472

28. Negoro, K., Y. Yamano, K. Fushimi, K. Saito, K. Nakatani, M. Shiiba, H. 473 Yokoe, H. Bukawa, K. Uzawa, T. Wada, H. Tanzawa, and S. Fujita. 2007. 474 Establishment and characterization of a cisplatin-resistant cell line, KB-R, derived 475 from oral carcinoma cell line, KB. Int. J. Oncol. 30:1325-1332. 476

29. Ono, N., I. van der Heijden, G. L. Scheffer, K. van de Wetering, E. van 477 Deemter, M. De Haas, A. Boerke, B. M. Gadella, D. G. De Rooij, J. J. Neefjes, 478 T. A. M. Groothuis, L. Oomen, L. Brocks, T. Ishikawa, and P. Borst. 2007. 479 Multidrug resistance-associated protein 9 (ABCC12) is present in mouse and 480 boar sperm. Biochem. J. 406:31-40. 481

30. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-482 time RT-PCR. Nucl. Acids Res. 29:e45. 483

31. Priebsch, A., F. Rompe, H. Tonnies, P. Kowalski, P. Surowiak, A. Stege, V. 484 Materna, and H. Lage. 2006. Complete reversal of ABCG2-depending atypical 485 multidrug resistance by RNA interference in human carcinoma cells. 486 Oligonucleotides. 16:263-274. 487

32. Reid, G., P. Wielinga, N. Zelcer, d. H. van, I, A. Kuil, M. de Haas, J. 488 Wijnholds, and P. Borst. 2003. The human multidrug resistance protein MRP4 489


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



functions as a prostaglandin efflux transporter and is inhibited by nonsteroidal 490 antiinflammatory drugs. Proc. Natl. Acad. Sci. U. S. A 100:9244-9249. 491

33. Rudin, D. E., P. X. Gao, C. X. Cao, H. C. Neu, and S. C. Silverstein. 1992. 492 Gemfibrozil enhances the listeriacidal effects of fluoroquinolone antibiotics in 493 J774 macrophages. J. Exp. Med. 176:1439-1447. 494

34. Russel, F. G., J. B. Koenderink, and R. Masereeuw. 2008. Multidrug 495 resistance protein 4 (MRP4/ABCC4): a versatile efflux transporter for drugs and 496 signalling molecules. Trends Pharmacol. Sci. 29:200-207. 497

35. Seral, C., M. Barcia-Macay, M. P. Mingeot-Leclercq, P. M. Tulkens, and F. 498 Van Bambeke. 2005. Comparative activity of quinolones (ciprofloxacin, 499 levofloxacin, moxifloxacin and garenoxacin) against extracellular and intracellular 500 infection by Listeria monocytogenes and Staphylococcus aureus in J774 501 macrophages. J. Antimicrob. Chemother. 55:511-517. 502

36. Shimizu, H., H. Taniguchi, Y. Hippo, Y. Hayashizaki, H. Aburatani, and T. 503 Ishikawa. 2003. Characterization of the mouse Abcc12 gene and its transcript 504 encoding an ATP-binding cassette transporter, an orthologue of human ABCC12. 505 Gene 310:17-28. 506

37. Soontornmalai, A., M. L. Vlaming, and J. M. Fritschy. 2006. Differential, strain-507 specific cellular and subcellular distribution of multidrug transporters in murine 508 choroid plexus and blood-brain barrier. Neuroscience 138:159-169. 509

38. Van Bambeke, F., E. Balzi, and P. M. Tulkens. 2000. Antibiotic efflux pumps. 510 Biochem. Pharmacol. 60:457-470. 511

39. Van Bambeke, F., J. M. Michot, and P. M. Tulkens. 2003. Antibiotic efflux 512 pumps in eukaryotic cells: occurrence and impact on antibiotic cellular 513 pharmacokinetics, pharmacodynamics and toxicodynamics. J. Antimicrob. 514 Chemother. 51:1067-1077. 515

40. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De 516 Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative 517 RT-PCR data by geometric averaging of multiple internal control genes. Genome 518 Biol. 3. 519

41. Wrobel, G., F Kokocinski, and and P Lichter. 2004. AutoPrime: selecting 520 primers for expressed sequences. Genome Biology 5:P11. 521

42. Wu, H., W. N. Hait, and J. M. Yang. 2003. Small interfering RNA-induced 522 suppression of MDR1 (P-glycoprotein) restores sensitivity to multidrug-resistant 523 cancer cells. Cancer Res. 63:1515-1519. 524

525


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



TABLE 1. Primers used for real-time PCR studies of Mrps. Each real-time PCR 526 reaction started with denaturation at 95°C for 5 min and then 40 cycles of 527 amplification (15 sec at 95°C followed by 1 min at Ta). The melting curve 528 analysis was made from 60°C to 95°C with continuous fluorescence readings. Ta 529 was 60°C for both housekeeping genes (Ywhaz, amplicon size: 141 pb; Rpl13A, 530 amplicon size: 130 pb). 531

532

Gene Forward primer (5’-3’) Reverse primer (5’-3’) Ta (°C) Amplicon size (pb)

Mrp1 CGATCAAGAGTGGCGAAGG AGGTGATGCCATTCAGTGTG 56.4 93

Mrp2 TGTTGGGCTTATGGTTCTCC CGAATGCTGTTCACTTGCTC 61.5 189

Mrp3 CCTGATCCAGAACCTACTCG GCAGTCCGTAGCCTCAAG 52.7 198

Mrp4 TGCTCCTCGTCGTAAGTGTG TGGAGGGAGGACGATAAATG 55.0 187

Mrp5 GCTGTTTGCTCTCGTGTGG TCCCTGTCACTTCTGTACCC 63.5 152

Mrp6 GGATTGACAGCAGAAGAGG GCAGAGGAAGAGGAACAGG 55.0 120

Mrp7 GGCTGAGAAGGAACAAGTGG AGCAGAGAGACGAGGATGG 61.5 216


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Figure 1 533

534


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



FIG. 1. Influence of gemfibrozil on the accumulation and efflux of ciprofloxacin in wild-535

type and in ciprofloxacin-resistant J774 macrophages. Data are the means of 3 536

independent measurements ± SD (when not visible, the SD bar is smaller than the 537

symbol). Upper panel: cells were incubated with 50 µM ciprofloxacin for 2 h at 37°C, in 538

the presence of gemfibrozil at concentrations ranging from 0 to 1 mM. Regression 539

parameters (non-linear; sigmoidal dose-response [Hill's coefficient = 1]) for wild-type and 540

ciprofloxacin-resistant cells, respectively: R2 = 0.975 and 0.956; EC50 (µM [95 % CI]; 541

shown by the open and closed triangles on the abscissa) = 58.1 (30.1 to 112.4) and 542

338.7 (142.6 to 804.4). Lower panels: cells were incubated for 2 h at 37°C with 50 µM 543

ciprofloxacin alone for wild-type cells and with 50 µM ciprofloxacin plus 200 µM 544

gemfibrozil for ciprofloxacin-resistant cells (to reach cell contents allowing for sufficiently 545

accurate measurements during efflux from both cell types; actual initial values: 338 ± 23 546

and 474 ± 44 ng/mg protein for wild-type and ciprofloxacin-resistant cells, respectively), 547

transferred to ciprofloxacin-free medium in the absence (left) or in the presence of 1 mM 548

gemfibrozil (right), and reincubated for up to 30 min at 37°C (for sake of clarity, the 549

graphs show only the data recorded during the first 5 min, but all data points were used 550

for analysis). Results are expressed as the percentage of the ciprofloxacin cell content 551

observed before transfer to ciprofloxacin-free medium. Data were best fitted to a 552

two-phases exponential decay function, with the first phase covering more than 70 % of 553

the analyzed time-span. Regression parameters for wild-type and ciprofloxacin-resistant 554

cells in the absence of gemfibrozil and for wild-type and ciprofloxacin-resistant cells in 555

the presence of gemfibrozil, respectively: R2 = 0.975, 0.998, 0.990, and 0.945; initial half-556

lives (min [95 % CI]): 1.75 (1.31 to 2.64), 0.09 (0.07 to 0.11), 4.49 (3.71 to 5.68), 4.35 557

(2.90 to 8.68) (the second phase is not visible on the graphs except for ciprofloxacin-558


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



resistant cells in the absence of gemfibrozil, for which the first phase is sufficiently 559

rapid). 560


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Figure 2 561

562

563

564


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



FIG. 2. Quantification of mRNA transcripts of Mrps (1-7) in ciprofloxacin-resistant (RS), 565

and revertant (Rev) J774 macrophages in comparison with wild-type cells (WT). 566

Upper panel: increase in expression over WT cells (set arbitrarily at 1 [dotted line]); 567

values of all samples were normalized using Ywhaz and Rpl13A as housekeeping 568

genes. Ratios shown are means ± SD (n=3). Statistical analysis (one-way ANOVA, 569

Dunnett Multiple Comparisons Test): ***: p< 0.001; **: p < 0.01, *: p< 0.05 as compared 570

to values in wild-type cells. Lower panel: mRNA transcripts (copy number as determined 571

by real-time PCR) expressed as the percentage of the total number of Mrp transcripts 572

detected starting from 1 µg purified total RNA for each cell type. Data were obtained 573

from the mean values of the number of copies calculated for each Mrp in each cell type. 574

Note that the boxes corresponding to Mrp2 and Mrp6 are not visible because the values 575

are smaller than the corresponding surrounding lines. 576


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Figure 3 577

578

579

FIG. 3. Western blot of proteins prepared from wild-type (WT), ciprofloxacin-resistant 580

(RS) and revertant (Rev) J774 macrophages. Gels were loaded with the amounts of 581

protein indicated. Upper part: whole cell lysates, with revelation with anti-Mrp4 (upper 582

row; 1:1000) or anti-actin (lower row; 1:600) antibodies, followed by anti-IgG HRP-583

labeled antibodies (1:1500). Lower part: membrane proteins, with revelation with anti-584

Mrp4 antibody (upper row; 1:2000) or anti-Mrp2 antibody (lower row; 1:200), followed by 585

anti-IgG HRP-labeled antibody (1:1500). Note that enriched membrane samples do not 586

contain actin. 587


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Figure 4 588

589

590

FIG. 4. Confocal microscopy of permeabilized J774 macrophages (WT, wild type; RS, 591

ciprofloxacin-resistant). A, cells stained with rhodamine-labeled phalloidin (to label actin 592

[red channel]) and monoclonal rat anti-Mrp4 antibody (followed by fluorescein 593

isothiocyanate-labeled anti-rat IgG antibodies [green channel]); B, cells stained with 594

rhodamine-labeled phalloidin (to label actin [red channel]) and polyclonal rabbit anti-595

Mrp2 antibodies (followed by fluorescein isothiocyanate-labeled anti-rabbit IgG 596

antibodies [green channel]); C, cells stained with monoclonal rat anti-Mrp4 antibody 597

(followed by Texas-Red-labeled polyclonal anti-rat IgG antibodies [red channel]) and 598

polyclonal rabbit anti- Mrp2 antibodies (followed by fluorescein isothiocyanate-labeled 599

anti-rabbit IgG antibodies [green channel]); note that there is no staining for actin in this 600

panel. r, red channel only; g, green channel only; m, merged images. 601


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Figure 5 602 603


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



FIG. 5. Effect of siRNA on the expression of Mrp4 and on the accumulation of 604

ciprofloxacin in ciprofloxacin-resistant J774 macrophages. Cells were either (i) 605

transfected with a specific anti-Mrp4 siRNA (targeting exon 31 [284556] or exon 8 606

[284555]), or with a non-targeting siRNA (neg. contr.); each at 25 nM); or (ii) left 607

untreated (none). A, mRNA Mrp4 level as determined by real-time PCR and expressed 608

as a percentage of the level observed in untransfected cells (for comparison, the graph 609

also shows the value observed in wild-type J774 macrophages [WT]). Data are from a 610

typical experiment (with determinations made in duplicate). B, Western blot analysis of 611

whole cell extracts of the corresponding cells. The gel was loaded with the same 612

amounts of protein for each sample (5 µg/well). Upper row: gel revealed with anti-Mrp4 613

antibody (1:1000), followed by the appropriate anti-IgG HRP-labeled antibody (1:666). 614

Lower row: gel revealed with anti-actin antibody (1:1000) followed by the appropriate 615

anti-IgG HRP-labeled antibody (1:1500). C, accumulation of ciprofloxacin expressed as 616

the percentage increase over untransfected cells. Cells were incubated with 50 µM 617

ciprofloxacin for 2 h at 37°C. Data are the means of 2 independent experiments with 618

measurements made in triplicate. 619

620


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/



Figure 6 621

622

FIG. 6. Effect of siRNA on the cell content in Mrp2 and on the accumulation of 623

ciprofloxacin in ciprofloxacin-resistant J774 macrophages. Cells were either (i) 624

transfected with two specific anti-Mrp2 siRNA (161716 [targeting exon 10]; 71770 625

[targeting exon 28]) or with a non-targeting siRNA (neg. contr.), each at 25 nM; or (ii) left 626

untreated (none). A, Western blot analysis of whole cell extracts of the corresponding 627

cells. The gel was loaded with the same amount of protein for each sample (45 µg/well). 628

Upper row: gel revealed with anti-Mrp2 antibody (1:200), followed by the appropriate 629

anti-IgG HRP-labeled antibody (1:1500). Lower row: gel revealed with anti-actin 630

antibody (1:1000) followed by the appropriate anti-IgG HRP-labeled antibody (1:1500). 631

B, accumulation of ciprofloxacin expressed as the percentage increase over 632

untransfected cells. Cells were incubated with 50 µM ciprofloxacin for 2 h at 37°C. 633


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

Download - Identification of the efflux transporter of the fluoroquinolone antibiotic

Top Related