Transcript
Page 1: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Intraventricular CXCL12 is neuroprotective and increases neurogenesis in a

murine model of stroke

Laura N. Zamproni, PhD1*, Marimelia A. Porcionatto, PhD1

1Neurobiology Lab, Department of Biochemistry, Escola Paulista de Medicina,

Universidade Federal de São Paulo, Rua Pedro de Toledo 669, 3o andar, Vila

Clementino, São Paulo, CEP: 04039-032.

*Corresponding Author: Laura N Zamproni, email: [email protected]

The authors have no conflict of interest to declare.

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 2: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Abstract

Stroke is the leading cause of physical disability and the second leading cause of

death in adults. Chemokines that regulate ischemic microenvironment can

influence neurorestorative therapies in stroke patients. CXCL12 was shown to be

neuroprotective, but there are some contradictory results in the literature. The

objective of this work is to verify whether CXCL12 delivery to the brain could be

beneficial or harmful. We decided to evaluate the intraventricular delivery to

facilitate its application in clinical practice. Intraventricular CXCL12 was able to

produce increased mRNA expression of the receptors CXCR4 and CXCR7 in the

cerebral cortex. After the stroke, intraventricular CXCL12 decreased mice

ischemic area and improved behavioral response. We found CXCL12 was

neuroprotective, increase reactive astrogliosis and improve neurogenesis in the

perilesional area.

Key words: stroke, CXCL12, neuroprotection, neurogenesis.

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 3: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Introduction

Stroke is the leading cause of physical disability and the second leading cause of

death in adults (Machado et al. 2013). Although thrombolytic therapy and

neuroendovascular intervention represents an advance for the treatment of acute

stroke a large proportion of survivors still struggle with severe disabilities due to

the limited time window for these therapies and frequent unsuccessful

recanalization (Nakagomi et al. 2015). There is no definitive therapy that can

restore lost brain function (Bang 2009). Numerous approaches have been

developed to protect the brain from ischemic damage but have limited success in

clinical practice (Bang 2009).

The microenvironment in the brain infarct area has been shown to influence the

effects of neurorestorative therapies in stroke patients (Bang 2017). Regulating

this microenvironment, by controlling chemokine and trophic factors levels, can

increase the degree of recovery after stroke (Wang et al. 2007). Among the milieu

of chemicals expressed in the injured tissue, C-X-C chemokine ligand 12

(CXCL12), also known as stromal-derived factor-1 (SDF-1) and its receptor

CXCR4, are potential candidates to modulate the microenvironment in the

infarcted brain (Shyu et al. 2008; Wang et al. 2012).

CXCL12 is a chemokine known to regulate migration, proliferation, and

differentiation of neural stem cells (NSCs) within the developing central nervous

system (CNS) (Li et al. 2015). Previous treatment of stroke with CXCL12 was

shown to upregulates the CXCL12/CXCR4 axis and enhances neurogenesis,

angiogenesis, and neurological outcome (Shyu et al. 2008; Yoo et al. 2012; Kim

et al. 2015).

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 4: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

However, there is some contradictory results in the literature. CXCL12 was shown

to function mainly as an inflammatory initiator during the acute phase of ischemia

(Huang et al. 2013; Ruscher et al. 2013). Pharmacological inhibition of CXCL12

binding to its receptors during the first week after stroke reduced inflammation

and neurodegeneration and promoted long-term recovery, without affecting the

infarct size (Wu et al. 2017). Also, higher circulating CXCL12 levels were shown

to be linked to poor outcome in stroke patients (Pan et al. 2016; Cheng et al.

2017a).

The objective of this work is to verify whether CXCL12 delivered to the brain could

be beneficial or harmful to stroke outcome. Since chemokines must be delivered

locally due to possible dangerous systemic effect, which severely limits their

therapeutic use and all previous work used intraparenchymal delivery, we decide

to evaluate the intraventricular delivery, in order to facilitate its application in

clinical practice.

Material and Methods

Intraventricular injection

Seven-week C57BL/6 female mice were submitted to surgery under anesthesia

with intraperitoneal administration of acepromazine (1 mg/Kg, Vetnil, Louveira,

São Paulo), xylazine (10 mg/kg, Ceva, São Paulo, Brazil) and ketamine

chloridrate (100 mg/kg, Syntec, São Paulo, Brazil). Peroperative analgesia was

provided by fentanyl (0.05 mg/Kg, Cristália, São Paulo, Brazil). All procedures

were approved by the Committee of Ethics in the Use of Animals (CEUA/Unifesp

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 5: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

9745220217). Intraventricular injection was performed according to a previously

described protocol (DeVos and Miller 2013). Briefly, animals were placed under

a stereotaxic frame, skin and skull were open. A 5 µL Hamilton syringe was used

for injection (stereotaxic coordinates from bregma: AP +0.3 mm; ML +1.0 mm;

DV −3.0 mm). Animals received 5 µL of PBS or CXCL12 20 ng/µL. Brains were

collected 1 or 3 days later. Mice were anesthetized and euthanized by cervical

dislocation. Ipsilateral brain cortex was immediately separated and frozen.

Ipsilateral brain cortex to injection was used for RNA extraction.

RNA extraction and Quantitative PCR (qPCR)

Total RNA was isolated from brain cortex using the Trizol® reagent (Life

Technologies, Thermo Fisher, Waltham, EUA), and RNA concentrations were

determined using a NanoDrop ND-1000 instrument (Thermo Fisher). Reverse-

transcriptase reactions were performed with the ImProm-II Reverse Transcription

System (Promega, Madison, USA) using 2 μg total RNA. qPCR was performed

using Brilliant® II SYBR® Green QPCR Master Mix (Applied Biosystems, Thermo

Fisher) and the Mx3000P QPCR System; MxPro qPCR software was used for

the analysis (Stratagene, San Diego, CA USA). Primers sequences are shown in

Table 1.

Values are expressed relative to those from the PBS group. For quantitation,

target genes were normalized using a reference control gene (HPRT). The

threshold cycle (Ct) for the target gene and Ct for the internal control were

determined for each sample, and triplicate experiments were performed. The

relative expression of mRNA was calculated using the 2-ΔΔCt method (Livak and

Schmittgen 2001).

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 6: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Stroke model

Seven-week C57BL/6 female mice were submitted to surgery under anesthesia

with intraperitoneal administration of acepromazine (1 mg/Kg), xylazine

(10 mg/kg) and ketamine chloridrate (100 mg/kg). Peroperative analgesia was

provided by fentanyl (0.05 mg/ Kg). All procedures were approved by

CEUA/Unifesp (9745220217).

Permanent distal middle cerebral artery occlusion was performed as previously

described (Llovera et al. 2014). A 1 cm skin incision between the ear and eye

was made and the temporal muscle was separated. The middle cerebral artery

(MCA) was identified at the transparent skull, in the rostral part of the temporal

area, dorsal to the retro-orbital sinus. The bone was thinned out with a drill right

above the MCA branch and carefully withdraw.

MCA was coagulated with monopolar electrosurgery (MedCir, São Paulo, Brazil).

The temporal muscle was relocated to its position, covering the burr hole and skin

sutured. Immediately after, animals were placed under a stereotaxic frame, skin

was open and skull was open. A 5 µL Hamilton syringe was used for

intraventricular injection (stereotaxic coordinates from bregma: AP +0.3 mm;

ML +1.0 mm; DV −3.0 mm). Animals received 5 µL of PBS or CXCL12 20 ng/ul

immediately after stroke. Sham animals were submitted to whole procedure

except artery coagulation. Mice were weighted every day. Brains were collected

7 days later. Mice were anesthetized and euthanized by cervical dislocation.

Next, the brains were removed, stained with 1.5% TTC (2,3,5-Triphenyl-

tetrazolium, Alphatec, São José dos Pinhais, Brazil) at room temperature, for

20 min and immersed in 4% PFA for 24 h. To estimate the amount of cerebral

tissue lost after stroke, the brains were sectioned into 2 mm coronal slices using

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 7: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

a manual sectioning block, and the lost tissue area in each slice was determined

by subtracting the area of the injured hemisphere from the area of the normal

hemisphere using Image J software. The volume of brain tissue lost was

determined by the sum of each slice area multiplied by the thickness (2 mm): lost

area = Σ (area of contralateral side – area of ipsilateral side) x 2 (Llovera et al.

2014). For histological analyses, brains were sectioned into 30 μm coronal slices

at −20 °C using a CM 1850 cryostat (Leica, Wetzlar, Germany).

Behavioral assessment

The functional outcomes of the stroke model were evaluated using two different

behavioral tests, conducted one day before stroke and 1, 4, and 7 days after

injury.

Cylinder: mice were recorded for 4 min while exploring an open-top, clear plastic

cylinder. Forelimb activity while rearing against the wall of the cylinder is

recorded. Forelimb use is defined by the placement of the whole palm on the wall

of the cylinder, which indicates its use for body support. Forelimb use is

expressed as a ratio of right/left-sided.

Grid walking: to verify limb sensitivity, mice were recorded while walking over a

grid for 4 min. The brain injury was in the left cortex, so as the mouse walked over

the grid, its right paws falls, because it could not grasp the grid properly. The

number of falls reflects the severity of the lesion (López-Valdés et al. 2014).

Fluoro-Jade B

Brain sections were mounted with distilled water onto gelatin coated slides and

dried on a slide warmer at 37 °C. The tissue was fully dried within 20 min at which

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 8: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

time it was immersed in 100% ethyl alcohol for 3 min followed by a 1 min change

in 70% alcohol and a 1 min change in distilled water. The slides were then

transferred to a solution of 0.06% potassium permanganate for 15 min. The slides

were rinsed for 1 min in distilled water, 3 times, and were then transferred to the

Fluoro-Jade (Sigma, St. Louis, EUA) staining solution for 30 min. A 0.01% stock

solution of the dye was prepared by dissolving 10 mg Fluoro-Jade in 100 mL of

distilled water. The 0.0001% working solution of Fluoro-Jade was prepared by

adding 1 mL of the stock Fluoro-Jade solution to 99 mL of 0.1% acetic acid in

distilled water. After staining, the sections were rinsed 1 min, 3 times, in distilled

water. Excess water was drained off and the slides were immersed in xylene and

then coversliped with DPX (Sigma) mounting media. Sections were examined

with a scanning confocal inverted microscope (TCS, SP8 Confocal Microscope,

Leica).

Immunofluorescence

For immunofluorescence staining, cortical sections were incubated overnight at

4 °C with anti-glial fibrillary acidic protein (GFAP, 1:1000, chicken IgG, Merck

Millipore, Burlington, EUA), anti-Iba1 (1:200, goat IgG, Abcam, Cambridge,

United Kingdom), anti-doublecortin (DCX, 1:500, guinea-pig IgG, Merck Millipore)

and anti-CD31 (1:200, BD, Franklin Lakes, USA). After washing with PBS, the

sections were incubated at room temperature with the appropriate secondary

antibodies conjugated to Alexa Fluor® 488 or 594 (1:500, Invitrogen, Carlsbad,

USA). Nuclei were stained with DAPI (1:500, Molecular Probes, Eugene, USA).

Glass slides were mounted using Fluoromount G (Sigma). The fluorescently

labeled tissue slices were analyzed using a scanning confocal inverted

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 9: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

microscope (TCS, SP8 Confocal Microscope, Leica), and image overlays were

generated using ImageJ software. Stained cells were quantified by measurement

of the total corrected fluorescence (Total corrected fluorescence = Integrated

Density – (Area of selection X Mean fluorescence of background readings)

(McCloy et al. 2014) or by manual cell counting per mm2 . Data from 3 animals

in each group, 3 sections per animal were analyzed.

Statistical analysis

Statistically significant differences were evaluated by Student’s T-test or one-way

ANOVA followed by Tukey post-test using the GraphPad Prism software version

5.01 (GraphPad Software, USA). Results are expressed as mean ± SEM and

were considered significant if p<0.05.

Results

Intraventricular administration of CXCL12 increased CXCR4 and CXCR7

expression in the cerebral cortex

We first evaluated whether CXCL12 intraventricular injection could promote a

response in the brain cortex (Figure 1). We found that animals who received

CXCL12 presented an increase in CXCR4 expression after 24 h (Figure 1A) and

significant increase in CXCR4 expression after 72 h (Figure 1B). CXCR7

expression significantly increased in the first 24 h (Figure 1C) and was similar to

PBS after 72 h (Figure 1B).

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 10: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Intraventricular CXCL12 reduced infarction volume

Once we confirmed intraventricular delivery produced a cortical response

regarding expression of CXCL12 receptors CXCR4 and 7, we evaluated its effect

on stroke. We first found that mice receiving CXCL12 have a lower ischemic area

confirmed by TTC staining (Figure 2A and B). Also, animals who received

CXCL12 behave better, losing less weight after stroke, in a similar way with Sham

group (Figure 2C). Although the cylinder test revealed no differences between

the groups (Figure 2D), in the 7th day post ischemia, animals who received

CXCL12 recovery better, presenting fewer falls when walking in the grid (Figure

2E).

Intraventricular CXCL12 decreased neuronal degeneration and increased

reactive astrocytes in brain ischemia

Our next step was to evaluate the molecular mechanisms involved in stroke

response to CXCL12 administration.

We first evaluated neuroprotection by analyzing the presence of degenerating

neurons, stained by Fluorojade B, in the ischemic borders (Figure 3A). Mice who

received CXCL12 presented significantly less neuronal degeneration (Figure 3B).

Surprisingly, along with less neuronal degeneration we observed an increase of

the GFAP infiltrate around the ischemic area in 7 days (Figures 3C and D). The

microglial infiltrate, however, did not change between PBS and CXCL 12 groups

(Figures 3C and E).

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 11: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Intraventricular CXCL12 increased neurogenesis but not angiogenesis

Finally, we evaluated neurogenesis and angiogenesis at the lesion site. We found

twice as many neuroblasts in CXCL12 treated animals (Figures 4A and B), but

we did not observe an increase in the number of endothelial cells (Figures 4C

and D).

Discussion

We chose an intraventricular injection to deliver CXCL12 because stroke is

usually an extensive lesion and we wanted CXCL12 to reach all the cortex. If we

performed an intraparenchymal injection, CXCL12 would concentrate in a single

region and probably not diffuse to the entire lesion. We could overcome this by

performing multiple intraparenchymal injections, but then, it would be very difficult

to translate the results into clinical practice, due the morbidity induced by the

procedure.

Our data support that CXCL12 delivered by intraventricular via was able to

increase expression of CXCL12 receptors in brain cortex and exert the

neuroprotective effects observed previously in brain ischemia (Shyu et al. 2008;

Yoo et al. 2012; Kim et al. 2015). CXCR4 is found at the membrane of a variety

of cells including neurons, astrocytes, microglia, bone marrow-derived cells, and

NSCs (Wang et al. 2012). CXCL12 and CXCR4 are constitutively expressed in

the brain but are up-regulated in the ischemic penumbra regions following

ischemic stroke (Cheng et al. 2017b). CXCL12/CXCR4 is thought to play

important roles in multiple processes after ischemic stroke, which include

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 12: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

inflammatory response, angiogenesis, and the recruitment of bone marrow-stem

cells and NSCs to injury (Kokovay et al. 2010; Yellowley 2013). Despite this

evidence, there is plenty of data in the literature showing that AMD3100, a

CXCR4 inhibitor, can improve outcome after stroke, mainly by attenuating

inflammatory response (Huang et al. 2013; Ruscher et al. 2013; Wu et al. 2017).

However, AMD3100 can also bind CXCR7 and function as an allosteric agonist

(Kalatskaya et al. 2009).

CXCR7 affinity for CXCL12 is almost 10 times higher than for CXCR4 and is more

distributed in neurons (Cheng et al. 2017b). The pathways behind their role are

not completely understood. CXCR7 was thought to function as a scavenger

receptor that can regulate the extracellular availability of CXCL12, mediating its

internalization and subsequent lysosomal degradation (Boldajipour et al. 2008;

Sánchez-Alcañiz et al. 2011). Clarification of the role of CXCR7 will be required

in the future (Cheng et al. 2017b). However, lack of a commercial CXCR7

antagonist difficult this process.

We found that intraventricular CXCL12 decreased degenerating neurons along

ischemic area. In fact, in brain development, CXCL12 was find to control neuronal

surviving and inhibiting apoptosis (Khan et al. 2008). Another interesting finding

was the increased number of reactive astrocytes in the perilesional area.

Astrocytes are commonly thought to be involved in negative responses through

glial scar formation and inhibition of axonal regeneration (Silver et al. 2014). But

new data describe that astrocytes appear to possess a high potential for

regeneration and neuroprotection following stroke (Sofroniew and Vinters 2010;

Becerra-Calixto and Cardona-Gómez 2017; Teh et al. 2017). Astrocytes are

involved in a large number of key processes essentials to keep integrity of the

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 13: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

nervous system, such as regulating the vascular tone, removing excess

glutamate in synaptic cleft and preventing excitotoxicity, releasing neurotrophic

factors and antioxidants and promoting synaptogenesis (López-Valdés et al.

2014). Many studies have suggested that after cerebral ischemia the astrocytes

are able to de-differentiate into NSCs and provide a new source of neurons at the

lesion site (Magnusson and Frisén 2016). To our knowledge, the increase in

reactive astrocytes in response to CXCL12 have not been reported.

Our most disappointing data was the lack of increased angiogenesis in response

to CXCL12 in contrast to what was previously described in the literature. One

possible explanation for this is that most studies evaluated angiogenesis after a

longer time period, usually 2 to 5 weeks, whereas we used a 7-day end-point

(Shyu et al. 2008; Li et al. 2018).

Conclusions

Intraventricular administration of CXCL12 was able to produce increased mRNA

expression of the receptors CXCR4 and CXCR7 in the cerebral cortex. In stroke,

intraventricular administration of CXCL12 decreased mice ischemic area and

improved behavioral response. We found CXCL12 was neuroprotective,

increased reactive astrogliosis and improved neurogenesis in stroke area.

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 14: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Figure Legends

Table 1: Primers sequences.

Figure 1: CXCR4 and CXCR7 expression in brain cortex after intraventricular

CXCL12 administration. (A and B) CXCR4 relative expression in the cortex in 24

h and 72 h (*= p < 0,05, Student’s T-test, n=3). (C and D) CXCR7 relative

expression in the cortex in 24 h and 72 h (*= p < 0,05, Student’s T-test, n=3).

Figure 2: Impact of intraventricular CXCL12 on ischemic brain cortex. (A) TTC

staining of brain slices. Unstained area corresponds to death tissue. (B)

Quantification of stroke area by TTC method (*= p < 0,05, Student’s T-test, n=3).

(C) Weight loss/gain curve (*= p < 0,05 for SHAM x PBS, CXCL12 x PBS, one-

way Anova plus Tukey posttest n=3). (D) Right/left ratio for forelimb use in the

cylinder test (n=3). (E) Number of paws falls in the grid walking test (*= p < 0,05

for SHAM x PBS, SHAM x CXCL 12, one-way Anova plus Tukey posttest n=3).

TTC: triphenyltetrazolium chloride

Figure 3: CXCL12 promotes neuroprotection and increases astroglial response

in the ischemic brain cortex. (A) Fluoro-Jade B staining for neuronal degeneration

(Scale bar =200 µm). (B)Total corrected fluorescence for Fluoro-Jade B staining

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 15: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

(*= p < 0,05, Student’s t-test, n=3). (C) Microglial and astrocyte lesion infiltrate in

7 days. Immunohistochemistry to IBA-1 (microglia) ang GFAP (astrocytes) (scale

bar = 50 µm). (D) Total corrected fluorescence for GFAP staining (*= p < 0,05,

Student’s t-test, n=3). (E) Total corrected fluorescence for IBA-1 staining (n=3).

LV: lateral ventricle; AU: arbitrary units. DAPI: 4',6-diamidino-2-phenylindole;

IBA-1: Ionized calcium binding adaptor molecule 1; GFAP: Glial fibrillary acidic

protein.

Figure 4: CXCL12 increases neurogenesis in ischemic brain cortex. (A)

Immunohistochemistry to DCX (neuroblasts) (scale bar = 50 µm). (B) Number

of DCX stained cells per mm2 (*= p < 0,05, Student’s t-test, n=3). (C)

Immunohistochemistry to CD31 (endothelial cells) (scale bar = 50 µm). (D)

Number of CD31 stained cells per mm2 (n=3).

DCX: doublecortin, CD: cluster of differentiation.

Acknowledgments

We kindly thank FAPESP (MP: 2009/05700-5, 2012/00652-5) and CNPq (LNZ:

380304/2017-1, MP: 404646/2012- 3, 465656/2014-5) for financial support.

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 16: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

References

Bang OY (2009) Current status of cell therapies in stroke. Int J Stem Cells 2:35-44 Bang OY (2017) Advances in biomarker for stroke patients: from marker to regulator. Precis

Future Med 1:32-42 doi: 10.23838/pfm.2017.00052 Becerra-Calixto A, Cardona-Gómez GP (2017) The Role of Astrocytes in Neuroprotection after

Brain Stroke: Potential in Cell Therapy. Front Mol Neurosci 10:88 doi: 10.3389/fnmol.2017.00088

Boldajipour B, Mahabaleshwar H, Kardash E, et al. (2008) Control of chemokine-guided cell migration by ligand sequestration. Cell 132:463-473 doi: 10.1016/j.cell.2007.12.034

Cheng X, Lian YJ, Ma YQ, Xie NC, Wu CJ (2017a) Elevated Serum Levels of CXC Chemokine Ligand-12 Are Associated with Unfavorable Functional Outcome and Mortality at 6-Month Follow-up in Chinese Patients with Acute Ischemic Stroke. Mol Neurobiol 54:895-903 doi: 10.1007/s12035-015-9645-9

Cheng X, Wang H, Zhang X, et al. (2017b) The Role of SDF-1/CXCR4/CXCR7 in Neuronal Regeneration after Cerebral Ischemia. Front Neurosci 11:590 doi: 10.3389/fnins.2017.00590

DeVos SL, Miller TM (2013) Direct intraventricular delivery of drugs to the rodent central nervous system. J Vis Exp:e50326 doi: 10.3791/50326

Huang J, Li Y, Tang Y, Tang G, Yang GY, Wang Y (2013) CXCR4 antagonist AMD3100 protects blood-brain barrier integrity and reduces inflammatory response after focal ischemia in mice. Stroke 44:190-197 doi: 10.1161/STROKEAHA.112.670299

Kalatskaya I, Berchiche YA, Gravel S, Limberg BJ, Rosenbaum JS, Heveker N (2009) AMD3100 is a CXCR7 ligand with allosteric agonist properties. Mol Pharmacol 75:1240-1247 doi: 10.1124/mol.108.053389

Khan MZ, Brandimarti R, Shimizu S, Nicolai J, Crowe E, Meucci O (2008) The chemokine CXCL12 promotes survival of postmitotic neurons by regulating Rb protein. Cell Death Differ 15:1663-1672 doi: 10.1038/cdd.2008.95

Kim DH, Seo YK, Thambi T, et al. (2015) Enhancing neurogenesis and angiogenesis with target delivery of stromal cell derived factor-1α using a dual ionic pH-sensitive copolymer. Biomaterials 61:115-125 doi: 10.1016/j.biomaterials.2015.05.025

Kokovay E, Goderie S, Wang Y, et al. (2010) Adult SVZ lineage cells home to and leave the vascular niche via differential responses to SDF1/CXCR4 signaling. Cell Stem Cell 7:163-173 doi: 10.1016/j.stem.2010.05.019

Li Y, Chang S, Li W, et al. (2018) cxcl12-engineered endothelial progenitor cells enhance neurogenesis and angiogenesis after ischemic brain injury in mice. Stem Cell Res Ther 9:139 doi: 10.1186/s13287-018-0865-6

Li Y, Tang G, Liu Y, et al. (2015) CXCL12 Gene Therapy Ameliorates Ischemia-Induced White Matter Injury in Mouse Brain. Stem Cells Transl Med 4:1122-1130 doi: 10.5966/sctm.2015-0074

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408 doi: 10.1006/meth.2001.1262

Llovera G, Roth S, Plesnila N, Veltkamp R, Liesz A (2014) Modeling stroke in mice: permanent coagulation of the distal middle cerebral artery. J Vis Exp:e51729 doi: 10.3791/51729

López-Valdés HE, Clarkson AN, Ao Y, Charles AC, Carmichael ST, Sofroniew MV, Brennan KC (2014) Memantine enhances recovery from stroke. Stroke 45:2093-2100 doi: 10.1161/STROKEAHA.113.004476

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 17: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Machado MF, Brucki SM, Nogueira CF, Rocha MS (2013) Infectious disease is the most common cause of death among stroke patients: two-years of follow-up. Arq Neuropsiquiatr 71:371-375 doi: 10.1590/0004-282X20130041

Magnusson JP, Frisén J (2016) Stars from the darkest night: unlocking the neurogenic potential of astrocytes in different brain regions. Development 143:1075-1086 doi: 10.1242/dev.133975

McCloy RA, Rogers S, Caldon CE, Lorca T, Castro A, Burgess A (2014) Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle 13:1400-1412 doi: 10.4161/cc.28401

Nakagomi T, Kubo S, Nakano-Doi A, et al. (2015) Brain vascular pericytes following ischemia have multipotential stem cell activity to differentiate into neural and vascular lineage cells. Stem Cells 33:1962-1974 doi: 10.1002/stem.1977

Pan DS, Yan M, Hassan M, Fang ZB, Chen MT (2016) Elevation of serum CXC chemokine ligand-12 levels predicts poor outcome after aneurysmal subarachnoid hemorrhage. J Neurol Sci 362:53-58 doi: 10.1016/j.jns.2016.01.024

Ruscher K, Kuric E, Liu Y, Walter HL, Issazadeh-Navikas S, Englund E, Wieloch T (2013) Inhibition of CXCL12 signaling attenuates the postischemic immune response and improves functional recovery after stroke. J Cereb Blood Flow Metab 33:1225-1234 doi: 10.1038/jcbfm.2013.71

Shyu WC, Lin SZ, Yen PS, Su CY, Chen DC, Wang HJ, Li H (2008) Stromal cell-derived factor-1 alpha promotes neuroprotection, angiogenesis, and mobilization/homing of bone marrow-derived cells in stroke rats. J Pharmacol Exp Ther 324:834-849 doi: 10.1124/jpet.107.127746

Silver J, Schwab ME, Popovich PG (2014) Central nervous system regenerative failure: role of oligodendrocytes, astrocytes, and microglia. Cold Spring Harb Perspect Biol 7:a020602 doi: 10.1101/cshperspect.a020602

Sofroniew MV, Vinters HV (2010) Astrocytes: biology and pathology. Acta Neuropathol 119:7-35 doi: 10.1007/s00401-009-0619-8

Sánchez-Alcañiz JA, Haege S, Mueller W, et al. (2011) Cxcr7 controls neuronal migration by regulating chemokine responsiveness. Neuron 69:77-90 doi: 10.1016/j.neuron.2010.12.006

Teh DBL, Prasad A, Jiang W, et al. (2017) Transcriptome Analysis Reveals Neuroprotective aspects of Human Reactive Astrocytes induced by Interleukin 1β. Scientific Reports 7:13988 doi: 10.1038/s41598-017-13174-w

Wang Q, Tang XN, Yenari MA (2007) The inflammatory response in stroke. J Neuroimmunol 184:53-68 doi: 10.1016/j.jneuroim.2006.11.014

Wang Y, Huang J, Li Y, Yang GY (2012) Roles of chemokine CXCL12 and its receptors in ischemic stroke. Curr Drug Targets 13:166-172

Wu KJ, Yu SJ, Shia KS, et al. (2017) A Novel CXCR4 Antagonist CX549 Induces Neuroprotection in Stroke Brain. Cell Transplant 26:571-583 doi: 10.3727/096368916X693563

Yellowley C (2013) CXCL12/CXCR4 signaling and other recruitment and homing pathways in fracture repair. Bonekey Rep 2:300 doi: 10.1038/bonekey.2013.34

Yoo J, Seo JJ, Eom JH, Hwang DY (2012) Effects of stromal cell-derived factor 1α delivered at different phases of transient focal ischemia in rats. Neuroscience 209:171-186 doi: 10.1016/j.neuroscience.2012.02.031

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 18: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

Gene Forward Reverse

CXCR4 AGCAGGTAGCAGTGAAACCTCTGA TGGTGGGCAGGAAGATOCTATTGA

CXCR7 AGCTCATTGATGCCTCCAGAGTGT ATACCACTCAAGCAACCAGACCCA

HPRT CTCATGGACTGATTATGGACAGGA GCAGGTCAGCAAAGAACTTATAGCC

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 19: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 20: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 21: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint

Page 22: Intraventricular CXCL12 is neuroprotective and increases ...Stroke is the leading cause of physical disability and the second leading cause of death in adults (Machado et al. 2013)

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted March 21, 2019. ; https://doi.org/10.1101/584565doi: bioRxiv preprint


Top Related