Download - MS Defence - Dr Visnu Pritom Chowdhury
![Page 1: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/1.jpg)
A statistical correlation between virulence genes and clinical features among patients with shigellosis in
Mirzapur, Bangladesh
Dr. Visnu Pritom ChowdhuryID#13176003
Session: Spring – 2013
MS in Biotechnology ProgramDepartment of Mathematics and Natural Science
BRAC University
![Page 2: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/2.jpg)
Background
Shigella episodes:
Kotloff et al., 1999
● 164.7 million – worldwide
● 163.2 million – developing countries (with 1.1 million deaths)
Kotloff et al., 2013
● 0.8 million fatalities
– In, sub-Saharan Africa & south Asia
– Along with, Rotavirus, Cryptosporidium and ETEC
![Page 3: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/3.jpg)
Classification
Genus: Shigella
Species:
1. Shigella dysenteriae (16 serotype)
2. Shigella flexneri (19)
3. Shigella boydii (20)
4. Shigella sonnei (1)
(Jakhetia et al., 2014)
![Page 4: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/4.jpg)
S. sonnei
S. flexneri
S. flexneri with intermittent S. dysenteriae Type 1 epidemics
Epidemiology
![Page 5: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/5.jpg)
Aim of this Study
Correlation between the presence of virulence factors and the clinical features observed in patients with shigellosis
![Page 6: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/6.jpg)
Methodology
![Page 7: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/7.jpg)
140 MD
105 MD
2.7 MD
35.6 MD
2.1 MD
1.8 MD
1.4 MD
62 MD
23 MD
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Plasmid Isolation
140 MD plasmid:
79% (+)ve (n = 48)
![Page 8: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/8.jpg)
Conserved Region in 140 MD Virulence Plasmid
![Page 9: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/9.jpg)
T3SS NC of Shigella spp.
![Page 10: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/10.jpg)
PCR Assay
Genes:
1. Virulence – ipaH, ial
2. Toxin – set1A, set1B, sen
3. T3SS – 18 genes
– Regulator – virB, mxiE
– Effector – ipgB1, icsB, ipgD
– Translocator – ipaBCD
– Chaperone – ipgC, ipgA, ipgE, spa15,
– Machinery – ipgF, mxiH, mxiI, mxiK, , mxiC, spa47, spa32, spa24
![Page 11: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/11.jpg)
Primer Designing
1. spa15 – chaperone
2. mxiE – T3SS regulator
![Page 12: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/12.jpg)
Steps for Primer Designing
1. Sequence retrieval ← NCBI
![Page 13: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/13.jpg)
Steps for Primer Designing
1. Sequence retrieval ← NCBI
2. Sequence input → Primer3Plus
![Page 14: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/14.jpg)
Steps for Primer Designing
1. Sequence retrieval ← NCBI
2. Sequence input → Primer3Plus
3. Parameter optimization Primer length – 18 – 20 nt Melting temperature (Tm) – 57 – 63 °C GC content – 45 – 60% GC clamp – sticky end and prevent mispriming
![Page 15: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/15.jpg)
Gene Primer Gene Primer
spa15 1 ACAGCCATTCAGCGATTACC mxiE 1 GCATAGCCATGCTGAAAAATG
spa15 2 AACGATGAAGCTCTACCAGCTC mxiE 2 TCCGACACACCATAATGCTC
Predicted Sequence
![Page 16: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/16.jpg)
Good temperature:Solid bands and no non-specific bands
Temperature too low:Reduced band intensity
Temperature too high:Fainting bands
Gene Cycle Td (°C)
Ta (°C) Gradient
Te (°C) Final Extn (°C)
Lowest Ta
Highest Ta
mxiE 32 94°C, 60 sec 48°C, 60 sec 64°C, 60 sec 72°C, 90 sec 72°C, 600 sec
spa15 32 94°C, 60 sec 48°C, 60 sec 64°C, 60 sec 72°C, 90 sec 72°C, 600 sec
Confirmation of predicted primer sequence
![Page 17: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/17.jpg)
ipaBCD500bp
icsB1568bp
ipgD560bp
spa24547bp
set1B147bp
set1A309bp
set2799bp
Agarose gel electrophoresis image of few genes
![Page 18: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/18.jpg)
ipaBCD ial ipgC ipgE virB ipgA sen mxiH mxiI spa15 spa47 ipgD ipgF spa32 ipgB1 mxiK spa24 mxiE set icsB mxiC0
10
20
30
40
50
60
70
80
90
100
PCR Assay
![Page 19: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/19.jpg)
pedal edemaseverity
abdominal painblood in stool
bloody mucoidfever
rectal strain vomiting
coughsunken eye
dry mouthdehydration
convulsion mental status
0
10
20
30
40
50
60
70
80
90
100
Clinical Feature Analysis
![Page 20: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/20.jpg)
Statistical Analysis
1. Presence of virulence genesVs.
2. Presence of clinical features
![Page 21: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/21.jpg)
Gene Clinical FeaturesChi-Squared Test
Value df P ( <0.01 )
set Blood in stool 9.244 1 .002
sen Blood in stool 9.244 1 .002
set Rectal strain 8.306 1 .004
sen Rectal strain 8.306 1 .004
ipgD Pedal edema 7.358 1 .007
Highly Statistically Significant Associations (P < 0.01)
![Page 22: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/22.jpg)
Gene Clinical FeatureChi-Squared Test
Value df P ( <0.05 )
set Stool consistency (Bloody mucoid) 9.514 3 .023
sen Stool consistency (Bloody mucoid) 9.514 3 .023
spa24 Rectal strain 4.378 1 .036
ial Abdominal pain 7.778 2 .020
ipaBCD Abdominal pain 7.378 2 .025
set Mouth dryness 4.118 1 .042
sen Mouth dryness 4.118 1 .042
set Cough 4.253 1 .039
sen Cough 4.253 1 .039
ipgD Cough 4.476 1 .034
set Fever 5.435 1 .020
sen Fever 5.435 1 .020
icsB Fever 3.840 1 .050
set Diarrheal disease severity 4.118 1 .042
sen Diarrheal disease severity 4.118 1 .042
Statistically Significant Associations (P < 0.05)
![Page 23: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/23.jpg)
In conclusion
● Shigella enterotoxins (set, sen) were mainly found associated with major clinical features (blood in stool and bloody mucoid stool consistency, rectal strain, dehydration, cough, fever, severity) observed in shigellosis
● The effector gene, ipgD was found to be correlated with pedal edema and cough
● And lastly, spa24 and icsB were associated with rectal strain and fever respectively; and ial, ipaBCD both were found associated with abdominal pain
![Page 24: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/24.jpg)
Limitations
1. Plasmids were isolated with only alkaline lysis method
2. Clinical data were insufficient to exclude associated co-morbidities or co-infections
3. Small sample size
![Page 25: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/25.jpg)
Recommendation for future work
1. Plasmid isolation confirmation through Sereny test
2. Exploring possibilities of chromosomal integration of plasmid borne virulence genes
3. Determination of any common conserved regions among Shigella and other immune system mediated cross-reacting pathogens
4. A more comprehensive study with larger sample size and extended clinical information
![Page 26: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/26.jpg)
Reference
Kotloff, K.L., Winickoff, J.P., Ivanoff, B., Clemens, J.D., Swerdlow, D.L., Sansonetti, P.J., Adak, G.K., and Levine, M.M. (1999). Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull. World Health Organ. 77, 651–666.
Kotloff, K.L., Nataro, J.P., Blackwelder, W.C., Nasrin, D., Farag, T.H., Panchalingam, S., Wu, Y., Sow, S.O., Sur, D., Breiman, R.F., et al. (2013). Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet 382, 209–222.
Jakhetia, R., Marri, A., Ståhle, J., Widmalm, G., and Verma, N.K. (2014). Serotype-conversion in Shigella flexneri: identification of a novel bacteriophage, Sf101, from a serotype 7a strain. BMC Genomics 15, 742
Khan, W.A., Dhar, U., Salam, M.A., Griffiths, J.K., Rand, W., and Bennish, M.L (1999). Central nervous system manifestations of childhood shigellosis: prevalence, risk factors, and outcome. Pediatrics 103, E18.
![Page 27: MS Defence - Dr Visnu Pritom Chowdhury](https://reader031.vdocuments.net/reader031/viewer/2022021507/5879c8c11a28abb42a8b6afb/html5/thumbnails/27.jpg)
Thank you