1
Mutations in BBS2 Cause Apparent Nonsyndromic Retinitis Pigmentosa
Meghan DeBenedictis2, Joseph Fogerty1, Gayle Pauer1, John Chiang3, Stephanie A.
Hagstrom1, Elias I. Traboulsi1,2 and Brian D. Perkins1
1Department of Ophthalmic Research, and the 2Center for Genetic Eye Diseases, Cole
Eye Institute, Cleveland Clinic, Cleveland, OH, 44195; 3Molecular Vision Laboratory,
Hillsboro, OR
Corresponding author:
Brian D. Perkins, Ph.D.
Department of Ophthalmic Research
Cleveland Clinic
Cleveland, OH 44195, USA
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
2
Abstract
Purpose: To identify and functionally test the causative mutations in the BBS2 gene in
a family presenting with retinitis pigmentosa and infertility and to generate a bbs2-/-
mutant zebrafish.
Methods: A female proband and her male sibling were clinically evaluated and genetic
testing with targeted next-generation sequencing was performed. Mutations were
verified by Sanger sequencing. Protein localization was examined by transient
expression and immunocytochemistry in cultured HEK-293T cells. Mutations in the
zebrafish bbs2 gene were generated by CRISPR/Cas9 and retinal phenotypes were
examined by immunohistochemistry.
Results: The proband and her brother exhibited reduced visual fields, retinal
degeneration, and bone spicule deposits, consistent with retinitis pigmentosa. The
brother also reported symptoms consistent with infertility. Compound heterozygous
mutations in the BBS2 gene; namely NM_031885.4 (BBS2):c.823C>T (p.R275X) and
NM_031885.4 (BBS2):c.401C>G (p.P134R), were identified in the proband and her
brother. Both mutations interfered with ciliary localization of Bbs2 in cell culture.
Mutation of the zebrafish bbs2 gene resulted in progressive cone degeneration and
rhodopsin mislocalization.
Conclusion: Missense mutations of BBS2 leads to non-syndromic retinitis pigmentosa,
but not Bardet-Biedl Syndrome, even though Bbs2 fails to localize to cilia. In zebrafish,
the complete loss of bbs2 results in cone degeneration and ciliopathy phenotypes,
indicating a requirement for Bbs2 in photoreceptor survival.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
3
Introduction
Bardet-Biedl Syndrome (BBS) is a rare, autosomal recessive group of disorders
that exhibits significant phenotypic and genetic heterogeneity. BBS results from
dysfunction of the cilia and is referred to as a ciliopathy. The clinical features of
different ciliopathies often overlap, making the diagnosis of BBS challenging in some
cases. BBS is characterized by the primary features of postaxial polydactyly, truncal
obesity, retinal degeneration, cognitive impairment, renal anomalies, and
hypogonadism. Secondary features include among others hypertension, diabetes
mellitus, hepatic fibrosis, hearing loss, dental abnormalities (hypodontia and dental
crowding), congenital heart defects, brachydactyly, speech disorder, ataxia, and
polydipsia-polyuria. A clinical diagnosis of BBS requires the presence of four of the
primary features or three primary and two secondary features [1]. The prevalence of
BBS differs between populations, with an incidence of approximately 1/160,000 in
European populations [2] to as high at 1/13,000 among Bedouins in Kuwait [3].
Mutations in at least 21 different genes cause BBS and many of these genes
encode proteins that regulate ciliary protein trafficking [4]. BBS2 (OMIM 606151) is one
of eight highly conserved BBS proteins (BBS1, 2, 4, 5, 7, 8, 9, and 18) that form the
BBSome, a protein complex that functions as a “ciliary gatekeeper” and regulates the
entry and removal of specific membrane proteins from the cilium [5, 6]. The
pathological features of BBS are thought to be linked to mislocalization and/or defects in
ciliary trafficking of various proteins, including several G-protein coupled receptors
(GPCRs), the leptin receptor, and the insulin receptor [7-12]. Nonsense, frameshift, and
missense mutations in BBS2 can result in BBS [13, 14].
The most penetrant feature of BBS is retinal dystrophy, with almost 97% of
patients exhibiting some form of retinopathy [15]. Patients typically develop night
blindness in the first decade of life and subsequently lose peripheral vision and visual
acuity, all symptoms consistent with retinitis pigmentosa [4, 16]. Retinitis pigmentosa
(RP) is a genetically heterogeneous condition with multiple inheritance patterns,
including autosomal recessive (30-40% of cases), autosomal dominant (50-60%), and
X-linked (5-15%) and is the most common hereditary retinal degenerative disease [17].
While the majority of RP cases remain isolated to the eye, up to 30% of patients can
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
4
also exhibit extra-ocular manifestations indicating a syndromic association of the retinal
dystrophy; this group of conditions includes BBS that accounts for up to 5% of all RP
cases [17]. Here we describe a proband with compound heterozygous missense and
nonsense variants in BBS2 who presented with apparent nonsyndromic RP and her
brother, who was affected by RP and infertility. These mutations disrupted ciliary
localization of BBS2 protein in cultured cells. The generation of zebrafish with truncating
mutations in bbs2 resulted in progressive retinal degeneration and phenotypes
consistent with cilia defects.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
5
Methods
Clinical Evaluation
Retinal examinations, DNA sample acquisition, and molecular analysis were approved
by the Cleveland Clinic Institutional Review Board (IRB). Written informed consent was
obtained from the patients and was in accordance with HIPAA regulations and the
tenets of the Declaration of Helsinki. The proband was evaluated in a specialized retinal
dystrophy clinic. Family and medical histories were obtained and reviewed. Fundus
photography, Goldmann visual field testing, and optical coherence tomography were
performed.
Molecular analysis
The proband’s DNA was sequenced for mutations in the retinal dystrophy genes via
next generation sequencing (NGS) in a Clinical Laboratory Improvement Amendments
(CLIA)-certified laboratory. Her brother’s and parent’s samples underwent targeted
variant analysis in the Hagstrom laboratory. Genomic DNA was isolated from leukocyte
nuclei prepared from blood samples as recommended by the manufacturer
(QuickGene-610L; autogen). Saliva was collected in OG-250 Oragen DNA collection
kits (DNA Genotek, Ottawa, ON, Canada) and processed using the PrepIT*L2P protocol
(DNA Genotek, Ottawa, ON, Canada). Genetic analysis was performed with NGS via
analysis of an inherited retinal dystrophy gene panel to identify the underlying cause of
disease. 131 RP genes were known and screened at the respective time of analysis.
Following the identification of the mutation in the proband, targeted analysis was
performed in the family’s samples. The DNA was amplified for exons 3 and 8 of the
BBS2 gene (AF342736). Primer pairs were designed for both exons. (Exon 3 forward:
CTGTTTTACTCAAAATCTGCTCAG and reverse:
AAAGTAAAAATGCTTAAGGGTACC; Exon 8 forward:
AGAATACTCTTGAAAACTGCTAGA and reverse: CTTTTTAAGGATTTTTCTCATCCC)
Amplification was performed at an annealing temperature of 54 ºC using Choice TM Taq
Mastermix DNA Polymerase (Denville Scientific, Inc, Metuchen, NJ). PCR products
were analyzed by direct sequencing using an automated sequencer. (3130XL, Life
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
6
Technologies Corporation Grand Island, NY). In silico analysis of the identified
missense variants was conducted using the Polyphen-2, pMut, and SIFT algorithms.
Disease gene collections and targeted capture probes design
283 genes for 146 monogenic eye diseases were collected by systematic database
(GeneReviews, OMIM, and RetNet) and literature searches, and expert reviews.
Customized oligonucleotide probes were designed to capture the exons and 30 base
pairs of adjacent sequences using NimbleGen (Roche) online oligonucleotide probe
design system.
Targeted sequencing library preparation and sequencing
Targeted sequencing libraries were prepared as following: 1 μg genomic DNA was
sonicated to 200~300 bp sized fragments. This was followed by end-repair, A-tailing,
Illumina adaptors ligation, and 4 cycles of pre-capture PCR amplification and sample
indexing. The indexed PCR product of 20-30 samples were pooled, targeted capture
was performed by hybridizing with capture probes, followed by 15 cycles of PCR
amplification and validation of library products for sequencing. DNA sequencing was
performed on Illumina HiSeq2000 sequencers to generate paired-end reads including
90 bps at each end and 8 bps of the index tag.
Data filtering and analysis
Image analysis and base calling were performed using the Illumina Pipeline. Indexed
primers were used for the data fidelity surveillance. Only reads that matched theoretical
adapter indexed sequences and theoretical primer indexed sequences with no more
than three mismatches were considered as valid reads. The human reference genome
was obtained from the NCBI database, version hg19. Sequence alignment was
performed using BWA (Burrows Wheeler Aligner) Multi-Vision software package (Li and
Durbin, 2009). SNPs were called using SOAPsnp (Li et al., 2009) and Indels were
identified using the GATK IndelGenotyper
(http://www.broadinstitute.org/gsa/wiki/index.php/, The Genome Analysis Toolkit).
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
7
Animal Maintenance
Wild-type zebrafish of an AB/Ekkwill hybrid strain were maintained and housed at
approximately 28 °C on a 14/10 light/dark cycle using standard procedures [18] and with
approval by the Institutional Animal Care and Use Committee (IACUC) at the Cleveland
Clinic.
CRISPR/Cas9 gene editing
Potential CRISPR target sites were identified in exon 4 of the zebrafish bbs2 gene using
ZiFiT (http://zifit.partners.org/ZiFiT/) [19] and gRNA synthesis was performed according
to the protocol by Talbot and Amacher [20]. Briefly, oligonucleotides for gRNA
synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’
AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274
(Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New
England BioLabs, Beverly, MA) and used for in vitro transcription reaction to generate
gRNA. Zebrafish embryos were injected at the 1-cell stage with a 1 nL solution of bbs2
gRNA (200 ng/µL) and Cas9 protein (10 µM; New England BioLabs, Beverly, MA).
Mutagenesis was confirmed by High Resolution Melt Analysis (HRMA) in injected F0
animals at 3 days post fertilization (dpf). Remaining F0 injected animals were raised to
adulthood and outcrossed to wild-type fish and HRMA was performed on DNA from F1
progeny to screen for mutations. F0 founders producing a high degree of mutant F1
progeny were kept and individual bbs2 alleles identified by sequencing.
Preparation of wild-type and mutant BBS2 constructs
The full-length human BBS2 clone in the pCMV6-entry vector was obtained
commercially (Origene; Clone ID: RC204337). Using this as a template, the human
BBS2 ORF was PCR amplified with gene specific primers and sub-cloned into the
pCDNA3.1V5/His TOPO TA vector (Invitrogen, Carlsbad, CA). The GeneArt Site-
Directed Mutagenesis system (Invitrogen, Carlsbad, CA) was used to engineer two
human BBS2 mutant alleles (P134R and R275X). The BBS2P134R mutant allele was
engineered using mutant primer pairs 5’-
ACATTGGGAGACATTTCTTCCCgTCTTGCGATTATTGGTGGCAAT and 5’
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
8
ATTGCCACCAATAATCGCAAGAcGGGAAGAAATGTCTCCCAATGT-3; while the
BBS2R275X mutant allele was engineered using mutant primer pairs 5’-
GAAGGTTGATGCTCGAAGTGACtGAACTGGGGAGGTCATCTTTAA and 5’-
TTAAAGATGACCTCCCCAGTTCaGTCACTTCGAGCATCAACCTTC-3’.
Cell line authentication
HEK-293T cells were authenticated by American Type Tissue Collection (ATCC;
Manassas, VA) using short tandem repeat (STR) analysis. Briefly, seventeen STR loci
and a gender determining locus were amplified using PowerPlex 18D Kit (Promega;
Madison, WI) and analyzed using GeneMapper ID-X v1.2 software (Applied
Biosystems; Foster City, CA). Samples were a 100% match to a reference of human
HEK-293T cells.
Cell culture, transient transfection and immunofluorescence
HEK-293T cells were cultured in DMEM medium containing 10% FBS. For localization
studies, cells were seeded in 6-well dishes with glass cover slips. At 60% confluence,
cells were transfected with 3 μg of either wild-type (BBS2-WT-V5) or mutant BBS2
constructs (BBS2P134R-V5 and BBS2R275X-V5) using FuGENE HD (Roche, Branford, CT)
according to the manufacturer's instructions. Ciliogenesis was induced 24 h post-
transfection by serum starvation using 0.5% FBS. After 24h, cell medium was removed
from cells and washed twice with cold 1X PBS. Cells were fixed with a 4% PFA solution
prepared in 1X PBS and subjected to indirect immunofluorescence. Cilia were detected
using an anti α-acetylated tubulin antibody (Sigma, clone 6-11B-1), while the BBS2-V5
fusion proteins were detected using anti V5 antibody (Abcam, Cambridge, MA). Nuclei
were stained using DAPI in the mounting medium. All mages were obtained using an
epi-florescent microscope (Olympus BX60) equipped with a U-M61002 Tri-pass cube
for DAPI/FITC/Texas Red. All images were obtained under a 100X oil immersion lens.
Experiments were carried out in duplicate and approximately 100 cells, from 10-15
fields, were counted and scored per transfection.
Immunohistochemistry
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
9
Immunohistochemistry was performed as previously described [21]. Briefly, zebrafish
larvae were fixed in 4% paraformaldehyde, equilibrated in PBS + 30% sucrose, and
embedded in Tissue Freezing Medium (Electron Microscopy Sciences, Hatfield, PA),
prior to cryosectioning. Adult eyes were likewise fixed 2 hours in PBS + 4%
paraformaldehyde and equilibrated as described [22]. Transverse sections including or
adjacent to the optic nerve were incubating in blocking solution (PBS + 2% BSA, 5%
goat serum, 0.1% Tween-20, 0.1% DMSO) for 1 hr. For cone inner segment analysis,
the length of five Zpr-1+ cells were measured near the synapse at regular intervals
across the retina. Rod outer segment length was measured similarly with zpr3 imaging.
Cone outer segments and PCNA+ nuclei were counted across the entire retina. All
experiments used between 3 and 6 animals per genotype.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
10
Results
Two siblings from a non-consanguineous Caucasian family display features of RP and
no other common signs of ciliopathies
A 40 year-old female presented for evaluation after an initial diagnosis of RP.
Her medical history was significant for recurrent vocal cord carcinoma but otherwise
non-contributory. She reported that her brother, three children, and parents were all
healthy with no complaints of vision loss. A dilated fundus exam showed characteristic
findings of RP, including optic nerve pallor, attenuated vessels, and the presence of
bone spicule pigment deposits in the periphery (Fig. 1A). Her best-corrected visual
acuity was 20/25 OU, but visual fields were significantly restricted (Fig. 1B).
Subjectively, the patient did not appear overweight. The subject reported having no
cardiac, renal, or neurological problems. A full panel analysis of 13 recessive retinitis
pigmentosa genes available at the time was obtained and included BEST1, CNGA1,
CNGB1, CRB1, EYS, LRAT, NR2E3, NRL, PDE6A, PDE6B, RHO, RPE65, and USH2A;
genetic testing did not detect any variants. Later, genetic testing via next generation
sequencing of additional retinal dystrophy genes detected 2 variants in BBS2, a
pathogenic nonsense variant, c.823C>T leading to p.R275X, and a likely pathogenic
missense variation, c.401C>G leading to p.P134R, which was previously identified in an
Indian family with non-syndromic RP [23]. In silico analysis performed on the missense
variant suggested it to be likely pathogenic (Polyphen score 0.957; PMut – pathological;
SIFT score 0.08; potentially tolerated). Cosegregation analysis determined the variants
to be in trans, but also determined the proband’s reportedly unaffected brother was also
positive for both variants (Fig. 2)
These results prompted us to revisit the family and perform a clinical evaluation
on the brother, a 39-year old male. Although he did not report any complaints in visual
function, dilated fundus examinations showed optic disc pallor, bone spicule pigment
deposition, evidence of retinal degeneration, and mild peripheral visual field constriction
(Fig. 3). During this examination he also disclosed fertility problems. His visual acuity
was 20/20 OU. His confrontation visual fields were full and he had no color
discrimination problems on Ishihara testing.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
11
Additional testing was obtained following the molecular diagnosis of BBS to
determine if the female patient had any systemic findings. Her free T4, TSH, and lipid
panel were normal. Her complete metabolic panel and renal function panel were
considered normal, although below the average reference range. Specifically, her
fasting blood glucose was 62 mg/dL (reference range: 65 - 100 mg/dL) and her
creatinine level was 0.58 mg/dL (reference range: 0.70 - 1.40 mg/dL). Prior imaging of
her heart and reproductive organs did not reveal any abnormalities. Her most recent
eye exam at the age of 48 years continued to show evidence of RP. Her best corrected
visual acuity was 20/40 in both eyes and she was noted to have posterior subcapsular
cataracts. Repeat metabolic testing was still normal.
The proband’s brother also had normal LH, FSH, Estradiol 17B, TSH and lipid
panel levels. His blood pressure was normal. He had no history of recurrent pneumonia,
bronchitis, or sinusitis. His complete metabolic panel was within normal limits.
However, his testosterone levels were slightly below normal (173 ng/dL, reference
range: 220 - 1000 ng/dL). Nigrosin-eosin staining of his sperm detected low amounts of
viable sperm (40%, reference range: >75%). Complete semen analysis showed a
decrease in motile sperm (30%, reference range: >40%) and a decrease in normal
sperm heads (2%, reference range: 14-100%). The morphology of his sperm was also
abnormal. Height was unavailable, but he weighed 270 pounds, placing him in the
obese range. This patient was lost to subsequent follow up visits.
The P134R and R275X mutations disrupts ciliary location BBS2 in HEK-293T cells
To investigate the functional consequences of the BBS2P134R and BBS2R275X
alleles, plasmids encoding V5-tagged BBS2 proteins were introduced into HEK-293T
cells (Fig. 4). The wild-type BBS2 protein was consistently seen localizing along the
length of the cilium, as assessed by immunocytochemistry with antibodies against
acetylated alpha tubulin and V5 (Fig. 4A). In contrast, the BBS2P134R mutant failed to
localize to the cilia, was retained within the cytoplasm, and occasionally aggregated
away from the cilium (Fig. 4B). The BBS2R275X mutant also failed to localize to the cilia
and additionally showed punctate staining near the cell surface (Fig. 4C). Taken
together, these data suggested that these mutations interfered with proper targeting or
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
12
localization of BBS2 to the cilium. Lack of ciliary localization may be responsible for the
retinal phenotypes associated with mutated BBS2 alleles.
Mutation of zebrafish bbs2 results in progressive cone degeneration
To assess the role of BBS2 in photoreceptor function, we utilized the
CRISPR/Cas9 gene editing system to target exon 4 of the zebrafish bbs2 gene. One
mutant line (lri82) was recovered that resulted in the insertion of a 15-base pair
fragment combined a 4-bp deletion, thereby yielding an 11-bp insertion and a frameshift
with a premature stop codon (Fig. 5A). The truncated protein is predicted to contain the
first 30% of the WD40 domain and then terminate after an additional frameshifted 58
amino acids (Fig. 5B). Founder (F0) animals were outcrossed to wild-type animals to
generate bbs2 heterozygote (bbs2+/-) zebrafish. Genotyping of clutches from bbs2+/-
intercrosses revealed that homozygous offspring (bbs2-/-) appeared normal and were
present in Mendelian ratios at 5 days post-fertilization (dpf) (Fig 5C). bbs2-/- mutants
survived to at least 1 year of age, but developed spinal curvatures and were smaller
than bbs2+/- and wild-type siblings (Fig 5D). These phenotypes resemble those of other
zebrafish ciliopathy mutants [22].
The bbs2-/- zebrafish have normal retinal patterning at 5 dpf, but show early signs
of photoreceptor dysfunction and long-term photoreceptor degeneration in adults. At
larval stages (5 dpf), the inner segments of the red-green double cone photoreceptors
were stained with the zpr-1 antibody, which recognizes arrestin 3-like [24], and with
peanut agglutinin (PNA), which labels the extracellular matrix surrounding cone outer
segments [25]. Although the number of cones and the size of the inner segments was
no different between bbs2-/- mutants and wild-type siblings, the cone outer segments of
bbs2-/- mutants were 20% shorter (5.43 ± 0.03 µm vs. 6.83 ± 0.18 µm, p=0.0015; Figs.
6A and 6B). Both juvenile bbs2-/- mutants (2.5 mpf) and adult bbs2-/- mutants showed
signs of cone disorganization, with both cone inner segments and outer segments being
significantly shorter than wild-type siblings (Figs. 6A, 6C, 6D) and reduced cone
numbers in 6 mpf adults (Fig. 6D). In 6 mpf bbs2-/- mutants, rhodopsin was mislocalized
to the rod inner segments, although the size of the rod outer segments was unchanged
(Figs. 6E and 6F). This phenotype resembled that of the zebrafish cep290-/- mutant,
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
13
which also showed signs of degeneration [22]. As retinal injury and cell death is known
to stimulate regeneration of lost retinal neurons through the reprogramming and
proliferation of Müller glia [26], retinal sections were stained with PCNA to identify
proliferating cells. In wild-type retinas, only 1-2 PCNA+ cells were found in either the
inner nuclear layer (INL), where the Müller glia reside, and 4-5 PCNA+ cells in the ONL
that represent rod precursors [27]. In contrast, bbs2-/- zebrafish had a 4-fold increase in
PCNA+ cells in the INL (10.8 ± 3.0 vs 2.5 ± 0.4) and a nearly 7-fold increase in PCNA+
cells in the ONL (35.8 ± 7.7 vs 4.8 ± 0.6; Figs. 6G and 6H). Increased proliferation of
unipotent rod precursors in the ONL indicates regeneration of dying rod photoreceptors.
The limited proliferation of Müller glia in the INL suggest that the slow degeneration in
bbs2-/- mutants was not sufficient to trigger a robust regeneration response.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
14
Discussion
Herein, we report two siblings with compound heterozygous mutations in BBS2
that result in apparently nonsyndromic retinitis pigmentosa, which on detailed
investigation revealed associated male infertility and mild obesity in the male but no
other syndromic signs of BBS in the proband or her brother. The two mutations
detected in the present patients appear more likely to cause retinal dystrophy with little
or no systemic findings. The P134R mutant allele was previously described in a non-
consanguineous family with non-syndromic RP [23]. Although biallelic inheritance of the
R275X allele was clinically diagnosed as BBS [14], the clinical manifestations were
restricted to one or two systems and did not include obesity and polydactyly, two classic
symptoms associated with BBS. The variability in expression of the genetic defect was
not only in the systems involved, but also in the severity of the retinal degeneration.
The female patient in the present report exhibited earlier onset of RP symptoms and
more rapid progression compared to the male sibling.
Clinical and functional data from this study provides further evidence that
pathogenic variants of the BBS2 gene can present with apparent nonsyndromic RP or
male infertility. It is likely that with advancing age the male patient would have shown
symptoms of his retinal dystrophy. Nonsyndromic RP or RP with minimal systemic
features has been described in patients with mutations in six of the BBS genes (BBS1,
BBS3/RP55/ARL6, BBS8/RP51/TTC8, BBS9, BBS12, and BBS14/CEP290) [28-31].
The first report of this association came in 2008 when Cannon et al. reported brothers
who were homozygous for the most common missense mutation in BBS1, p.M390R
[31]. Brother 1 had RP, polydactyly, and some mild learning difficulties but he did not
meet clinical diagnostic criteria for BBS [1]. Similarly, brother 2 had only RP and
polydactyly. A second study that investigated the phenotypic spectrum of the common
p.M390R BBS1 variant found biallelic inheritance in two siblings with nonsyndromic RP
[28]; one patient who was compound heterozygous for the p.M390R variant and a
second missense pathogenic variant, p.L388P with nonsyndromic RP; three patients (3
homozygous and 1 compound heterozygous) were labeled as possibly nonsyndromic
RP; and six patients (5 homozygous and 1 compound heterozygous) with mild BBS.
There was only 1 patient with classic BBS in that study. A study of Saudi patients with
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
15
RP found 4 patients in 1 family to be homozygous for the missense mutation, p.A89V in
the BBS3 gene [30]. All had RP without systemic findings. Four members of a family
with a homozygous splice site mutation in BBS8, namely IVS1-2A>G had nonsyndromic
RP [29]. Recently, Shevach et al. reported an association between missense
pathogenic variants in the BBS2 gene and nonsyndromic RP [23]. One of the missense
variants they found is the same missense variant we detected in the present family,
p.P134R. Unlike the patient in that report, the second pathogenic variant we report is a
nonsense variant. This observation further broadens both the phenotypic and genetic
spectrum of BBS alleles.
While BBS is largely an autosomal recessive disease, a number of reports have
attributed phenotypic variability to triallelism [14]. In one study aimed at testing the
hypothesis that triallelism causes clinical variability, a homozygous deletion of exon 6 in
the BBS9 gene was detected in three sisters [32]. One of these patients had all the
primary features of BBS, while her two sisters had RP but none of the other BBS
features. No other variants were found in any of the other BBS genes in this family. One
study found a novel BBS12 variant, p.S701X, in three affected individuals of a
consanguineous family. All three had postaxial polydactyly and retinal degeneration.
There were no renal or genital anomalies, obesity, or other symptoms consistent with a
clinical diagnosis of BBS [33, 34]. Much has been published on the phenotypic
heterogeneity in patients with BBS14/CEP290 gene. This gene has also been reported
to cause Leber Congenital Amaurosis [35], Senior Loken Syndrome [36], Joubert
syndrome [36, 37], and McKusick-Kaufman syndrome [38]. Modifier alleles have been
proposed to influence phenotypic severity of CEP290-associated disease [39], but
mechanisms such as nonsense-mediated exon skipping may prove more predictive
[40].
This also represents the first report of a loss-of-function phenotype for any bbs
gene in zebrafish. Several prior studies utilized morpholinos to knock-down bbs gene
function in bbs1-14 and bbs18 and reported defects in early embryogenesis [34, 41-48].
Unfortunately, interpretations of morpholino phenotypes, particularly those related to
bbs function, have recently come under increased scrutiny due to potential off-target
effects [49]. The phenotypes of the bbs2-/- mutant reported herein are consistent with
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
16
other genetic mutants in zebrafish that affect cilia genes [22, 50, 51]. Importantly, the
zebrafish bbs2-/- mutant undergoes progressive photoreceptor degeneration, consistent
with mouse models [11] and humans. As zebrafish are capable of regenerating
damaged photoreceptors following acute injury [52, 53], the bbs2-/- mutant may serve as
a useful model for studies of regeneration in inherited retinal dystrophies.
In conclusion, we demonstrate that mutations in BBS2 cause non-syndromic RP
and infertility, that these mutations prevent ciliary localization of Bbs2 protein, and that
zebrafish lacking bbs2 function exhibit progressive photoreceptor degeneration.
Although the phenotypes reported do not meet the diagnostic criteria for BBS, patients
with RP and difficulties conceiving children from sperm problems should still be
suspected of having BBS mutations. Advances in genetic testing technology, such as
next generation sequencing, and broader diagnostic genetic testing panels have
increased our ability to molecularly diagnose patients. Using more unbiased approaches
for genetic diagnosis may lead to detection of variants in genes otherwise not
considered as causative for a patient’s disease.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
17
References
1. Beales PL, Elcioglu N, Woolf AS, Parker D, Flinter FA. New criteria for improved diagnosis of Bardet-Biedl syndrome: results of a population survey. J Med Genet 1999; 36(6):437-46. 2. Beales PL, Warner AM, Hitman GA, Thakker R, Flinter FA. Bardet-Biedl syndrome: a molecular and phenotypic study of 18 families. J Med Genet 1997; 34(2):92-8. 3. Farag TI, Teebi AS. High incidence of Bardet Biedl syndrome among the Bedouin. Clin Genet 1989; 36(6):463-4. 4. Weihbrecht K, Goar WA, Pak T, Garrison JE, DeLuca AP, Stone EM, Scheetz TE, Sheffield VC. Keeping an Eye on Bardet-Biedl Syndrome: A Comprehensive Review of the Role of Bardet-Biedl Syndrome Genes in the Eye. Med Res Arch 2017; 5(9). 5. Datta P, Allamargot C, Hudson JS, Andersen EK, Bhattarai S, Drack AV, Sheffield VC, Seo S. Accumulation of non-outer segment proteins in the outer segment underlies photoreceptor degeneration in Bardet-Biedl syndrome. Proc Natl Acad Sci U S A 2015; 112(32):E4400-9. 6. Ye F, Nager AR, Nachury MV. BBSome trains remove activated GPCRs from cilia by enabling passage through the transition zone. J Cell Biol 2018; 217(5):1847-68. 7. Seo S, Guo DF, Bugge K, Morgan DA, Rahmouni K, Sheffield VC. Requirement of Bardet-Biedl syndrome proteins for leptin receptor signaling. Hum Mol Genet 2009; 18(7):1323-31. 8. Starks RD, Beyer AM, Guo DF, Boland L, Zhang Q, Sheffield VC, Rahmouni K. Regulation of Insulin Receptor Trafficking by Bardet Biedl Syndrome Proteins. PLoS Genet 2015; 11(6):e1005311. 9. Seo S, Zhang Q, Bugge K, Breslow DK, Searby CC, Nachury MV, Sheffield VC. A novel protein LZTFL1 regulates ciliary trafficking of the BBSome and Smoothened. PLoS Genet 2011; 7(11):e1002358. 10. Davis RE, Swiderski RE, Rahmouni K, Nishimura DY, Mullins RF, Agassandian K, Philp AR, Searby CC, Andrews MP, Thompson S, Berry CJ, Thedens DR, Yang B, Weiss RM, Cassell MD, Stone EM, Sheffield VC. A knockin mouse model of the Bardet-Biedl syndrome 1 M390R mutation has cilia defects, ventriculomegaly, retinopathy, and obesity. Proc Natl Acad Sci U S A 2007; 104(49):19422-7. 11. Nishimura DY, Fath M, Mullins RF, Searby C, Andrews M, Davis R, Andorf JL, Mykytyn K, Swiderski RE, Yang B, Carmi R, Stone EM, Sheffield VC. Bbs2-null mice have neurosensory deficits, a defect in social dominance, and retinopathy associated with mislocalization of rhodopsin. Proc Natl Acad Sci U S A 2004; 101(47):16588-93. 12. Abd-El-Barr MM, Sykoudis K, Andrabi S, Eichers ER, Pennesi ME, Tan PL, Wilson JH, Katsanis N, Lupski JR, Wu SM. Impaired photoreceptor protein transport and synaptic transmission in a mouse model of Bardet-Biedl syndrome. Vision Res 2007; 47(27):3394-407. 13. Nishimura DY, Searby CC, Carmi R, Elbedour K, Van Maldergem L, Fulton AB, Lam BL, Powell BR, Swiderski RE, Bugge KE, Haider NB, Kwitek-Black AE, Ying L, Duhl DM, Gorman SW, Heon E, Iannaccone A, Bonneau D, Biesecker LG, Jacobson SG, Stone EM, Sheffield VC. Positional cloning of a novel gene on chromosome 16q causing Bardet-Biedl syndrome (BBS2). Hum Mol Genet 2001; 10(8):865-74. 14. Katsanis N, Ansley SJ, Badano JL, Eichers ER, Lewis RA, Hoskins BE, Scambler PJ, Davidson WS, Beales PL, Lupski JR. Triallelic inheritance in Bardet-Biedl syndrome, a Mendelian recessive disorder. Science 2001; 293(5538):2256-9.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
18
15. Denniston AK, Beales PL, Tomlins PJ, Good P, Langford M, Foggensteiner L, Williams D, Tsaloumas MD. Evaluation of visual function and needs in adult patients with bardet-biedl syndrome. Retina 2014; 34(11):2282-9. 16. Fulton AB, Hansen RM, Glynn RJ. Natural course of visual functions in the Bardet-Biedl syndrome. Archives of ophthalmology 1993; 111(11):1500-6. 17. Hartong DT, Berson EL, Dryja TP. Retinitis pigmentosa. Lancet 2006; 368(9549):1795-809. 18. Westerfield M. The Zebrafish Book. 3 ed. Eugene, OR: University of Oregon Press; 1995. 19. Sander JD, Maeder ML, Reyon D, Voytas DF, Joung JK, Dobbs D. ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering tool. Nucleic acids research 2010; 38(Web Server issue):W462-8. 20. Talbot JC, Amacher SL. A streamlined CRISPR pipeline to reliably generate zebrafish frameshifting alleles. Zebrafish 2014; 11(6):583-5. 21. Fogerty J, Stepanyan R, Cianciolo LT, Tooke BP, Perkins BD. Genomic non-redundancy of the mir-183/96/182 cluster and its requirement for hair cell maintenance. Sci Rep 2019; 9(1):10302. 22. Lessieur EM, Song P, Nivar GC, Piccillo EM, Fogerty J, Rozic R, Perkins BD. Ciliary genes arl13b, ahi1 and cc2d2a differentially modify expression of visual acuity phenotypes but do not enhance retinal degeneration due to mutation of cep290 in zebrafish. PloS one 2019; 14(4):e0213960. 23. Shevach E, Ali M, Mizrahi-Meissonnier L, McKibbin M, El-Asrag M, Watson CM, Inglehearn CF, Ben-Yosef T, Blumenfeld A, Jalas C, Banin E, Sharon D. Association Between Missense Mutations in the BBS2 Gene and Nonsyndromic Retinitis Pigmentosa. JAMA ophthalmology 2015; 133(3):312-8. 24. Ile KE, Kassen S, Cao C, Vihtehlic T, Shah SD, Mousley CJ, Alb JG, Jr., Huijbregts RP, Stearns GW, Brockerhoff SE, Hyde DR, Bankaitis VA. Zebrafish class 1 phosphatidylinositol transfer proteins: PITPbeta and double cone cell outer segment integrity in retina. Traffic 2010; 11(9):1151-67. 25. Blanks JC, Johnson LV. Specific binding of peanut lectin to a class of retinal photoreceptor cells. A species comparison. Invest Ophthalmol Vis Sci 1984; 25(5):546-57. 26. Wan J, Goldman D. Retina regeneration in zebrafish. Curr Opin Genet Dev 2016; 40:41-7. 27. Stenkamp DL. The rod photoreceptor lineage of teleost fish. Prog Retin Eye Res 2011; 30(6):395-404. 28. Estrada-Cuzcano A, Koenekoop RK, Senechal A, De Baere EB, de Ravel T, Banfi S, Kohl S, Ayuso C, Sharon D, Hoyng CB, Hamel CP, Leroy BP, Ziviello C, Lopez I, Bazinet A, Wissinger B, Sliesoraityte I, Avila-Fernandez A, Littink KW, Vingolo EM, Signorini S, Banin E, Mizrahi-Meissonnier L, Zrenner E, Kellner U, Collin RW, den Hollander AI, Cremers FP, Klevering BJ. BBS1 mutations in a wide spectrum of phenotypes ranging from nonsyndromic retinitis pigmentosa to Bardet-Biedl syndrome. Archives of ophthalmology 2012; 130(11):1425-32. 29. Riazuddin SA, Iqbal M, Wang Y, Masuda T, Chen Y, Bowne S, Sullivan LS, Waseem NH, Bhattacharya S, Daiger SP, Zhang K, Khan SN, Riazuddin S, Hejtmancik JF, Sieving PA, Zack DJ, Katsanis N. A splice-site mutation in a retina-specific exon of BBS8 causes nonsyndromic retinitis pigmentosa. Am J Hum Genet 2010; 86(5):805-12.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
19
30. Aldahmesh MA, Safieh LA, Alkuraya H, Al-Rajhi A, Shamseldin H, Hashem M, Alzahrani F, Khan AO, Alqahtani F, Rahbeeni Z, Alowain M, Khalak H, Al-Hazzaa S, Meyer BF, Alkuraya FS. Molecular characterization of retinitis pigmentosa in Saudi Arabia. Mol Vis 2009; 15:2464-9. 31. Cannon PS, Clayton-Smith J, Beales PL, Lloyd IC. Bardet-biedl syndrome: an atypical phenotype in brothers with a proven BBS1 mutation. Ophthalmic Genet 2008; 29(3):128-32. 32. Abu-Safieh L, Al-Anazi S, Al-Abdi L, Hashem M, Alkuraya H, Alamr M, Sirelkhatim MO, Al-Hassnan Z, Alkuraya B, Mohamed JY, Al-Salem A, Alrashed M, Faqeih E, Softah A, Al-Hashem A, Wali S, Rahbeeni Z, Alsayed M, Khan AO, Al-Gazali L, Taschner PE, Al-Hazzaa S, Alkuraya FS. In search of triallelism in Bardet-Biedl syndrome. European journal of human genetics : EJHG 2012; 20(4):420-7. 33. Pawlik B, Mir A, Iqbal H, Li Y, Nurnberg G, Becker C, Qamar R, Nurnberg P, Wollnik B. A Novel Familial BBS12 Mutation Associated with a Mild Phenotype: Implications for Clinical and Molecular Diagnostic Strategies. Mol Syndromol 2010; 1(1):27-34. 34. Stoetzel C, Muller J, Laurier V, Davis EE, Zaghloul NA, Vicaire S, Jacquelin C, Plewniak F, Leitch CC, Sarda P, Hamel C, de Ravel TJ, Lewis RA, Friederich E, Thibault C, Danse JM, Verloes A, Bonneau D, Katsanis N, Poch O, Mandel JL, Dollfus H. Identification of a novel BBS gene (BBS12) highlights the major role of a vertebrate-specific branch of chaperonin-related proteins in Bardet-Biedl syndrome. Am J Hum Genet 2007; 80(1):1-11. 35. den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, Zonneveld MN, Strom TM, Meitinger T, Brunner HG, Hoyng CB, van den Born LI, Rohrschneider K, Cremers FP. Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis. Am J Hum Genet 2006; 79(3):556-61. 36. Sayer JA, Otto EA, O'Toole JF, Nurnberg G, Kennedy MA, Becker C, Hennies HC, Helou J, Attanasio M, Fausett BV, Utsch B, Khanna H, Liu Y, Drummond I, Kawakami I, Kusakabe T, Tsuda M, Ma L, Lee H, Larson RG, Allen SJ, Wilkinson CJ, Nigg EA, Shou C, Lillo C, Williams DS, Hoppe B, Kemper MJ, Neuhaus T, Parisi MA, Glass IA, Petry M, Kispert A, Gloy J, Ganner A, Walz G, Zhu X, Goldman D, Nurnberg P, Swaroop A, Leroux MR, Hildebrandt F. The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nat Genet 2006; 38(6):674-81. 37. Valente EM, Silhavy JL, Brancati F, Barrano G, Krishnaswami SR, Castori M, Lancaster MA, Boltshauser E, Boccone L, Al-Gazali L, Fazzi E, Signorini S, Louie CM, Bellacchio E, International Joubert Syndrome Related Disorders Study G, Bertini E, Dallapiccola B, Gleeson JG. Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome. Nat Genet 2006; 38(6):623-5. 38. Baala L, Audollent S, Martinovic J, Ozilou C, Babron MC, Sivanandamoorthy S, Saunier S, Salomon R, Gonzales M, Rattenberry E, Esculpavit C, Toutain A, Moraine C, Parent P, Marcorelles P, Dauge MC, Roume J, Le Merrer M, Meiner V, Meir K, Menez F, Beaufrere AM, Francannet C, Tantau J, Sinico M, Dumez Y, MacDonald F, Munnich A, Lyonnet S, Gubler MC, Genin E, Johnson CA, Vekemans M, Encha-Razavi F, Attie-Bitach T. Pleiotropic effects of CEP290 (NPHP6) mutations extend to Meckel syndrome. Am J Hum Genet 2007; 81(1):170-9. 39. Coppieters F, Casteels I, Meire F, De Jaegere S, Hooghe S, van Regemorter N, Van Esch H, Matuleviciene A, Nunes L, Meersschaut V, Walraedt S, Standaert L, Coucke P, Hoeben H, Kroes HY, Vande Walle J, de Ravel T, Leroy BP, De Baere E. Genetic screening of LCA in Belgium: predominance of CEP290 and identification of potential modifier alleles in AHI1 of CEP290-related phenotypes. Hum Mutat 2010.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
20
40. Drivas TG, Wojno AP, Tucker BA, Stone EM, Bennett J. Basal exon skipping and genetic pleiotropy: A predictive model of disease pathogenesis. Sci Transl Med 2015; 7(291):291ra97. 41. Zaghloul NA, Liu Y, Gerdes JM, Gascue C, Oh EC, Leitch CC, Bromberg Y, Binkley J, Leibel RL, Sidow A, Badano JL, Katsanis N. Functional analyses of variants reveal a significant role for dominant negative and common alleles in oligogenic Bardet-Biedl syndrome. Proc Natl Acad Sci U S A 2010; 107(23):10602-7. 42. Stoetzel C, Laurier V, Davis EE, Muller J, Rix S, Badano JL, Leitch CC, Salem N, Chouery E, Corbani S, Jalk N, Vicaire S, Sarda P, Hamel C, Lacombe D, Holder M, Odent S, Holder S, Brooks AS, Elcioglu NH, Silva ED, Rossillion B, Sigaudy S, de Ravel TJ, Lewis RA, Leheup B, Verloes A, Amati-Bonneau P, Megarbane A, Poch O, Bonneau D, Beales PL, Mandel JL, Katsanis N, Dollfus H. BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus. Nat Genet 2006; 38(5):521-4. 43. Leitch CC, Zaghloul NA, Davis EE, Stoetzel C, Diaz-Font A, Rix S, Alfadhel M, Lewis RA, Eyaid W, Banin E, Dollfus H, Beales PL, Badano JL, Katsanis N. Hypomorphic mutations in syndromic encephalocele genes are associated with Bardet-Biedl syndrome. Nat Genet 2008; 40(4):443-8. 44. Ross AJ, May-Simera H, Eichers ER, Kai M, Hill J, Jagger DJ, Leitch CC, Chapple JP, Munro PM, Fisher S, Tan PL, Phillips HM, Leroux MR, Henderson DJ, Murdoch JN, Copp AJ, Eliot MM, Lupski JR, Kemp DT, Dollfus H, Tada M, Katsanis N, Forge A, Beales PL. Disruption of Bardet-Biedl syndrome ciliary proteins perturbs planar cell polarity in vertebrates. Nat Genet 2005; 37(10):1135-40. 45. Gerdes JM, Liu Y, Zaghloul NA, Leitch CC, Lawson SS, Kato M, Beachy PA, Beales PL, DeMartino GN, Fisher S, Badano JL, Katsanis N. Disruption of the basal body compromises proteasomal function and perturbs intracellular Wnt response. Nat Genet 2007; 39(11):1350-60. 46. Badano JL, Kim JC, Hoskins BE, Lewis RA, Ansley SJ, Cutler DJ, Castellan C, Beales PL, Leroux MR, Katsanis N. Heterozygous mutations in BBS1, BBS2 and BBS6 have a potential epistatic effect on Bardet-Biedl patients with two mutations at a second BBS locus. Hum Mol Genet 2003; 12(14):1651-9. 47. Yen HJ, Tayeh MK, Mullins RF, Stone EM, Sheffield VC, Slusarski DC. Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Hum Mol Genet 2006; 15(5):667-77. 48. Loktev AV, Zhang Q, Beck JS, Searby CC, Scheetz TE, Bazan JF, Slusarski DC, Sheffield VC, Jackson PK, Nachury MV. A BBSome subunit links ciliogenesis, microtubule stability, and acetylation. Dev Cell 2008; 15(6):854-65. 49. Borovina A, Ciruna B. IFT88 plays a cilia- and PCP-independent role in controlling oriented cell divisions during vertebrate embryonic development. Cell reports 2013; 5(1):37-43. 50. Lessieur EM, Fogerty J, Gaivin RJ, Song P, Perkins BD. The Ciliopathy Gene ahi1 Is Required for Zebrafish Cone Photoreceptor Outer Segment Morphogenesis and Survival. Invest Ophthalmol Vis Sci 2017; 58(1):448-60. 51. Grimes DT, Boswell CW, Morante NF, Henkelman RM, Burdine RD, Ciruna B. Zebrafish models of idiopathic scoliosis link cerebrospinal fluid flow defects to spine curvature. Science 2016; 352(6291):1341-4. 52. Goldman D. Muller glial cell reprogramming and retina regeneration. Nature reviews Neuroscience 2014; 15(7):431-42.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
21
53. Hyde DR, Reh TA. The past, present, and future of retinal regeneration. Exp Eye Res 2014; 123:105-6.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
22
Figure Legends
Figure 1. Evidence of retinitis pigmentosa and reduced visual fields in the
proband (40 year old female). (A) Fundus photography showed optic disc pallor,
vascular constriction and bone spicule deposits. (B) Goldmann visual field
measurements of both eyes illustrate severely constricted visual fields.
Figure 2. Pedigree of the proband, her brother and their parents. (A) Targeted
variant analysis demonstrates the proband and her brother are both compound
heterozygous for the p.P134R and p.R275X variants. (B) Parental testing confirms the
variants are in trans with the mother and father carrying the p.P134R and p.R275X
variants, respectively.
Figure 3. Evidence of retinitis pigmentosa and reduced visual fields in the
proband’s brother, a 38 year old male. (A) Fundus photographs show a normal
appearing optic nerve and posterior pole; however, pigmentary changes with bony
spicules are seen in the inferior quadrants peripherally. (B) Goldmann visual field
measurements of both eyes found only mildly reduced visual fields.
Figure 4. The P134R and R275X mutations disrupt ciliary location BBS2 in HEK-
293T cells. Immunocytochemistry of HEK293-T cells expressing (A) wild-type BBS-V5
(B) BBSP134R-V5, or (C) BBSR275X-V5 mutant constructs using a monoclonal antibody
again acetylated tubulin (AcTub - green) to label the ciliary axoneme and polyclonal
antibodies against V5 (red) to label BBS-V5 fusion proteins. Nuclei are stained with
DAPI (blue). Arrows note the location of the primary cilium.
Figure 5. Mutation in bbs2 exon 4 causes a frame shift and premature truncation.
(A) Coding sequence alignment of the wild-type and bbs2lri82 alleles. A 15bp fragment
replaces “CTCT” from the wild-type allele, yielding a net 11-bp insertion and a frame
shift. Numbering is relative to the start codon. (B) Predicted structure the of the wild-
type and bbs2lri82 peptides. The bbs2lri82 mutant terminates after 58 frame-shifted
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
23
codons (red). (C) Lateral view of 5 dpf wild-type (top), bbs2+/lri82 heterozygotes (middle)
and bbs2lri82/lri82 homozygotes (bottom) that were verified by genotyping. No differences
could be observed. (D) Lateral view of a 10 month old wild-type (top) and bbs2-/-
homozygous mutant (bottom). Mutants are smaller and exhibit spinal curvature as
adults.
Figure 6. bbs2-/- zebrafish exhibit progressive cone degeneration. (A) Retinal
sections were immunostained at the indicated time points with the monoclonal antibody
zpr1 (green) to label cone inner segments (CIS), and with PNA (red) to label cone outer
segments (COS). (B) Quantification of cone inner segment length and cone outer
segment lengths at 5dpf, (C-D) Quantification of cone numbers and CIS and COS
lengths in 2.5 mpf and 6 mpf adults. (E) Retinas from 6 mpf animals immunostained for
zpr3 to label rod outer segments (ROS). (F) Quantified ROS length at 6 mpf. (G)
Retinal cryosections from 6 mpf animals were immunostained for PCNA to label
proliferating cells. (H) Quantification of PCNA+ cell counts at 6 mpf in the inner nuclear
layer (INL) and outer nuclear layer (ONL). Asterisks indicate statistically significant
differences, as determined by an unpaired t-test. *p<0.05; **p<0.01; ***p<0.001.
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint