© 2018. Published by The Company of Biologists Ltd.
Collaborative repressive action of the antagonistic ETS transcription factors Pointed and
Yan fine-tunes gene expression to confer robustness in Drosophila
Jemma L. Webber, Jie Zhang, Alex Massey, Nicelio Sanchez-Luege and Ilaria Rebay
Ben May Department for Cancer Research
University of Chicago
Chicago, Illinois 60637
Corresponding author:
Email: [email protected]
Key Words: gene regulatory network, cell fate specification, chromatin occupancy, mesoderm
development, RNA pol II pausing
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
http://dev.biologists.org/lookup/doi/10.1242/dev.165985Access the most recent version at First posted online on 30 May 2018 as 10.1242/dev.165985
Abstract
The acquisition of cellular identity during development depends on precise spatiotemporal
regulation of gene expression, with combinatorial interactions between transcription factors,
accessory proteins and the basal transcription machinery together translating complex signaling
inputs into appropriate gene expression outputs. The Drosophila ETS family transcription factors
Yan and Pointed, whose opposing repressive and activating inputs orchestrate numerous cell
fate transitions downstream of receptor tyrosine kinase signaling, provide one of the premier
systems for studying this process. Current models describe the differentiative transition as a
switch from Yan-mediated repression to Pointed-mediated activation of common target genes.
We describe here a new layer of regulation whereby Yan and Pointed co-occupy regulatory
elements to coordinately repress gene expression, with Pointed unexpectedly required for the
genome-wide occupancy of both Yan and the corepressor Groucho. Using even-skipped as a
test-case, synergistic genetic interactions between Pointed, Groucho, Yan and components of
the RNA polymerase II pausing machinery suggest Pointed integrates multiple scales of
repressive regulation to confer robustness. We speculate that this mechanism may be used
broadly to fine-tune the expression of many developmentally critical genes.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Introduction
Genetic and epigenetic mechanisms together produce the spatiotemporal gene expression
dynamics that drive accurate and robust developmental transitions. At the genetic level,
combinatorial codes of competing and collaborating transcriptional activators and repressors are
recruited to individual cis-regulatory enhancers to determine precise gene expression outputs
(Ma 2005; Bauer et al. 2010). Analogously at the epigenetic level, activating and repressive
marks facilitate open or closed chromatin states that respectively promote or preclude
expression, while more nuanced regulation can be achieved by the simultaneous presence of
activating and repressive marks (Reynolds et al. 2013; Lagha et al. 2012). For example, at
many developmentally important genes, specific combinations of inherently conflicting histone
modifications permit RNA pol II to initiate transcription but then stall, keeping gene expression
off yet poised for rapid activation (Schwartz et al. 2010; Gaertner et al. 2012). While chromatin
looping can physically coordinate the transcriptional complexes assembled at enhancers across
a locus with the promoter-proximal complexes that orchestrate RNA pol II pause and release,
the mechanisms by which these two layers of regulation are actually integrated to fine-tune
gene expression dynamics during development are just beginning to be elucidated (reviewed in
Gaertner and Zeitlinger 2014; Liu et al. 2015; Meng and Bartholomew 2017)
The Drosophila ETS transcriptional repressor Yan (also known as Anterior open (Aop),
Nüsslein-Volhard et al. 1984; Rogge et al. 1995) and activator Pointed (Pnt) provide a useful
model system for exploring how activator and repressor inputs are balanced to control
developmental gene expression. Genetic and biochemical analysis of several enhancer
elements, including the muscle heart enhancer (MHE) that drives the segmental pattern of
even-skipped (eve) expression in the cardiogenic mesoderm, has showcased competition
between Yan and Pnt for access to consensus ETS motifs as a mechanism for directing rapid
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
off-on gene expression transitions in response to upstream signals. Thus prior to signaling, Yan
outcompetes Pnt to repress target gene expression, thereby stabilizing the uncommitted
precursor state. Following pathway activation, Yan is targeted for rapid degradation, allowing
Pnt access to sites previously occupied by Yan. This turns on formerly repressed gene
expression programs to promote a differentiative transition (Brunner et al. 1994; Klaes et al.
1994; O’Neill et al. 1994; Rebay and Rubin 1995; Hsu and Schulz 2000).
The results of several recent studies have motivated us to reconsider the universality of this
regulatory mechanism with respect to all Yan target genes and to ask whether more
complicated Yan-Pnt interactions might also contribute to regulation of well-studied targets like
eve. First, ChIP-seq studies have shown that Yan occupies chromatin in broad stretches of
clustered peaks, binding preferentially to enhancers associated with developmentally important
genes and signaling pathway effectors (Webber et al. 2013a). Simple binary off-on regulation of
all of these putative targets seems unlikely. Second, a comparative survey of Yan and Pnt
protein expression throughout development revealed extensive co-expression, particularly in
tissues in which RTK signaling levels are presumed low (Boisclair Lachance et al. 2014). This
raises the possibility of more complicated interactions than might be needed if their expression
were always mutually exclusive as it is in the embryonic midline. Indeed, two recent studies
focused on eve highlight the importance of properly balanced Yan and Pnt repressive and
activating inputs at the MHE before, during and after a cell fate transition, and emphasize the
use of long-range interactions between the MHE and other Yan-bound elements as a
mechanism for ensuring robust regulation (Webber et al. 2013b; Boisclair Lachance et al. 2018).
How Yan-Pnt-mediated regulatory mechanisms might be coordinated with epigenetic
mechanisms that influence gene expression is not known.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
In this study we report the discovery of a completely unexpected role for Pnt in recruiting or
stabilizing Yan occupancy and repression at regulatory elements across the genome. In wild
type embryos, we find that Yan and Pnt have virtually identical genome-wide occupancy
patterns and that the two actually co-occupy individual enhancers. While the majority of Pnt
occupancy is Yan-independent, the majority of Yan occupancy is Pnt-dependent, a finding that
positions Pnt as an anchor with respect to establishing Yan occupancy and repression. Further
challenging the model of exclusive Yan-Pnt regulatory antagonism, gene expression analyses
predict that in addition to the classic opposing Pnt and Yan inputs at select targets, Yan and Pnt
together negatively regulate many target genes. Pnt also facilitates chromatin binding of the
TLE corepressor protein Groucho, raising the possibility of context-specific roles for Pnt as a
repressor. Focusing on the target gene eve, synergistic interactions between Pnt, Yan, Groucho
and factors associated with RNA polymerase II pausing fine-tune Eve expression to ensure
robust cell fate specification. We propose that the collaborative action of an opposing activator-
repressor pair establishes repressive complexes that collaborate with the pol II pausing
machinery to create a locus-wide poised state that both prevents spurious gene activation and
ensures timely induction of expression following signaling cues.
Results
Yan and Pnt co-occupy regulatory regions
To investigate how regulatory inputs from Yan and Pnt are integrated across their target gene
loci we used ChIP-Seq to generate a genome-wide map of Pnt-bound regions in stage 11
embryos and then compared it to that of Yan. The two occupancy profiles were strikingly similar,
including at loci of the known Yan/Pointed targets argos (aos), even-skipped (eve) and mae
(Figure 1A and Supplemental Figure 1A,B). Using high confidence bound regions identified with
the Model-Based Analysis of ChIP-Seq (MACS) peak-calling tool (Zhang et al. 2008), 82% of
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Yan-bound peaks overlapped with Pnt-bound peaks. In the instances when a peak was called
only in the Pnt dataset, visual inspection of the tag density pileups often revealed a
subthreshold accumulation of reads in the Yan sample (Supplemental Figure 1A,B). Consistent
with the similar binding landscapes, central motif enrichment analysis showed that the
consensus sequences recognized by Mothers against dpp (Mad) and ETS transcription factors
were the two most enriched motifs in Pnt-bound peaks (Supplemental Figure 1C), exactly as in
Yan-bound peaks (Webber et al. 2013a). Assigning Pnt-bound regions to the nearest gene
produced a list of genes with significant overlap to a similarly generated Yan target list, and thus
near identical enrichment of gene ontology (GO) terms (Supplemental Table 1 and
Supplemental Figure 1D).
Although Yan and Pnt are coexpressed extensively in stage 11 embryos (Boisclair Lachance et
al. 2014), we expected the overlapping occupancy profiles would reflect mutually exclusive Yan
or Pnt binding to specific enhancers, consistent with current understanding of their antagonistic
relationship. To assess this we selected a subset of bound regions whose ability to respond
appropriately to Pnt and Yan activating and repressive inputs had been previously
demonstrated in S2 cell transcriptional reporter assays (Webber et al. 2013a). To our surprise,
sequential ChIP (ChIP-reChIP) followed by qPCR revealed Yan-Pnt co-occupancy at six of the
seven regions tested (Figure 1B). This suggested that the mechanisms that organize Yan and
Pnt chromatin occupancy and contributions to gene expression regulation are more complicated
than previously assumed.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Pnt facilitates Yan recruitment across the genome
Yan-Pnt co-occupancy of an enhancer could result from either interdependent or independent
recruitment. Based on the accepted model of Yan and Pnt function in which Yan-mediated
repression maintains cells in an uncommitted progenitor-like state, we predicted that Yan would
be the more likely initiator, perhaps recruiting Pnt to poise bound target regions for subsequent
activation in response to signaling. We therefore first asked whether binding of Pnt to its target
regions depends upon Yan by examining Pnt chromatin occupancy in yan null mutant embryos.
In contrast to our predictions, the binding landscape of Pnt was broadly conserved in the
absence of Yan (Figure 1C,D and Supplemental Table 2), suggesting that Pnt recruitment
occurs primarily independently of Yan.
To determine if Yan recruitment was similarly independent of Pnt, we profiled Yan chromatin
occupancy in pnt null mutant embryos. In contrast to expectations, comparison of ChIP-seq
signal profiles revealed a global reduction in Yan occupancy (Figure 1E,F). This finding was
validated independently by ChIP-qPCR at all targets tested (Figure 1G). Indirect
immunofluorescence analysis confirmed comparable Yan protein levels in wildtype and pnt
mutant embryos (Supplemental Figure 2), ruling out the most trivial explanation for globally
reduced occupancy. In further support for a direct role for Pnt in facilitating Yan recruitment to
chromatin, Yan occupancy was preferentially reduced at regions identified as bound by both
Yan and Pnt versus regions identified as bound by Yan alone (Figure 1H). We conclude that Pnt
plays a critical and unexpected role in the recruitment and/or stabilization of Yan binding across
the genome.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Pnt collaborates with Yan to mediate repressive function
Yan’s unanticipated dependency upon Pnt for proper occupancy motivated us to consider a
non-canonical role for Pnt as a repressor, and a collaborative rather than antagonistic
relationship with Yan in this capacity. The central prediction was that the expression of genes
subject to such Pnt-Yan cooperative repression should increase upon loss of either Pnt or Yan.
To test this, we utilized an unpublished analysis of mRNA expression changes in pnt or yan
mutant embryos that we had performed with a custom Agilent microarray made with probes
from Yan-bound genes identified by ChIP (for ChIP targets see Webber et al. 2013a). Using a
P-value cutoff of <0.05, we first identified probes whose expression was significantly changed in
pnt mutants versus wildtype (Figure 2A) and then selected a handful of up- or down-regulated
targets for qPCR validation. Comparison of array and qPCR results revealed broad agreement
between the two datasets, confirming the overall quality of the array data (Figure 2B). As a
second point of validation, we asked whether mRNA levels of the known Yan/Pnt targets, aos,
mae and eve, exhibited the expected opposite response to loss of Pnt or Yan. Consistent with
expectation, expression of aos and mae was reduced in pnt mutants and increased in yan
mutants. In contrast, while eve levels were elevated in the absence of Yan, they were not
significantly changed in pnt mutants, a finding perhaps in keeping with the stochastic and rather
modest loss of Eve expression that has been described in pnt mutant embryos (Halfon et al.
2000).
Although a handful of studies have uncovered roles for Pnt in negatively regulating the
expression of genes, including hid in the embryo, yan in the eye disc and asense in the larval
brain (Kurada and White 1998; Rohrbaugh et al. 2002; Zhu et al. 2011), Pnt has been
characterized exclusively as a transcriptional activator (Klämbt 1993; Scholz et al. 1993;
Brunner et al. 1994; O’Neill et al. 1994; Gabay et al. 1996; Schwartz et al. 2010). We were
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
therefore intrigued by the set of genes upregulated in the pnt mutant. Although some of these
expression increases could reflect indirect regulation, because the genes used in the analysis
were selected based on chromatin occupancy, the approach should enrich for changes resulting
from loss of direct Pnt-mediated regulation. Focusing on genes with upregulated expression,
which would reflect loss of Pnt repressive inputs, we assessed their response to loss of Yan. If
Pnt’s ability to repress transcription depends on its ability to recruit Yan, then a similar set of
genes should be upregulated in both mutants; indeed, a strong positive correlation was
observed, with a R2 of 0.7 and P-value of <0.0001 (Figure 2C).
To gain insight into the developmental processes that might be regulated by coordinated Pnt-
Yan repression, we identified the ontologies of the upregulated genes using the PANTHER
classification system (Mi et al., 2013). Upregulated genes were enriched for categories
associated with muscle cell fate commitment and cardioblast differentiation. These GO terms
were absent from ontology analyses performed with downregulated genes (Supplemental Table
3). Considering these differences in light of the Yan and Pnt expression patterns in the st 11
embryo suggest that in the mesoderm, where Yan and Pnt are co-expressed and RTK signaling
levels are low (Gabay et al. 1997; Boisclair Lachance et al. 2014), the two collaborate as
repressors to stabilize the unspecified state.
Groucho is recruited to Yan and Pnt co-occupied regions
A second prediction of a model in which Pnt contributes repressive function to gene regulation is
that it should recruit co-repressor proteins, either directly or via its interaction with Yan. To
identify likely candidates, we examined the modENCODE database (Contrino et al. 2012;
wwww.modencode.org) to compare available corepressor genome-wide occupancy patterns to
those of Yan and Pnt. The binding landscape of the corepressor Groucho (Gro) immediately
stood out. Because the published datasets were not appropriately stage-matched to our work,
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
we performed ChIP-seq analysis of Groucho in stage 11 wild type embryos. The results
confirmed the similarity of the Gro binding landscape to that of Yan and Pnt. Intersecting high
confidence peaks of Gro with the Yan and Pnt datasets revealed a 54 and 37 percent overlap
respectively, and heatmap analysis of Yan/Pnt co-bound regions suggested even greater
overlap (Figure 3A).
To ask if proper Gro occupancy requires Pnt, we performed ChIP-seq analysis of Gro in a pnt
mutant background. Western blot analysis revealed no significant change in Gro protein levels
in pnt mutant versus wildtype embryos (Supplemental Figure 3A,B) and Gro occupancy was
only moderately affected at regions of the genome without nearby Pnt binding (Figure 3B,C). In
contrast, analogous to our finding of reduced Yan occupancy in pnt null animals, Gro binding
was reduced in regions of the genome where Gro and Pnt profiles normally overlap (Figure 3C).
Comparison of the ChIP-seq peaks suggested that loss of Gro occurred at regions that also
displayed reduced Yan occupancy in pnt null embryos. For example, Gro occupancy was lost
across the neuralized locus (Figure 3D), in patterns similar to those observed for Yan loss, but
was barely reduced at the turtle locus that does not bind Yan (Figure 3E). Plotting the ratio of
Groucho occupancy at bound regions in pnt mutants relative to the wildtype control confirmed
that the reduction of Gro in the absence of pnt is more severe at Yan and Groucho co-occupied
sites, than at sites that are not bound by Yan (Figure 3F). Taken together, these data indicate
that Pnt recruits both Gro and Yan to common regulatory elements, raising the possibility of
coordinated Yan-Pnt-Gro occupancy and repression of the associated target gene.
We tested this prediction by correlating gene expression changes in pnt mutant embryos with
the changes in Yan and Gro occupancy described above. Of the 320 genes associated with Yan
and Groucho occupancy loss in pnt mutants, 129 were represented in the custom microarray.
Of these, 107 were differentially expressed in the absence in of pnt, with 72% displaying
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
upregulated expression (Figure 3G). Using the converse approach, upregulated genes identified
in the microarray had reduced Yan and Groucho signal intensity in pnt mutants relative to WT;
this list included the validated Groucho target E(spl)mbeta-HLH (Supplemental Figure 3C and
4). We conclude that the loss of Yan and Groucho occupancy that occurs in pnt mutant embryos
reflects a novel mechanism by which Pnt recruits and collaborates with these two repressive
factors to negatively regulate expression at a significant subset of target genes.
Pnt mediates repressive inputs at eve
Having defined a novel role for Pnt in recruitment of Yan and Gro, we next asked how these
interactions influence expression at a specific locus. The heart identity gene eve provided an
ideal vantage point to do this because of the already deep mechanistic understanding of how
Yan repressive and Pnt activating inputs are organized at specific enhancers (Halfon et al.
2000; Webber et al. 2013b; Boisclair Lachance et al. 2018). In stage 11 embryos, Eve is
expressed in segmentally arrayed clusters of cells in the developing cardiogenic mesoderm.
Yan and Pnt exert antagonistic inputs at the level of a pattern-driving muscle heart enhancer
(MHE), such that in yan mutant embryos extra Eve+ cells are specified, while in pnt mutant
embryos, the number of Eve+ cells specified is reduced (Halfon et al. 2000). Additional
repressive input is provided via the D1, a Yan-responsive element whose deletion results in
elevated and more variable Eve expression (Webber et al. 2013b).
Matching the pattern of Yan occupancy (Webber et al. 2013a), tag density profiles of Pnt at the
eve locus revealed enrichment at both the D1 and MHE regulatory regions (Figure 4A); Pnt
occupancy at the D1, which genetically appears dedicated to dampening Eve expression
(Webber et al. 2013b), further supports the hypothesis of a role for Pnt in repressive regulation.
Analysis of the Yan genome-wide ChIP dataset in pnt mutant embryos suggested Pnt is
required for proper Yan occupancy at both the MHE and D1; ChIP-qPCR confirmed this
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
dependency (Figure 4B). To test whether Yan and Pnt are co-bound, we performed sequential
ChIP. While we were unable to detect co-occupancy at the eve MHE, simultaneous occupancy
was detected at the eve D1 region (Figure 4C). One explanation for the negative results at the
MHE is that we are simply below the detection threshold. Indeed both the genome-wide ChIP
data sets and the ChIP-qPCR confirmation experiments always show low enrichment at the
MHE, perhaps indicating Yan/Pnt occupancy/co-occupancy of this pattern-driving enhancer
occurs in only the small subset of mesodermal cells from which Eve+ pericardial cells are
specified. Alternatively, Yan and Pnt might co-occupy the D1 but not the MHE, with 3D
interactions enabling D1-bound Pnt to recruit/stabilize Yan occupancy at both the D1 and the
MHE. While further testing will be required to distinguish between these possibilities, in support
of the latter, long-range interactions between the D1 and MHE stabilize Yan occupancy at the
two elements (Webber et al. 2013b; Boiclair Lachance et al. 2018).
Because complete loss of pnt results in reduced Eve expression, we devised an alternate
genetic strategy to assess repressive function. We reasoned that embryos heterozygous for
Yan might provide a suitably sensitized background to reveal a role for Pnt-mediated repressive
regulation. We first assessed Eve expression levels in animals heterozygous for either yan or
pnt and compared these to Eve levels in double heterozygotes. The yan and pnt loss of function
alleles were fully recessive, with no significant change in Eve expression detected relative to
wildtype control (Figure 4D). In contrast, in yan/+;pnt/+ embryos, Eve levels were significantly
elevated and extra Eve+ cells were specified (Figure 4D,E). We repeated the experiment using
a functional Eve-YFP BAC transgene (Webber et al. 2013b) and again measured elevated Eve
levels in doubly heterozygous animals compared to single heterozygotes (Supplemental Figure
5). Together these data suggest a cooperative function for Yan and Pnt in negative regulation of
eve.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
We extended the dose-sensitive genetic interaction analysis to assess involvement of the
corepressor Gro, whose occupancy at both the eve MHE and D1 is reduced in the absence of
pnt (Figure 4A). Consistent with previous studies of Gro repressive input at eve (Helman et al.
2011), we observed increased Eve levels and extra Eve+ cells in gro/+ embryos; both
phenotypes were enhanced in pnt/gro doubly heterozygous animals (Figure 4D,E). We
conclude that Yan, Pnt and Gro work collaboratively to negatively regulate Eve levels and Eve+
cell fate specification in the cardiogenic mesoderm.
Pnt integrates with pausing machinery to maintain a poised state
The inherent conflict of recruiting both active and repressive histone marks to a given bound
region is characteristic of a balanced chromatin state, whereby genes are held silent, but poised
for transcriptional activation (Schwartz et al. 2010; Gaertner et al. 2012). Analogously at the
transcription factor level, co-occupancy by the activator-repressor pair Pnt/Yan could both
prevent inappropriate activation of eve under sub-threshold signaling conditions and prime the
locus for rapid transcriptional activation following the onset of upstream signaling. Meta-analysis
of publically available ChIP-seq data for three different chromatin modifications from 4-8hr
embryos, which includes the stage 11 time-point used in our ChIP experiments, provided
circumstantial evidence that eve may be poised. Specifically, the combination of negligible
H3K27ac, which exclusively marks active enhancers, prominent H3K4me1, a mark of both
poised and active enhancers, and prominent H3K27me3, a mark that in the absence of
H3K27ac indicates a poised state, suggests that the eve locus may be poised (Rada-Iglesias et
al. 2011; Bonn et al. 2012; Koenecke et al. 2017; and Figure 5A).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Poised genes commonly employ a RNA polymerase (pol) pausing strategy whereby RNA pol II
is recruited and initiates transcription, but then pauses downstream of the transcription start site
(TSS) until receiving the appropriate signaling cues for pause release (reviewed in Gaertner and
Zeitlinger 2014). Recent work from Drosophila cell lines implicates Groucho in RNA pol II
pausing (Kaul et al. 2014), an intriguing association given our discovery of a role for Pnt in
recruiting Gro, including to the eve MHE and D1 enhancers (Figs. 3D,E and 4A). Further, meta-
analysis of genome-wide ChIP datasets revealed frequent overlap between Yan and Pnt
occupancy patterns with those of components of the pausing machinery, including Trithorax-like
(Trl, also known as GAGA factor) and Bric à brac 1 (Bab1) (Figure 5B; Contrino et al. 2012; Tsai
et al. 2016). Focusing on eve, the locus bears hallmarks of pausing with high Pol II occupancy
near the TSS, together with low incidence of H3K4me3 and overlap with the pausing factor Trl (
Figure 5C; Contrino et al. 2012; Lee et al. 2008; Fuda et al. 2009 Gaertner et al. 2012; Tsai et
al. 2016).
Using eve as our model, we assessed genetic interactions between Pnt and members of the
pausing machinery. We first tested whether heterozygosity for either Trl or bab1 could influence
Eve expression and observed no significant change in Eve levels (Figure 6A). In contrast,
embryos doubly heterozygous for either pnt and Trl or pnt and bab1 displayed significantly
increased Eve levels with a corresponding increase in the number of Eve+ cells specified
(Figure 5A,B). Similar changes in Eve expression and number of Eve+ cells were observed in
embryos doubly heterozygous for either Trl and bab1 or yan/gro and Trl (Figure 6A,B and
Supplemental Figure 6). A trend towards increased Eve expression was also observed in
pnt/Nelf-E double heterozygotes, although the relative increase was not statistically different
from control, perhaps because of the maternal contribution of Nelf-E and/or the multi-subunit
nature of the NELF complex (Wang et al. 2010; Wu et al. 2005). Suggesting that interactions
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
between Pnt and the pausing machinery may play a broader role in development beyond eve,
survival to adulthood of animals doubly heterozygous for either pnt and Trl or pnt and bab1 was
half that of any of the three single heterozygotes (Figure 6C).
Discussion
The precision with which multipotent cells commit to specialized fates relies on regulated
derepression of gene transcription. Thus in stem cells and in early embryos, concomitant with
the initial opening of chromatin domains by pioneer factors, conflicting epigenetic marks
deposited at the promoters of many developmentally important genes recruit yet stall RNA pol II,
thereby maintaining repression and multipotency. How such epigenetic-based repressive
poising is coordinated with the transcription factors that respond to inductive cues to direct
specific cell fate transitions as development proceeds is not well understood. Our study
positions the ETS1 homolog and transcriptional activator Pointed (Pnt) as a key integration point
between the transcriptional repressive complexes that assemble at regulatory elements across
a locus and the molecular complexes that establish, maintain and release RNAPII pausing. The
results not only redefine the classic Yan-Pnt cell fate switch paradigm in Drosophila, but more
broadly uncovers a novel strategy by which genetic and epigenetic regulation is coordinated to
confer robustness to developmental cell fate transitions.
The accepted model for Yan and Pnt function predicts mutually exclusive occupancy at
enhancers, with RTK signaling triggering the transition from an initial Yan-bound repressed state
in uncommitted progenitors to a subsequent Pnt-bound activated state that drives cell fate
acquisition. Our study paints a different picture in which Pnt plays a role in establishing and
stabilizing that initial Yan-bound repressed state, and in fact co-occupies many regulatory
elements with Yan. It is important to note that because the sequential ChIP analysis was not
performed genome-wide and because whole embryos rather than single cells were profiled, it is
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
formally possible that Yan-Pnt co-occupancy only occurs at a small subset of targets and that
the broad similarity in overall occupancy patterns primarily reflects a mix of exclusively Yan or
exclusively Pnt binding at the same enhancers in different cells. Arguing against this, the
genome-wide loss of Yan occupancy in pnt mutants and normal Pointed occupancy in yan
mutants positions Pointed as the critical determinant and/or stabilizer of Yan binding and
repression, with co-occupancy likely relevant to the mechanism.
We therefore speculate that Pnt is required first to set up Yan occupancy and repression and
second to respond to RTK signaling by activating target gene expression; its activating function
is thus epistatic to its repressive role, explaining why predominantly loss of function phenotypes
have been described for pnt mutants. Use of the same transcription factor to dictate both the
repressive regulation that maintains the initial multipotent state and the subsequent activation
that changes it, enables a level of temporal coordination of gene expression dynamics that may
be critical to the robustness of differentiative transitions. We also note that although Yan/Pnt
function has been studied primarily in the context of RTK signaling, the two are co-expressed in
many tissues across development, including those presumed to have low RTK signaling input
(Gabay et al. 1997; Boisclair Lachance et al. 2014), and co-occupy regulatory elements across
a broad swath of signaling pathway genes and critical developmental regulators that are unlikely
all to be regulated downstream of RTK signaling. Thus Pnt-Yan-Gro enhancer co-occupancy
may provide a modular repressive mechanism that can be adapted to a variety of regulatory
situations.
How Pnt-Yan co-occupancy is organized/facilitated by the DNA sequence of each enhancer will
be interesting to explore. One possibility is that Pnt initially interacts with all ETS binding sites to
open up a regulatory element, but then gets displaced at a subset of sites upon recruitment of
Yan, perhaps remaining bound only at sites critical for subsequent activation. Alternatively,
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
distinct sequence preferences rather than affinity differences might result in Pnt occupancy of
only a specific subset of ETS binding sites, leaving others free for Yan to bind. This model also
supports a variation in mechanism in which Pnt and Yan are recruited jointly, rather than
sequentially, to establish the initial repressed state, with co-occupancy essential to stabilize Yan
binding. Our recent work exploring how the cis-regulatory organization of the eve muscle heart
enhancer (MHE) organizes Yan and Pnt inputs supports the idea that distinct sequence
preferences enable simultaneous occupancy and hence complex integration of repressive and
activating inputs (Boisclair Lachance et al. 2018).
The mechanism by which Yan occupancy depends on Pnt also remains to be elucidated. One
possibility is that Pnt recruits Yan directly. However to date our efforts to detect Yan-Pnt protein-
protein interactions, either in vitro, in two-hybrid screens, or in standard co-immunoprecipitation
experiments, have yielded negative results. Indirect protein-level interaction mechanisms, such
as bridging the complex with Gro or with another transcription factor, may thus be more likely.
The strong overlap between Mad and ETS binding sites noted in Yan/Pnt-bound regions
genome-wide (Webber et al., 2013a) makes the Dpp effector Mad an intriguing candidate.
Alternatively, rather than nucleating specific protein complexes, Pnt may establish or interpret a
local chromatin state that permits Yan binding. Analogous pioneer-like activity has been
described for a few other ETS factors including PU.1 and ETV2 (reviewed in Iwafuchi-Doi and
Zaret 2014; Kanki et al. 2017). As pnt encodes two alternatively spliced products, Pnt-P1 and
Pnt-P2, that contain the same DNA binding domain but different amino-terminal activation
domains and exhibit different patterns of expression and signal responsiveness (Klämbt 1993;
Scholz et al. 1993; O’Neill et al. 1994; Brunner et al. 1994; Gabay et al. 1996; Shwartz et al.
2013), it will be important to re-evaluate the role of each isoform during cell fate transitions with
respect to the establishment of Yan/Gro binding, target gene repression and the subsequent
switch to activation.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Independent of precise mechanism, Yan’s reliance on Pnt for its stable recruitment provides a
plausible explanation for a previous unexpected finding that doubling Yan dose does not lead to
increased or ectopic DNA occupancy (Webber et al. 2013a). More broadly, the strategy of the
activator recruiting the repressor could provide an occupancy feedback circuit that buffers
against fluctuations in activator or repressor concentrations. For example, the standard
competition model predicts that a multipotent cell with lower than normal Pnt will over-recruit
Yan; we speculate that such Yan-dominated repression would be sluggish in response to
inductive cues. In contrast, a system in which Yan occupancy depends on Pnt might be buffered
against such variation, since the consequence of lower Pnt levels would be less efficient Yan
recruitment, which should maintain the appropriate Yan-Pnt balance.
We speculate that this precisely poised Pnt-Yan-mediated repressive state is achieved through
close coordination with the RNA pol II pausing machinery (summarized in Figure 7). Several
pieces of evidence support this idea. For example, not only is Pnt essential for proper Yan
occupancy, but it also recruits the corepressor Gro to the same set of regulatory elements. Prior
genome-wide analyses of Groucho occupancy and function in embryos and cultured cells have
shown that Gro-regulated genes are enriched for epigenetic marks and promoter proximal
transcripts commonly associated with paused RNAPII (Kaul et al. 2014; Chambers et al. 2017).
Our demonstration of eve derepression in embryos doubly heterozygous for gro and Trl
provides the first genetic evidence of a possible direct mechanistic link between Gro repressive
complexes and the RNAPII pausing machinery. Our study also emphasizes the likely
importance of Pnt to the Gro-paused RNAPII connection. For example, included among the set
of genes showing coordinately disrupted Yan-Gro occupancy and derepression in pnt mutant
embryos is E(spl)mbeta-HLH, a target previously shown to be regulated by Gro-dependent
RNAPII pausing in cultured cells (Kaul et al. 2014 and Supplemental Figure 4).. The web of
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
synergistic genetic interactions between pnt, yan, gro and mutants in RNAPII pausing factors
like Trl, Bab1 and NELF further supports such a model.
RNAP II pausing establishment and release is also closely linked to Polycomb (PcG) repressive
complexes in both Drosophila and mammals (Schwartz et al. 2010; Gaertner et al. 2012;
Bernstein et al. 2006; Ferrai et al. 2017) and PcG repression has in turn been connected to
Groucho (Abraham et al. 2015). For example, a recent study describes how recruitment of the
Hox family transcriptional activators AbdA and Ubx reduces PcG binding at RNAPII paused
genes to promote release and transcriptional activation (Zouaz et al. 2017). Similarly ETS1, the
mammalian ortholog of Pnt, promotes release of paused RNAPII to activate angiogenic gene
expression, although connections to PcG complexes were not investigated (Chen et al. 2017).
Trl, which our study connects genetically to Pnt-Gro-Yan repressive mechanisms, helps direct
PcG proteins to Polycomb response elements, or PREs, and thus contributes to PcG repressive
activity (Mahmoudi et al. 2003; Mishra et al. 2003; Mulholland et al. 2003). Given that eve is a
PcG target gene, with a validated PRE (Dura and Ingham 1988; Fujioka et al. 2008; Kim et al.
2011), it may provide an ideal context for elucidating the molecular levels of integration between
Yan-Pnt-Gro and PcG repressive complexes in relation to RNA Pol II pausing.
In conclusion, we propose that analogous to the use of conflicting epigenetic marks to poise
RNAPII, the inherent conflict of co-occupancy by an activator-repressor pair like Pnt-Yan
establishes an exquisitely sensitive and dynamic repressive mechanism that confers robustness
to developmental gene expression regulation. Because loss or misexpression of ETS
transcription factors contributes to many cancers and because oncogenic transformation relies
on dysregulated use of normal developmental pathways, exploration of these ideas in
mammalian systems may provide new insight into human disease.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Materials and Methods
Chromatin immunoprecipitation
All ChIP was from Stage 11 embryos (5h20-7h20) processed as previously described (Webber
et al. 2013a) and summarized in supplementary methods. Sequential ChIP of Yan and Pnt was
performed by first immunoprecipitating Yan (guinea pig anti-Yan, (Webber et al. 2013a)). The
protein-DNA complex was eluted in reduced volume and diluted 10 times in ChIP lysis buffer
before performing the second round of ChIP with a rabbit GFP antibody (rabbit anti-GFP,
A6455, Invitrogen, Lot# 1603336). A no antibody control (mock-treated) processed identically to
experimental samples was included. For ChIP-seq, two biological replicates and an input
sample were sequenced on an Illumina Hi-seq instrument according to the Illumina protocols.
The raw sequence data was aligned to the April 2006 D. melanogaster genome using BWA (Li
and Durbin. 2009). Following standard practice in the field (Robertson et al. 2007; Rozowsky et
al. 2009; Zhong et al. 2010), having first confirmed consistency between replicates, the two IP
reads were combined and peak detection performed using MACS software with an mfold of 3,40
and otherwise default parameters. SPP was used to calculate genome-wide tag density profiles.
Default parameters were used, with the exception that scale.by.dataset.size=T option was used
to normalize tag density by the total dataset size to make it comparable across samples
(Kharchenko et al. 2008). ChIP-qPCR was performed as previously described (Webber et al.
2013a) and summarized in supplementary methods.
Microarray analysis
A custom expression array was designed on the Agilent GE 8x15K platform. The microarray
included 7080 probes for putative Yan target genes identified in Webber et al., 2013a (designed
using the Earray software by Agilent), 1894 probes for random genes and 536 control probes.
Total RNA was extracted from stage 11 wildtype, yan null or pnt null embryos with TRIzol
Reagent (Invitrogen) following manufacturer’s protocol, and purified using the RNeasy Mini Kit
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
(Qiagen). Total RNA was labeled and hybridized to the microarray using the Quick Amp One-
Color Labeling Kit (Agilent) as described by the manufacturer. Triplicate experiments for each
genotype were performed. Expression array data were first analyzed by the Feature Extraction
Software (Agilent) using default parameter settings, and the processed signals for the probes
were then used for downstream analysis. Linear models were generated for each array using
only the probes in the random gene set, and then signals were normalized across all arrays.
After normalization, the average signal for each probe across triplicate experiments of each
genotype was calculated, and signal fold changes between wild-type and the pnt or yan mutants
were computed. T-tests were performed at the probe level, and probes with a p-value less than
0.05 were selected as significant (Supplemental Table 4).
Tag density analysis and generation of heatmaps
Sorted bed files were produced using the BEDOPS wig2bed script (Neph et al. 2012). To
manage the large number of calculations, a Visual Basic Application (VBA) for Microsoft Excel
was used to generate matrices of read density data for groups of given bound regions +/- 5kb
from the midpoint of each individual region. The matrices were used for a) calculating ratios of
TF occupancy in mutant vs. wildtype b) producing aggregate read density profiles by averaging
read density across all peaks and c) generating TF binding heatmaps.
Differential binding analysis
Bed files of MACS defined bound regions and sequence aligned reads for WT and mutant
datasets for each factor were generated. The differential binding analysis software, MAnorm
(Shao et al. 2012), was used to generate a merged set of bound regions for each factor with
quantitative values of differential binding and associated P-values for each peak. These
datasets were used to describe patterns of peak gain or peak loss, where peak loss
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
corresponds to normalized M values of > 0.5 and peak gain of < -0.5 (Figure 1D,F,
Supplemental Tables 2 and 5).
Eve quantification
For quantification of Eve levels and numbers of Eve+ cells, embryos were stained as described
in Webber et al. 2013a with 1:10 mouse anti-Eve (3C10, Developmental Studies Hybridoma
Bank [DHSB]). Using a Zeiss 880 confocal microscope, serial 0.8µm z-sections were taken
through the Eve-positive mesodermal cells and maximum projections generated. Expression
intensity was calculated as the mean pixel intensity for each Eve+ cluster minus the mean
background pixel intensity, normalized to the average cluster intensity of the control imaged in
the same session. For cell counts, Eve+ cells were counted by going through Z-stack projections
of the relevant slices. For rescue experiments, stage 11 embryos of each genotype were hand-
selected, transferred to vials and incubated at 25C until adults emerged.
Drosophila strains and genetics
The following stocks were obtained from the Bloomington Drosophila Stock Center: w1118,
pnt∆88/TM3,Sb1, w1;Trl13C/TM6B,Sb1,Tb1 , Df(3L)babAR07,bab1AR07,bab2AR07/TM6B,Tb1 , y1,w67c23;
P{w+mC]y+mDint2=EPgy2}EY07065/TM3, Sb1,Ser1. Additional stocks used include: groMB36
(Jennings et al. 2008), pntAF397(Rebay et al. 2000), yanER443 and yanE833 (Karim et al. 1996), Pnt-
GFP (Boisclair Lachance et al. 2014) and Eve-YFP (Webber et al. 2013b). To allow genotyping
of stage 11 embryos, stocks were rebalanced over twist-Gal4>UAS-GFP marked 2nd and 3rd
chromosome balancers.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Data Availability
ChIP-seq and microarray data from this study have been deposited at GEO with accession
numbers GSE114092 and GSE114209 respectively.
Statistical Analysis
Data are presented as mean +/- SEM except where otherwise described and minimum sample
sizes are reported in each figure. Data were plotted and analyzed for statistical significance
using Graphpad Prism software. Statistical significance was determined either by a two-tailed t-
test where appropriate, or alternatively with a one-way ANOVA in combination with Tukey’s
multiple comparison tests to compare two or more groups. P-values less than 0.05 were
considered to be statistically significant.
Acknowledgements
We thank Pieter Faber, Mikayka Marchuk and Abhilasha Cheruku in the University of Chicago
Genomics Facility for help with ChIP-seq and microarray. Jean-Francois Boisclair Lachance,
Kohta Ikegami, Rebecca Spokony and Matthew Slattery provided many helpful discussions and
comments on the manuscript. We acknowledge the Bloomington Drosophila Stock Center (NIH
P40OD018537) and the Developmental Studies Hybridoma Bank (created by the NICHD of the
NIH) for critical reagents. This work was supported by American Heart Association Grants
#12POST12040225/Jemma Webber/2012-2014 and #15POST22660028/Jemma Webber/2015
to J.L.W., by NIH R01 GM080372 to I.R. and by the Genomics Core Facility through a
University of Chicago Cancer Center Support Grant P30 CA014599. N.S.L was supported in
part by NIH T32 GM007281 and by NIH R01 EY12549 to I.R.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
References
Abraham S, Paknikar R, Bhumbra S, Luan D, Garg R, Dressler GR, Patel SR. 2015. The
Groucho-associated Phosphatase PPM1B Displaces Pax Transactivation Domain
Interacting Protein (PTIP) to Switch the Transcription Factor Pax2 from a Transcriptional
Activator to a Repressor. J Biol Chem 290: 7185–7194.
Bauer DC, Buske FA, Bailey TL. 2010. Dual-functioning transcription factors in the
developmental gene network of Drosophila melanogaster. BMC Bioinformatics 11.
Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig
M, Plath K, et al. 2006. A bivalent chromatin structure marks key developmental genes in
embryonic stem cells. Cell 125: 315–326.
Boisclair Lachance J-F, Peláez N, Cassidy JJ, Webber JL, Rebay I, Carthew RW. 2014. A
comparative study of Pointed and Yan expression reveals new complexity to the
transcriptional networks downstream of receptor tyrosine kinase signaling. Dev Biol 385:
263–278.
Bonn S, Zinzen RP, Girardot C, Gustafson EH, Perez-Gonzalez A, Delhomme N, Ghavi-Helm
Y, Wilczyński B, Riddell A, Furlong EEM. 2012. Tissue-specific analysis of chromatin
state identifies temporal signatures of enhancer activity during embryonic development.
Nat Genet 44: 148–156.
Brunner D, Dücker K, Oellers N, Hafen E, Scholz H, Klämbt C. 1994. The ETS domain protein
pointed-P2 is a target of MAP kinase in the sevenless signal transduction pathway.
Nature 370: 386–389.
Chambers M, Turki-Judeh W, Kim MW, Chen K, Gallaher SD, Courey AJ. 2017. Mechanisms
of Groucho-mediated repression revealed by genome-wide analysis of Groucho binding
and activity. BMC Genomics 18.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5331681/ (Accessed March 9, 2018).
Chen J, Fu Y, Day DS, Sun Y, Wang S, Liang X, Gu F, Zhang F, Stevens SM, Zhou P, et al.
2017. VEGF amplifies transcription through ETS1 acetylation to enable angiogenesis.
Nat Commun 8: 383–383.
Contrino S, Smith RN, Butano D, Carr A, Hu F, Lyne R, Rutherford K, Kalderimis A, Sullivan J,
Carbon S, et al. 2012. modMine: flexible access to modENCODE data. Nucleic Acids Res
40: D1082–D1088.
Dura JM, Ingham P. 1988. Tissue- and stage-specific control of homeotic and segmentation gene
expression in Drosophila embryos by the polyhomeotic gene. Development 103: 733–
741.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Ferrai C, Torlai Triglia E, Risner-Janiczek JR, Rito T, Rackham OJ, de Santiago I, Kukalev A,
Nicodemi M, Akalin A, Li M, et al. 2017. RNA polymerase II primes Polycomb-
repressed developmental genes throughout terminal neuronal differentiation. Mol Syst
Biol 13: 946.
Fuda NJ, Guertin MJ, Sharma S, Danko CG, Martins AL, Siepel A, Lis JT. 2015. GAGA Factor
Maintains Nucleosome-Free Regions and Has a Role in RNA Polymerase II Recruitment
to Promoters. PLOS Genet 11: e1005108.
Fujioka M, Yusibova GL, Zhou J, Jaynes JB. 2008. The DNA-binding Polycomb-group protein
Pleiohomeotic maintains both active and repressed transcriptional states through a single
site. Dev Camb Engl 135: 4131–4139.
Gabay L, Scholz H, Golembo M, Klaes A, Shilo BZ, Klämbt C. 1996. EGF receptor signaling
induces pointed P1 transcription and inactivates Yan protein in the Drosophila embryonic
ventral ectoderm. Dev Camb Engl 122: 3355–3362.
Gabay L, Seger R, Shilo BZ. 1997. MAP kinase in situ activation atlas during Drosophila
embryogenesis. Development 124: 3535–3541.
Gaertner B, Johnston J, Chen K, Wallaschek N, Paulson A, Garruss AS, Gaudenz K, De Kumar
B, Krumlauf R, Zeitlinger J. 2012. Poised RNA Polymerase II changes over
developmental time and prepares genes for future expression. Cell Rep 2: 1670–1683.
Gaertner B, Zeitlinger J. 2014. RNA polymerase II pausing during development. Development
141: 1179–1183.
Halfon MS, Carmena A, Gisselbrecht S, Sackerson CM, Jiménez F, Baylies MK, Michelson
AM. 2000. Ras Pathway Specificity Is Determined by the Integration of Multiple Signal-
Activated and Tissue-Restricted Transcription Factors. Cell 103: 63–74.
Helman A, Cinnamon E, Mezuman S, Hayouka Z, Von Ohlen T, Orian A, Jiménez G, Paroush
Z. 2011. Phosphorylation of Groucho Mediates RTK Feedback Inhibition and Prolonged
Pathway Target Gene Expression. Curr Biol 21: 1102–1110.
Hsu T, Schulz RA. 2000. Sequence and functional properties of Ets genes in the model organism
Drosophila. Oncogene 19: 6409–6416.
Iwafuchi-Doi M, Zaret KS. 2014. Pioneer transcription factors in cell reprogramming. Genes
Dev 28: 2679–2692.
Jennings BH, Wainwright SM, Ish‐ Horowicz D. 2008. Differential in vivo requirements for
oligomerization during Groucho‐ mediated repression. EMBO Rep 9: 76–83.
Kanki Y, Nakaki R, Shimamura T, Matsunaga T, Yamamizu K, Katayama S, Suehiro J-I, Osawa
T, Aburatani H, Kodama T, et al. 2017. Dynamically and epigenetically coordinated
GATA/ETS/SOX transcription factor expression is indispensable for endothelial cell
differentiation. Nucleic Acids Res 45: 4344–4358.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Karim FD, Chang HC, Therrien M, Wassarman DA, Laverty T, Rubin GM. 1996. A Screen for
Genes That Function Downstream of Ras1 during Drosophila Eye Development.
Genetics 143: 315–329.
Kaul A, Schuster E, Jennings BH. 2014. The Groucho Co-repressor Is Primarily Recruited to
Local Target Sites in Active Chromatin to Attenuate Transcription. PLOS Genet 10:
e1004595.
Kharchenko PV, Tolstorukov MY, Park PJ. 2008. Design and analysis of ChIP-seq experiments
for DNA-binding proteins. Nat Biotechnol 26: 1351–1359.
Kim SN, Shim HP, Jeon B-N, Choi W-I, Hur M-W, Girton JR, Kim SH, Jeon S-H. 2011. The
pleiohomeotic functions as a negative regulator of Drosophila even-skipped gene during
embryogenesis. Mol Cells 32: 549–554.
Klaes A, Menne T, Stollewerk A, Scholz H, Klämbt C. 1994. The Ets transcription factors
encoded by the Drosophila gene pointed direct glial cell differentiation in the embryonic
CNS. Cell 78: 149–160.
Klämbt C. 1993. The Drosophila gene pointed encodes two ETS-like proteins which are
involved in the development of the midline glial cells. Dev Camb Engl 117: 163–176.
Koenecke N, Johnston J, He Q, Meier S, Zeitlinger J. 2017. Drosophila poised enhancers are
generated during tissue patterning with the help of repression. Genome Res 27: 64–74.
Kurada P, White K. 1998. Ras Promotes Cell Survival in Drosophila by Downregulating hid
Expression. Cell 95: 319–329.
Lachance J-FB, Webber JL, Hong L, Dinner A, Rebay I. 2018a. Cooperative recruitment of Yan
via a high-affinity ETS supersite organizes repression to confer specificity and robustness
to cardiac cell fate specification. Genes Dev.
http://genesdev.cshlp.org/content/early/2018/03/13/gad.307132.117 (Accessed March 22,
2018).
Lachance J-FB, Webber JL, Hong L, Dinner A, Rebay I. 2018b. Cooperative recruitment of Yan
via a high-affinity ETS supersite organizes repression to confer specificity and robustness
to cardiac cell fate specification. Genes Dev.
http://genesdev.cshlp.org/content/early/2018/03/13/gad.307132.117 (Accessed May 2,
2018).
Lagha M, Bothma JP, Levine M. 2012. Mechanisms of transcriptional precision in animal
development. Trends Genet TIG 28: 409–416.
Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast and memory-efficient alignment
of short DNA sequences to the human genome. Genome Biol 10: R25.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Lee C, Li X, Hechmer A, Eisen M, Biggin MD, Venters BJ, Jiang C, Li J, Pugh BF, Gilmour
DS. 2008. NELF and GAGA factor are linked to promoter-proximal pausing at many
genes in Drosophila. Mol Cell Biol 28: 3290–3300.
Liu X, Kraus WL, Bai X. 2015. Ready, Pause, Go: Regulation of RNA Polymerase II Pausing
and Release by Cellular Signaling Pathways. Trends Biochem Sci 40: 516–525.
Ma J. 2005. Crossing the line between activation and repression. Trends Genet 21: 54–59.
Mahmoudi T, Zuijderduijn LMP, Mohd-Sarip A, Verrijzer CP. 2003. GAGA facilitates binding
of Pleiohomeotic to a chromatinized Polycomb response element. Nucleic Acids Res 31:
4147–4156.
Meng H, Bartholomew B. 2017. Emerging Roles of Transcriptional Enhancers In Chromatin
Looping And Promoter-Proximal Pausing Of RNA Polymerase II. J Biol Chem.
Mishra K, Chopra VS, Srinivasan A, Mishra RK. 2003. Trl-GAGA directly interacts with lola
like and both are part of the repressive complex of Polycomb group of genes. Mech Dev
120: 681–689.
Mulholland NM, King IFG, Kingston RE. 2003. Regulation of Polycomb group complexes by
the sequence-specific DNA binding proteins Zeste and GAGA. Genes Dev 17: 2741–
2746.
Neph S, Kuehn MS, Reynolds AP, Haugen E, Thurman RE, Johnson AK, Rynes E, Maurano
MT, Vierstra J, Thomas S, et al. 2012. BEDOPS: high-performance genomic feature
operations. Bioinformatics 28: 1919–1920.
Nüsslein-Volhard C, Wieschaus E, Kluding H. 1984. Mutations affecting the pattern of the larval
cuticle inDrosophila melanogaster : I. Zygotic loci on the second chromosome. Wilhelm
Rouxs Arch Dev Biol 193: 267–282.
O’Neill EM, Rebay I, Tjian R, Rubin GM. 1994. The activities of two Ets-related transcription
factors required for Drosophila eye development are modulated by the Ras/MAPK
pathway. Cell 78: 137–147.
Rada-Iglesias A, Bajpai R, Swigut T, Brugmann SA, Flynn RA, Wysocka J. 2011. A unique
chromatin signature uncovers early developmental enhancers in humans. Nature 470:
279–283.
Rebay I, Chen F, Hsiao F, Kolodziej PA, Kuang BH, Laverty T, Suh C, Voas M, Williams A,
Rubin GM. 2000. A Genetic Screen for Novel Components of the Ras/Mitogen-Activated
Protein Kinase Signaling Pathway That Interact With the yan Gene of Drosophila
Identifies split ends, a New RNA Recognition Motif-Containing Protein. Genetics 154:
695–712.
Rebay I, Rubin GM. 1995. Yan functions as a general inhibitor of differentiation and is
negatively regulated by activation of the Ras1/MAPK pathway. Cell 81: 857–866.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Reynolds N, O’Shaughnessy A, Hendrich B. 2013. Transcriptional repressors: multifaceted
regulators of gene expression. Development 140: 505–512.
Robertson G, Hirst M, Bainbridge M, Bilenky M, Zhao Y, Zeng T, Euskirchen G, Bernier B,
Varhol R, Delaney A, et al. 2007. Genome-wide profiles of STAT1 DNA association
using chromatin immunoprecipitation and massively parallel sequencing. Nat Methods 4:
651.
Rogge R, Green PJ, Urano J, Horn-Saban S, Mlodzik M, Shilo BZ, Hartenstein V, Banerjee U.
1995. The role of yan in mediating the choice between cell division and differentiation.
Dev Camb Engl 121: 3947–3958.
Rohrbaugh M, Ramos E, Nguyen D, Price M, Wen Y, Lai Z-C. 2002. Notch Activation of yan
Expression Is Antagonized by RTK/Pointed Signaling in the Drosophila Eye. Curr Biol
12: 576–581.
Rozowsky J, Euskirchen G, Auerbach RK, Zhang ZD, Gibson T, Bjornson R, Carriero N, Snyder
M, Gerstein MB. 2009. PeakSeq enables systematic scoring of ChIP-seq experiments
relative to controls. Nat Biotechnol 27: 66.
Scholz H, Deatrick J, Klaes A, Klämbt C. 1993. Genetic dissection of pointed, a Drosophila gene
encoding two ETS-related proteins. Genetics 135: 455–468.
Schwartz YB, Kahn TG, Stenberg P, Ohno K, Bourgon R, Pirrotta V. 2010. Alternative
epigenetic chromatin states of polycomb target genes. PLoS Genet 6: e1000805.
Shao Z, Zhang Y, Yuan G-C, Orkin SH, Waxman DJ. 2012. MAnorm: a robust model for
quantitative comparison of ChIP-Seq data sets. Genome Biol 13: R16.
Shwartz A, Yogev S, Schejter ED, Shilo B-Z. 2013. Sequential activation of ETS proteins
provides a sustained transcriptional response to EGFR signaling. Dev Camb Engl 140:
2746–2754.
Tsai S-Y, Chang Y-L, Swamy KBS, Chiang R-L, Huang D-H. 2016. GAGA factor, a positive
regulator of global gene expression, modulates transcriptional pausing and organization
of upstream nucleosomes. Epigenetics Chromatin 9: 32.
Wang X, Hang S, Prazak L, Gergen JP. 2010. NELF Potentiates Gene Transcription in the
Drosophila Embryo. PLOS ONE 5: e11498.
Webber JL, Zhang J, Cote L, Vivekanand P, Ni X, Zhou J, Nègre N, Carthew RW, White KP,
Rebay I. 2013a. The Relationship Between Long-Range Chromatin Occupancy and
Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan. Genetics
193: 633–649.
Webber JL, Zhang J, Mitchell-Dick A, Rebay I. 2013b. 3D chromatin interactions organize Yan
chromatin occupancy and repression at the even-skipped locus. Genes Dev 27: 2293–
2298.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Wu C-H, Lee C, Fan R, Smith MJ, Yamaguchi Y, Handa H, Gilmour DS. 2005. Molecular
characterization of Drosophila NELF. Nucleic Acids Res 33: 1269–1279.
Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM,
Brown M, Li W, et al. 2008. Model-based Analysis of ChIP-Seq (MACS). Genome Biol
9: R137.
Zhong M, Niu W, Lu ZJ, Sarov M, Murray JI, Janette J, Raha D, Sheaffer KL, Lam HYK,
Preston E, et al. 2010. Genome-Wide Identification of Binding Sites Defines Distinct
Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental
Response. PLOS Genet 6: e1000848.
Zhu S, Barshow S, Wildonger J, Jan LY, Jan Y-N. 2011. Ets transcription factor Pointed
promotes the generation of intermediate neural progenitors in Drosophila larval brains.
Proc Natl Acad Sci 108: 20615–20620.
Zouaz A, Auradkar A, Delfini MC, Macchi M, Barthez M, Ela Akoa S, Bastianelli L, Xie G,
Deng W-M, Levine SS, et al. 2017. The Hox proteins Ubx and AbdA collaborate with the
transcription pausing factor M1BP to regulate gene transcription. EMBO J 36: 2887–
2906.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figures
Figure 1. Pnt recruits Yan to chromatin. A) Comparison of ChIP-seq read density for Pnt-
GFP (Pnt) and Yan across argos (aos), with RefGene gene track shown below profiles. * marks
region assessed by ChIP-qPCR. B) Sequential Yan-Pnt ChIP-qPCR analysis plotted as fold
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
increase relative to mock-treated control, normalized to a negative control region (NC1, Webber
et al., 2013a), using mean +/- SEM from two (cv2 and lace) or more separate experiments. C,E)
ChIP-seq read density profiles for Pnt-GFP and Yan from wildtype (WT) and yan or pnt mutant
embryos at neur. Red shading highlights an example of statistically significant reduction in Yan
occupancy. D,F) Pie charts showing the proportion of Pnt or Yan peaks gained or lost in the
reciprocal mutant background. G) ChIP-qPCR analysis of Yan occupancy at candidate target
regions from either control (wildtype) or pnt mutant embryos. Data from at least three separate
experiments are plotted as mean +/- SEM values normalized to a negative control region. H)
Comparison of ratios of Yan read density in pnt mutants relative to the wildtype control. Yan
bound regions that do not intersect with a Pnt-bound peak were less affected by loss of pnt than
peaks that intersect Pnt. P-value of <0.01 depicted by ** (Students t-test).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figure 2. Yan and Pnt negatively regulate gene expression. A) Volcano plot depicting fold
change in gene expression in a pnt mutant relative to wildtype versus P-value. Probes that pass
a P-value threshold for either up- or down-regulated expression are depicted in red and blue,
respectively. B) qPCR confirmation of gene expression changes detected in the microarray. Bar
charts depict mean +/- SEM of at least 3 independent experiments. C) Scatterplot shows a
strong correlation between differential gene expression in the yan and pnt datasets.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figure 3. Pnt recruits the corepressor Gro to Yan bound regions. A) Heatmap analysis of
Yan, Pnt-GFP (Pnt) and Groucho occupancy at the top 250 Yan/Pnt bound regions. Each row
represents an individual peak that spans 2kb, inversely sorted by ChIP-signal and centered
around each peak midpoint. B) Ratios of Groucho occupancy in pnt mutants relative to the
wildtype control show that Groucho bound regions that do not intersect with a Pnt-bound peak
were relatively unaffected by loss of pnt, whereas Groucho binding was reduced at regions
normally bound by Pnt. P-value of <0.0001 depicted by **** (Students t-test) C) Average signal
intensity plots show reduced Groucho occupancy occurs predominantly at peaks with wildtype
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Pnt binding. D,E) Read density profiles for Pnt-GFP, Groucho and Yan from wildtype or mutant
embryos at the neur and turtle (tutl) loci. Red highlighted regions contrast the coordinate loss of
Yan and Gro occupancy at neur in the absence of pnt with the lack of change in Gro at tutl
where Yan is not normally bound. F) Groucho peaks not bound by Yan are less significantly
reduced in pnt mutants than Groucho peaks that overlap Yan in wildtype conditions. P-value of
<0.0001 depicted by **** (Students t-test) G) The set of genes associated with both Yan and
Groucho peak loss in the pnt mutant is enriched for genes with significantly elevated expression
in the microarray.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figure 4. Yan, Pnt and Groucho collaborate to fine-tune eve expression A) Read density
profiles for Pnt-GFP, Groucho and Yan from wildtype or mutant embryos at the eve locus. Red
highlighting shows that Pnt-GFP occupancy is broadly maintained at the MHE and D1 in the
absence of Yan, whereas Yan and Gro occupancy is reduced at both elements in the absence
of Pnt. B) ChIP-qPCR analysis of Yan occupancy at the D1 and MHE in stage 11 wildtype or pnt
mutant embryos. Data from at least five separate experiments are plotted as +/- SEM values
normalized to a negative control region. C) Sequential ChIP detects Yan-Pnt co-occupancy at
the D1 but not at the MHE. Fold increase relative to mock-treated control and normalized to a
negative control region is plotted. Bars represent +/- SEM of at least 6 independent
experiments. D) Quantification of average Eve levels per cluster in different genetic
backgrounds. Box plots depict measurements from at least 70 clusters. P-values of <0.0001
and <0.001 are depicted by **** and *** respectively (Anova, Tukey’s multiple comparison test).
E) Bar charts depicting the frequency of clusters with different numbers of Eve+ cells from at
least 7 embryos.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figure 5. Chromatin marks and TF occupancy associated with the eve locus predict a
poised chromatin state A) The eve locus is associated with the poised chromatin signature
comprising H3K27me3 and H3K4me1 and depletion of H3K27ac. ChIP-seq profiles of
modEncode datasets (H3K27me3: Stage 4-8hr embryos, modEncode 811; H3K4me3: Stage 4-
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
8hr embryos, modEncode 778 and H3K27ac, Stage 4-8hr embryos, modEncode 835) were
visualized using IGB. Yan and Pnt ChIP datasets are shown for reference. The RefGene gene
track is shown below the profiles. Green boxes depict peaks called using IGB and a 97%
threshold. B) Trl and Bab1 are associated with Yan, Pnt and Gro bound regions. Aggregate
binding profiles of Trl (GAF: Stage 8-12 embryos, modEncode 3397) and Bab1 (Bab1: 0-12hr
embryos, modEncode 628) were generated for regions of the genome bound by Yan, Pnt and
Groucho. C) ChIP-seq profiles of Trl, H3K4me3 and RNApol II (GAF: Stage 8-12 embryos,
H3K4me3: Stage 4-8 hr embryos, modEncode 790; RNA pol II: Stage 4-8hr embryos,
modEncode 846) at the eve locus. Green boxes depict peaks called using a 97% threshold with
IGB.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figure 6. Pnt interacts with the pausing machinery to poise expression of eve A) Box plots
of relative Eve intensity measurements from at least 30 clusters. P-values of <0.0001 and
<0.001 are depicted by **** and *** respectively (Anova, Tukey’s multiple comparison test). E)
Bar charts depicting the frequency of clusters with different numbers of Eve+ cells from at least 3
embryos C) Adult survival rates of indicated genotypes, plotted as mean+/-SEM of at least three
independent experiments.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
Figure 7. Proposed model of Yan-Pnt repressive synergy Pnt promotes the recruitment and
stabilization of Yan and Gro and coordinates interactions with the RNA pol II pausing machinery
to maintain a poised state in progenitor cells. Following signaling cues, the disassembly of Yan,
Pnt and Gro complexes would release pol II pause and allow productive elongation. Such a
mechanism could act to sense the signaling status of the cell, ensuring that pol II pausing is only
released once a given signaling threshold is achieved, thereby conferring precise and perhaps
synchronous gene expression.
D
evel
opm
ent •
Acc
epte
d m
anus
crip
t
Supplemental Figure 1) Yan and Pnt ChIP-seq bound regions are highly
overlapping. A,B) Comparison of ChIP-seq read density for Pnt-GFP (Pnt) and Yan
across the argos and neuralized loci. The RefGene gene track is shown below the
profiles. Green boxes depict peaks called using the Integrated Genome Browser (IGB;
Affymetrix) using a cut-off of the top 3% of bound regions (97% threshold) as previously
described in Webber et al. 2013a. Purple boxes depict peaks called by MACS. C)
Analysis of transcription factor PWMs revealed central enrichment for Mad and ETS
motifs in the top 100 sequences bound by Pnt. D) Venn Diagram depicting GO terms
significantly overrepresented in Yan and Pnt datasets.
naYPF
Gt nP
80
60
Chr3L:16,463,000-16,478,000
aos
2kb
Threshold (97%)MACS
A
2kb
neurhyx
Chr3R:4,846,000-4,868,000
Threshold (97%)MACS
B
Threshold (97%)MACS
Threshold (97%)MACS
0.00050.00100.00150.00200.00250.00300.00350.00400.00450.0050
0.0000-250-200-150-100-50 0 50 100 150200 250
Position of Best Site in Sequence
ytilibaborP
ETS96BYan Mad
C
886243 175
Yan and Pnt Biological GO termsD
YanPnt
Webber_SuppFig1
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Figure 2) Yan protein levels in wildtype and pnt null embryos.
Embryos were fixed, stained and imaged in parallel with identical confocal settings.
Wildtype pnt mutant
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Figure 3) Gro occupancy is reduced in pnt mutants, while Gro
protein levels do not change. A) Gro protein level does not change in pnt null
embryos. B) Pixel intensity ratios of pnt mutant to wildtype for Gro and Tubulin. C) The
proportion of genes associated with Gro occupancy loss (<0.5), no change (0.5-1.5) and
occupancy gain (>1.5) were determined for i) all bound genes and ii) bound genes
associated with upregulated expression in a pnt mutant. Genes that are upregulated in
pnt mutants are more frequently associated with Gro peak loss relative to all Gro bound
regions.
_-tubulin
Groucho
wildtyp
e
pnt -/
-A
<0.5 0.5-1 1-1.5 1.5-2Ratio of Groucho read density (pnt mutant/wildtype)
B
Gro_-t
ubuli
n0
50
100
150
Back
grou
nd s
ubtra
cted
pixe
l int
ensi
ty wildtypepnt -/-
CAll bound genes (2748) Genes that are upregulated in a pnt mutant (210)
51%35%
8%4%
16%
55%
20%
7%
Webber_SuppF
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Figure 4) In the absence of pnt, Yan and Gro occupancy is reduced
at the E(spl)mbeta-HLH gene locus and unregulated expression is observed. A)
Comparison of ChIP-seq read density for Groucho and Yan across the E(spl)mbeta
locus. The RefGene track is shown below the profiles. B) Bar charts showing the
average upregulation of E(spl)mbeta-HLH probes from yan or pnt mutants relative to
WT. Error bars represent standard deviation of 4 probe sets.
AWebber_SuppFig4
Chr3R:21,828,000-21,838,000
250
250Groucho
WT
pnt
WT
pnt80
80
Yan
E(spl)mbeta-HLH
0
0.2
0.4
0.6
0.8
1
yan pnt
Log2
Fol
d C
hang
e (m
utan
t/wild
type
)
E(spl)mbeta-HLH
B
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Figure 5) yan and pnt collaborate to fine-tune eve expression. For
each genotype, the average pixel intensity of Eve-YFP expression was measured per
cluster of Eve-positive cells and the background pixel intensity was subtracted.
Measurements were normalized to the average wildtype cluster intensity. Animals
doubly heterozygous for yan and pnt were associated with increased cluster intensity
relative to the wildtype control and single heterozygotes (n = at least 4 embryos per
genotype; P<0.0005 yan/+;eve-YFP/+ and P<0.0001 yan/+;YFP,pnt/+, ANOVA).
eve-Y
FP/+
eve-Y
FP,pnt/+
yan/+;
eve-Y
FP/+
yan/+;
eve-Y
FP,pnt/+
0
1
2
3
4
Rel
ativ
e In
tens
ity o
f Eve
-YFP
A
*** ****
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Figure 6) yan and gro genetically interact with Trl. For each given
genotype, Eve expression was measured in each cluster of Eve-positive mesodermal
cells. An increase in Eve intensity was measured in animals heterozygous for both Trl
and either yan or gro relative to the single heterozygotes (n = at least 5 embryos; P
<0.05 yan/Trl; P<0.0005 gro/+ and P<0.0001 gro/Trl, ANOVA).
wtTrl
/+ya
n/+
yan/T
rlgro
/+gro
/Trl
0
1
2
3
4
Rel
ativ
e In
tens
ity o
f ev
e ex
pres
sion
A
**** ****
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Table 1) List of Pnt and Yan bound regions and associated genes. UCSC
Table browser (Karolchik et al. 2004) was used to assign each Pnt-GFP and Yan bound region
to the nearest gene.
Supplemental Table 2) MAnorm comparison of Pnt datasets. M = log2 (Pnt-GFP read
density wildtype/Pnt-GFP read density yan mutant) and A = 0.5 x log2 (Pnt-GFP read density
wildtype/Pnt-GFP read density yan mutant). A linear regression model was applied using peaks
common to both wildtype and yan mutant datasets (Shao et al. 2012b). This model was then
used to output normalized M value (Column E) and A value (Column F) and associated -log10 P-
value (Column G). Normalized M values were used as a readout for differential binding with M
values of >0.5 or <-0.5 denoting peak loss or gain, respectively. Using this cut-off, all
differentially bound regions have P-values <0.05.
Supplemental Table 3) Panther enrichment analysis of genes that are upregulated or
downregulated in pnt mutant embryos. Significant GO terms describing each gene set
(upregulated or downregulated genes) are listed, along with the fold enrichment over
background and associated P-value. Significant GO terms for each dataset were compared to
identify overlapping GO terms or uniquely enriched GO terms.
Click here to Download Table S1
Click here to Download Table S2
Click here to Download Table S3
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Table 5) MAnorm comparison of Yan datasets. M = log2 (Yan read density
wildtype/Yan read density pnt mutant) and A = 0.5 x log2 (Yan read density wildtype/Yan read
density pnt mutant). A linear regression model was applied using peaks common to both
wildtype and pnt mutant datasets (Shao et al. 2012b). This model was then used to output
normalized M value (Column E) and A value (Column F) and associated -log10 P-value (Column
G). Normalized M values were used as a readout for differential binding with M values of >0.5
or <-0.5 denoting peak loss or gain, respectively. Using this cut-off, all differentially bound
regions have P-values <0.05.
Supplemental Table 4) List of all probes with fold change (mutant/wildtype) and P-value.
Probes were assigned to genes using probe annotations from affymetrix and Flybase
(Gramates et al. 2017). A gene was considered as differentially expressed if it had an assigned
probe with a P-value <0.05 irrespective of fold change. Where two or more probes correspond
to the same gene, the highest absolute value (maximizing) was utilized for differential
expression analyses.
Click here to Download Table S4
Click here to Download Table S5
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental Methods
ChIP
Stage 11 embryos (5h20-7h20) were dechorionated in 50% bleach and cross-linked with
1.8% formaldehyde for 15 min. Cross-linking was stopped by washing embryos with
125mM Glycine. Fixed embryos were washed twice with PBS/T (PBS, 0.1% Triton X-
100) and Wash Solution (10mM HEPES, 10mM EDTA, 0.5mM EGTA, 0.25% Triton X-
100), and then homogenized in ChIP lysis buffer (50mM HEPES, 140mM NaCl, 1mM
EDTA, 1mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor
tablet (Roche)). Lysates were sonicated (11 cycles at 15% amplitude for 15 sec (0.9 sec
on/0.1 sec off)) using a Fisher Scientific Sonic Dismembrator sonicator. Clarified lysates
were incubated with the previously validated antibodies: guinea pig anti-Yan (1:500, in-
house, (Webber et al. 2013a)), rabbit anti-GFP (1:100, A6455, Invitrogen, Lot# 1603336,
(Yamaguchi et al. 2009)) or anti-Gro (1:200; (Nègre et al. 2011)) overnight at 4°C.
Gamma-bind sepharose beads (GE Healthcare) were added to the lysates and samples
were incubated for 4 hours, rotating at 4°C. The beads were washed thrice in ChIP lysis
buffer, once in high-salt ChIP lysis buffer and once in TE. ChIPed material was eluted by
a 15 min incubation at 65°C in TE/1% SDS with regular vortexing. Chromatin was
reverse cross-linked by incubation overnight at 65°C. DNA was purified using the
QIAquick PCR Purification Kit (Qiagen).
For ChIP experiments performed in a pnt mutant background, batches of 400 stage 11
GFP negative pnt null embryos were hand selected from embryo collections of either
pntAF397/TM3, twist-Gal4,UAS-GFP (TTG) or pnt∆88/TTG animals. Around 1600 pntAF397
embryos were used for each ChIP-seq replicate of Gro, and ~4000 pnt∆88 embryos for
each replicate of Yan.
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
ChIP-qPCR was performed using the QuantiTech SYBR Green PCR Kit (Qiagen).
Briefly, the relative amounts of input and immunoprecipitated DNA were determined
based on standard curves generated for each primer pair (sequences previously
published in (Webber et al. 2013a, 2013b)), and the ChIP signals were calculated as %
input. ChIP signals were normalized to a negative control region (NC1) to account for
any differences in starting material amount.
RT-PCR
Total RNA was isolated using TRIzol (Invitrogen, 15596018) according to the standard
protocol (http://www.flychip.org.uk/protocols/gene_expression/standard_extraction.pdf).
Purified RNA was resuspended in 16µl of RNAse-free dH20 and subjected to a 1 hour
DNase I (Invitrogen, 18068015) treatment at 37°C. 2µg of RNA was reverse transcribed
using the Promega Reverse Transcription System (A3500) in 20µl using oligo-dT primer.
Real-time PCR was performed using a 1:5 -1:10 dilution of cDNA with the StepOnePlus
Real-Time PCR system (Applied Biosystems). The following primers were utilized: aos 5’
GCATCCTCTACCAAGTGGGG and 3’ GCGATTCGATTCAGGACAACG; mae 5’
TATCAAATGCTGGACAAGTG and 3’ TCAGTCGATTGTTATTGTCG; eve 5’
CCTCTTGGCCACCCAGTA and 3’ CGGACTGGATAGGCATTC; aop 5’
CCAGCAACGAGGACTGTTATCC and 3’ AAGCGGCTACCTGGTGTT; pnr 5’
AGAAAACGGGAAGTGGTTCG and 3’ CTGAGCGAGGGTTTGAGATC
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
tinc 5’ ATCTGCATCTGAACTCGCTATG and 3’ TCCAGGGTATCAAAGAGCATCC; Adhr
5’ ACAAGAACGTGATTTTCGTTGC and 3’ ACGGTCACCTTTGGATTGATTG; IA2 5’
GCACTCCGAGGTCTGCTAC and 3’ CTTCTCAATGTCCTCAACGTC and RpS17 5’ 5'
CGAACCAAGACGGTGAAGAAG and 3’ CCTGCAACTTGATGGAGATACC.
ChIP-seq visualization and thresholding
Integrated genome browser was used to visualize wig files for each ChIP-seq dataset.
Thresholding of the top 3% of bound regions (97% threshold) was used to separate the
genome into bound and un-bound regions for each transcription factor.
Motif analysis
Centrimo analysis (Bailey and Machanick 2012) was performed on the top-scoring 100
Pnt ChIP-seq peaks identified by MACS. Each region was trimmed to 500bp around the
MACS defined summit. Sequences were scanned against a set of 1419 DNA motifs from
a combined database of Drosophila TF DNA binding sites (OnTheFly (Shazman et al.
2014), Fly Factor Survey (Zhu et al. 2011; http://pgfe.umassmed.edu/TFDBS), FLYREG
(Bergman et al. 2005), iDMMPMM and DMMPMM (Kulakovskiy and Makeev 2009;
Kulakovskiy et al. 2009)) with motif sites reported only when enriched.
GO analysis
MACS defined bound regions were assigned to the nearest TSS using the UCSC
genome browser. Genes were functionally classified with Gene Ontology terms using
GO (Ashburner et al. 2000; The Gene Ontology Consortium, 2017).
Assigning Yan/Gro peak loss to Pnt bound regions
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
To assess whether Yan and Gro peak loss occurs preferentially at Pnt bound regions,
the read density of Pnt at the midpoint of Yan MACS defined peaks was first determined
(see materials and methods for description of read density analysis; Table S5). Using a
read density threshold of 97% (see Supplemental Figure 1), these peaks were
categorized according to the absence or presence of Pnt (Figure 1H; Yan only or Yan
and Pnt bound). The pnt mutant to wildtype Yan density ratio was calculated and plotted
for each “Yan only” bound region or each “Yan and Pnt” bound region. An identical
approach was taken to assess pnt mutant to wildtype Gro density ratios at “Gro only” or
“Pnt and Gro” bound regions in Figure 3B, and at “Gro only” or “Yan and Gro” bound
regions in Figure 3F.
Aggregate Profiles of Trl and Bab1
Intersectbed was used to overlay Yan, Pnt and Gro bound regions (called using our 97%
thresholded method). Sorted bed files for the Trl and Bab1 datasets were produced
using the BEDOPS wig2bed script (Neph et al. 2012). A Visual Basic Application (VBA)
for Microsoft Excel was then used to generate matrices of read density data spanning
2kb either side of the midpoint of peaks identified as Yan/Pnt and Gro bound (available
on request). These matrices were then aggregated to produce average read density
profiles.
Integrating ChIP-seq and expression array data
We have considered a probe to be differentially expressed if its expression changes
between two treatments, regardless of fold change. This approach was taken to
maximize the degree of overlap between the ChIP-seq and microarray datasets,
ensuring adequate sample size for the downstream analyses presented in Fig. 3G and
Supplemental Figure 3C. Thus, a P-value of the expression change between wildtype
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
and yan or pnt mutants was calculated for each probe. Genes were considered to be
differentially expressed if they were associated with probes with P-values less than 0.05.
Determining whether Yan/Gro loss is associated with differential gene expression
For Figure 3G, MAnorm was used to first define regions of Yan loss. Regions with a
normalized M value >0.5 were selected as high-confidence peaks showing reduced Yan
occupancy. The read density of Gro was then determined at the midpoint of each of
these regions in WT and mutant datasets, and a ratio calculated. Regions were selected
as having reduced Yan and Gro occupancy if the M value was >0.5 and Gro ratio was
<0.5. These regions were then assigned to the nearest gene and cross-referenced to
genes in the microarray.
To assess Gro occupancy change at differentially expressed genes (Supplemental
Figure 3C), the genome coordinates of either i) genes associated with upregulated
probes (shaded red in Figure 2A) or ii) all genes bound by Groucho were determined
and cross-referenced with read densities of Groucho occupancy in both wildtype and pnt
mutant datasets. Ratios of Groucho occupancy in pnt mutants relative to the wildtype
control were calculated and used to bin genes into distinct categories of ratios of <0.5,
0.5-1, 1-1.5, or 1.5-2. For genes that were associated with multiple Gro peaks, the most
substantial wildtype peak was identified and used to assess the ratio of Gro read density
in the pnt mutant vs wildtype control.
Embryo staining and quantification
For Yan expression analysis, wildtype or pnt∆88 embryos were stained as described in
Boisclair-Lachance et al. 2014 with a guinea pig anti-Yan antibody (1:10,000 ; Webber et
al. 2013a). For Eve-YFP expression and quantification, w1118 females were crossed to
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
the following males i) eve-YFP ii) eve-YFP, pntAF397/TTG iii) yan833/CTG; eve-YFP as
previously described in Webber et al. 2013b. Embryos were fixed and stained as
described here, using an anti-GFP rabbit antibody (1:1000, A6455, Invitrogen, Lot#
1603336). For determining whether yan and gro genetically interact with Trl, w1118 or
Trl13C/TTG females were crossed to i) yanER443/CTG or ii) groMB36/TTG males (Jennings
et al. 2008). Embryos were fixed and stained as described in Materials and Methods,
using an anti-Eve mouse antibody (3C10; 1:10, DHSB). Secondary antibodies are from
Jackson ImmunoResearch: donkey anti-guinea pig-Cy3 (1:2000) or donkey anti-mouse-
Cy3 (1:2000).
A Zeiss 880 confocal microscope was used to take serial 0.8µm z-sections through
layers of the embryo where Yan or Eve are normally expressed, and maximum
projections generated. For Eve quantification, the mean pixel intensity for each individual
Eve-positive cluster in the bilateral embryo was determined using Image J. After
subtracting the mean background pixel intensity for each cluster, measurements for
each genotype were normalized to the average cluster intensity of the control that was
fixed, stained and imaged in parallel.
Western blot analysis
Stage 11 wildtype or pnt∆88 embryos were dechorionated in 50% bleach and
homogenized in 50µl of SDS sample buffer (250mM Tris-Cl, pH 8, 10% SDS, 50%
glycerol, 50% β-mercaptoethanol, 0.04% bromophenol blue). Samples were passed
through a 27G needle 10 times and boiled for 10 min prior to running on an 8% SDS-
PAGE gel. After transfer to PVDF, blots were probed with mouse anti-Gro (1:100;
DHSB) and anti-tubulin (1:2000; Sigma), which served as a loading control.
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Supplemental References
Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. 2000. Gene Ontology: tool for the unification of biology. Nat Genet. https://www.nature.com/articles/ng0500_25 (Accessed January 22, 2018).
Bailey TL, Machanick P. 2012. Inferring direct DNA binding from ChIP-seq. Nucleic Acids Res 40: e128–e128.
Bergman CM, Carlson JW, Celniker SE. 2005. Drosophila DNase I footprint database: a systematic genome annotation of transcription factor binding sites in the fruitfly, Drosophila melanogaster. Bioinformatics 21: 1747–1749.
Hu Y, Sopko R, Foos M, Kelley C, Flockhart I, Ammeux N, Wang X, Perkins L, Perrimon N, Mohr SE. 2013. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents. G3 Genes Genomes Genet 3: 1607–1616.
Jennings BH, Wainwright SM, Ish‐Horowicz D. 2008. Differential in vivo requirements for oligomerization during Groucho‐mediated repression. EMBO Rep 9: 76–83.
Kulakovskiy IV, Favorov AV, Makeev VJ. 2009. Motif discovery and motif finding from genome-mapped DNase footprint data. Bioinformatics 25: 2318–2325.
Kulakovskiy IV, Makeev VJ. 2009. Discovery of DNA motifs recognized by transcription factors through integration of different experimental sources. Biophysics 54: 667–674.
Nègre N, Brown CD, Ma L, Bristow CA, Miller SW, Wagner U, Kheradpour P, Eaton ML, Loriaux P, Sealfon R, et al. 2011. A Cis-Regulatory Map of the Drosophila Genome. Nature 471: 527–531.
Neph S, Kuehn MS, Reynolds AP, Haugen E, Thurman RE, Johnson AK, Rynes E, Maurano MT, Vierstra J, Thomas S, et al. 2012. BEDOPS: high-performance genomic feature operations. Bioinformatics 28: 1919–1920.
Shazman S, Lee H, Socol Y, Mann RS, Honig B. 2014. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites. Nucleic Acids Res 42: D167–D171.
Webber JL, Zhang J, Cote L, Vivekanand P, Ni X, Zhou J, Nègre N, Carthew RW, White KP, Rebay I. 2013a. The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan. Genetics 193: 633–649.
Webber JL, Zhang J, Cote L, Vivekanand P, Ni X, Zhou J, Nègre N, Carthew RW, White KP, Rebay I. 2013b. The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan. Genetics 193: 633–649.
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
Webber JL, Zhang J, Mitchell-Dick A, Rebay I. 2013c. 3D chromatin interactions organize Yan chromatin occupancy and repression at the even-skipped locus. Genes Dev 27: 2293–2298.
Yamaguchi A, Wu M-F, Yang L, Wu G, Poethig RS, Wagner D. 2009. The microRNA-regulated SBP-Box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1. Dev Cell 17: 268–278.
Zhu LJ, Christensen RG, Kazemian M, Hull CJ, Enuameh MS, Basciotta MD, Brasefield JA, Zhu C, Asriyan Y, Lapointe DS, et al. 2011. FlyFactorSurvey: a database of Drosophila transcription factor binding specificities determined using the bacterial one-hybrid system. Nucleic Acids Res 39: D111–D117.
Development 145: doi:10.1242/dev.165985: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion