Download - Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!
![Page 1: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/1.jpg)
Photo taken by http://flickr.com/people/mfsarwar/
Interoperability With BioMoby 1.0
It’s Better ThanSharing Your Toothbrush!
![Page 2: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/2.jpg)
A brief history of BioMoby• Model Organism Bring Your own Database Interface Conference,
Sept, 2001 (MOBY-DIC)
• May 21, 2002 – Genome Canada Platform Award
• May 25, 2002 – API Version 0.1 deployed, including object ontology serialization into XML
• July 18, 2002 – First Moby Client (Gbrowse Moby)
• June 9, 2003 – API Version 0.5 deployed
• 2006 – Genome Canada Platform Award
• 2007 - Version 1.0 API submitted for publication
![Page 3: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/3.jpg)
MOBY-DIC Chapter VII
7th Model Organism Bring Your-own Database Interface Conference
Vancouver, BC, June 2007.
![Page 4: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/4.jpg)
The Core Ahab’s
![Page 5: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/5.jpg)
WendyRichard
MylahMartin
Eddie
![Page 6: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/6.jpg)
Andreas
Paul
Ivan
Mark’s Screen…
![Page 7: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/7.jpg)
• Create an ontology of bioinformatics data-types• Define a serialization of this ontology (data syntax)• Create an open API over this ontology• Define Web Service inputs and outputs v.v. Ontology• Register Services in an ontology-aware Registry
• Machines can find an appropriate service• Machines can execute that service unattended• Ontology is community-extensible
The BioMoby PlanThe BioMoby Plan
![Page 8: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/8.jpg)
Gene names
MOBYCentral
MOBY hosts & services
SequenceAlignment SequenceExpress. Protein Alleles…
AlignPhylogenyPrimers
Overview of BioMoby Transactions
Overview of BioMoby Transactions
![Page 9: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/9.jpg)
MOBYCentral
SequenceAlignPhylogenyPrimers
Overview of BioMoby Transactions
Overview of BioMoby Transactions
Objectontology
What is a sequence?A sequence is a ___That has these features __
Discovery of servicesThat consume things LIKE sequences!
![Page 10: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/10.jpg)
![Page 11: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/11.jpg)
![Page 12: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/12.jpg)
![Page 13: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/13.jpg)
![Page 14: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/14.jpg)
![Page 15: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/15.jpg)
![Page 16: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/16.jpg)
![Page 17: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/17.jpg)
![Page 18: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/18.jpg)
![Page 19: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/19.jpg)
![Page 20: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/20.jpg)
![Page 21: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/21.jpg)
![Page 22: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/22.jpg)
![Page 23: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/23.jpg)
![Page 24: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/24.jpg)
![Page 25: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/25.jpg)
![Page 26: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/26.jpg)
This is SCUFL – Simple ConceptualUnified Flow Language
It is a complete record of everything you just did, and it can be saved for use in the Taverna workflow application that we will look at later…
![Page 27: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/27.jpg)
![Page 28: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/28.jpg)
Pipeline discovery “on the fly”
• No explicit coordination between providers
• Dynamic discovery of ~appropriate Services
• Automated execution of services
![Page 29: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/29.jpg)
Some BioMoby statistics
![Page 30: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/30.jpg)
Moby: Breadth
• Namespaces (data types): 418• Objects (data syntaxes): >561• Service Types (analytical categories): 112• Providers: ~50 active
• Service Instances: ~1200 currently “alive”– In main Moby Central server in Canada – Others in “boutique” Moby registries serving
specialized communities worldwide
![Page 31: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/31.jpg)
Moby: Clients• Gbrowse_moby (M Wilkinson)
• PlaNet Locus_View (H Schoof, R Ernst)
• Blue-Jay (P Gordon)
• Taverna (T Oinn, M Senger, E Kawas)
• MOWserv (INB, Spain)
• Remora (S Carrere, J Gouzy, INRA)
• MOBYLE (B Néron, P Tufféry, C Letondal, Pasteur Inst.)
• SeaHawk (P Gordon)
![Page 32: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/32.jpg)
BioMoby in detail
• MOBY Data typing system: Semantic Type
• MOBY Data typing system: Syntactic Type
• Moby Registry Queries
![Page 33: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/33.jpg)
BioMoby in detail
• MOBY Data typing system: Semantic Type
• MOBY Data typing system: Syntactic Type
• Moby Registry Queries
![Page 34: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/34.jpg)
Moby Namespaces
• A “Namespace” is a category of identifiers– NCBI has gi numbers (gi Namespace)– GO Terms have accession numbers (GO Namespace)
• Namespaces indicate data’s semantic type.– GO:0003476 a Gene Ontology Term– gi|163483 a GenBank record
• Though we are using the word “Namespace” correctly, it causes confusion!– “Namespace” in XML is tightly associated with an XML
document and/or its syntax– In Moby, we are ONLY talking about data entities NOT
THEIR SYNTAX
![Page 35: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/35.jpg)
BioMoby in detail
• MOBY Data typing system: Semantic Type
• MOBY Data typing system: Syntactic Type
• Moby Registry Queries
![Page 36: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/36.jpg)
BioMoby in detail
• MOBY Data typing system: Semantic Type
• MOBY Data typing system: Syntactic Type
• Moby Registry Queries
![Page 37: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/37.jpg)
The MOBY Object Ontology
• Syntactic types are defined by a GO-like ontology– Class name at each node– Edges define the relationships between Classes– GO used as a model because of its familiarity in the
community
• Edges define one of three relationships– ISA
• Inheritance relationship• All properties of the parent are present in the child
– HASA• Container relationship of ‘exactly 1’
– HAS• Container relationship with ‘1 or more’
![Page 38: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/38.jpg)
The Simplest Moby Data-Type
<Object namespace=‘NCBI_gi’ id=‘111076’/>
Object
The combination of a namespace and an identifier within that namespace uniquely identify a data entity, not its location(s), nor its representation
![Page 39: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/39.jpg)
Moby Primitives
Object
Integer
String
Float
DateTimeISA
ISA
ISA
ISA
<Integer namespace=‘’ id=‘’>38</Integer>
![Page 40: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/40.jpg)
A Derived Data-Type
Object
Integer
VirtualSequence
String
ISA
ISA
ISA
HASA
<Integer namespace=‘’ id=‘’>38</Integer><VirtualSequence namespace=‘NCBI_gi’ id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer></ VirtualSequence >
Describes the semanticrelationship between the Integer andthe Virtual Sequence
![Page 41: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/41.jpg)
<VirtualSequence namespace=‘NCBI_gi’ id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer></ VirtualSequence >
<GenericSequence namespace=‘NCBI_gi’ id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer> <String namespace=‘’ id=‘’ articleName=“SequenceString”>
ATGATGATAGATAGAGGGCCCGGCGCGCGCGCGCGC </String></ GenericSequence >
Object
Integer
VirtualSequence
String
ISA
ISA
ISA
HASA
GenericSequence
ISA
HASA
A Derived Data-Type
![Page 42: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/42.jpg)
<GenericSequence namespace=‘NCBI_gi’ id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer> <String namespace=‘’ id=‘’ articleName=“SequenceString”>
ATGATGATAGATAGAGGGCCCGGCGCGCGCGCGCGC </String></ GenericSequence >
<DNASequence namespace=‘NCBI_gi’ id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer> <String namespace=‘’ id=‘’ articleName=“SequenceString”>
ATGATGATAGATAGAGGGCCCGGCGCGCGCGCGCGC </String></ DNASequence >
Object
Integer
VirtualSequence
String
ISA
ISA
ISA
HASA
GenericSequence
ISA
HASA
DNASequence
ISA
A Derived Data-Type
![Page 43: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/43.jpg)
Legacy file formats
<NCBI_Blast_Report namespace=‘NCBI_gi’ id=‘115325’><String namespace=‘’ id=‘’ articleName=‘content’>
TBLASTN 2.0.4 [Feb-24-1998]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman(1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.
Query= gi|1401126 (504 letters)
Database: Non-redundant GenBank+EMBL+DDBJ+PDB sequences 336,723 sequences; 677,679,054 total letters
Searchingdone
Score ESequences producing significant alignments: (bits) Value
gb|U49928|HSU49928 Homo sapiens TAK1 binding protein (TAB1) mRNA... 1009 0.0emb|Z36985|PTPP2CMR P.tetraurelia mRNA for protein phosphatase t... 58 4e-07emb|X77116|ATMRABI1 A.thaliana mRNA for ABI1 protein 53 1e-05
</String></NCBI_Blast_Report>
• Containing “String” allows ontological classes to represent legacy data types
![Page 44: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/44.jpg)
Binaries – pictures, movies
<base64_encoded_jpeg namespace=‘TAIR_image’ id=‘3343532’><String namespace=‘’ id=‘’ articleName=‘content’>MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCCAv4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNVMIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCCAv4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNVBAgTDFdlc3Rlcm4gQ2FwZTESMBAGA1UEBxMJQ2FwZSBUb3duMQ8wDQYDVQQKEwZUaGF3dGUxHTAbBgNVBAsTFENlcnRpZmljYXRlIFNlcnZpY2VzMSgwJgYDVQQDEx9QZXJzb25hbCBGcmVlbWFpbCBSU0EgMjAwMC44LjMwMB4XDTAyMDkxNTIxMDkwMVoXDTAzMDkxNTIxMDkwMVowQjEfMB0GA1UEAxMWVGhhd3RlIEZyZWVtYWlsIE1lbWJlcjEfMB0GCSqGSIb3DQEJARYQamprM0Bt
</String>
</base64_encoded_jpeg>
• Text-base64 is a Class that contains String
• Binaries are base64 encoded and passed in classes that inherit from text-base64
• base64_encoded_jpeg ISA text/base64 ISA text/plain HASA String
![Page 45: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/45.jpg)
• With legacy data-types defined, we can extend them as we see fit• annotated_jpeg ISA base64_encoded_jpeg• annotated_jpeg HASA 2D_Coordinate_set • annotated_jpeg HASA Description
<annotated_jpeg namespace=‘TAIR_Image’ id=‘3343532’>
<2D_Coordinate_set namespace=‘’ id=‘’ articleName=“pixelCoordinates”> <Integer namespace=‘’ id=‘’
articleName=“x_coordinate”>3554</Integer> <Integer namespace=‘’ id=‘’ articleName=“y_coordinate”>663</Integer>
</2D_Coordinate_set>
<String namespace=‘’ id=‘’ articleName=“Description”>This is the phenotype of a ufo-1 mutant under long daylength,
16’C</String><String namespace=‘’ id=‘’ articleName=“content”>MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCC
Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNV
</String></annotated_jpeg>
Extending legacy datatypes
![Page 46: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/46.jpg)
The same object…
<annotated_jpeg namespace=‘TAIR_Image’ id=‘3343532’>
<2D_Coordinate_set namespace=‘’ id=‘’ articleName=“pixelCoordinates”> <Integer namespace=‘’ id=‘’ articleName=“x_coordinate”> 3554 </Integer> <Integer namespace=‘’ id=‘’ articleName=“y_coordinate”> 663 </Integer> </2D_Coordinate_set>
<String namespace=‘’ id=‘’ articleName=“Description”>This is the phenotype of a ufo-1 mutant under long daylength, 16’C
</String> <String namespace=‘’ id=‘’ articleName=“content”>
MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCCAv4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNV
</String></annotated_jpeg>
annotated_jpeg ISA base64_encoded_jpeg HASA 2D_Coordinate_set HASA Description
![Page 47: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/47.jpg)
The same object…
<annotated_jpeg namespace=‘TAIR_Image’ id=‘3343532’>
<2D_Coordinate_set namespace=‘’ id=‘’ articleName=“pixelCoordinates”>
<Integer namespace=‘’ id=‘’ articleName=“x_coordinate”> 3554 </Integer> <Integer namespace=‘’ id=‘’ articleName=“y_coordinate”> 663 </Integer> </2D_Coordinate_set> <String namespace=‘’ id=‘’ articleName=“Description”>
This is the phenotype of a ufo-1 mutant under long daylength, 16’C </String> <String namespace=‘’ id=‘’ articleName=“content”>
MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1U
</String></annotated_jpeg>
<CrossReference><Object namespace=“TAIR_Allele” id=“ufo-1”/>
</CrossReference>
<CrossReference> <Object namespace=‘TAIR_Tissue’ id=‘122’/> </CrossReference>
annotated_jpeg ISA base64_encoded_jpeg HASA 2D_Coordinate_set HASA Description
![Page 48: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/48.jpg)
Cross reference types
• Simple– A MOBY Object
• Rich– Takes the form:
– …Incidentally, this avoids the problem of reification that is experienced in RDF
<Xref namespace='' id='' authURI='' serviceName='' evidenceCode='' xrefType=''><Xref namespace='' id='' authURI='' serviceName='' evidenceCode='' xrefType=''> ... Textual Description ...... Textual Description ... </Xref></Xref>
<Object namespace=‘foo' id=‘12345‘/><Object namespace=‘foo' id=‘12345‘/>
![Page 49: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/49.jpg)
XML Schema?
The Object Ontology allows new data-types WITHOUT new flatfile formats, and
without having to understand e.g. XML Schema
Minimize future heterogeneity
Improve interoperability without requiring schema-to-schema mapping
![Page 50: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/50.jpg)
• Object Ontology terms have semantically rich names, but this is primarily for human intuition– DNA Sequence– Annotated_GIF
• Object Ontology does not define the meaning of an object to the machine– No machine-readable semantics
• It does define the representation – SYNTAX
XML Schema?
![Page 51: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/51.jpg)
A portion of the MOBY-SObject Ontology
…community-built!
![Page 52: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/52.jpg)
BioMoby in detail
• MOBY Data typing system: Semantic
Type
• MOBY Data typing system: Syntactic
Type
• Moby Registry Queries
![Page 53: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/53.jpg)
A Moby Central Query
• Give me:
– Services that consume THIS data-type in THIS syntax…
– …do SOMETHING LIKE THIS to it…
– …and provide me THAT data-type in response
![Page 54: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/54.jpg)
Example
• Find me services that – consume FASTA sequence data, – do a BLAST with it, – and provide me lists of GenBank GI numbers in
return.
• Query can be any or all of the above criterion– Also limit by service provider and service
description keyword
![Page 55: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/55.jpg)
Remember!!
Moby Registry Query
INPUT TYPE||
TRANSFORMATION TYPE||
OUTPUT TYPE
![Page 56: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/56.jpg)
A weakness of MOBY
Service discovery is horribly flawed due to insufficiently rich semantics…
![Page 57: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/57.jpg)
Chickens go in;Pies come out!
The problem with Moby
![Page 58: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/58.jpg)
The problem with Moby
What sort o’ pies?
![Page 59: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/59.jpg)
Apple!
The problem with Moby
![Page 60: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/60.jpg)
The MOBY-S Service Ontology
• A simple ISA hierarchy… – too simple!
• Primitive types include:– Analysis– Parsing– Registration– Retrieval– Resolution– Conversion– Rendering
![Page 61: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/61.jpg)
Parse_WU_Blast
A slice of the Service Ontology
Service
Blast
NCBI_Blast
WU_Blast
Parse_NCBI_Blast
Parsing
AlignmentAnalysis
“The Exploding Bicycle”- A. Rector, U Manchester
![Page 62: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/62.jpg)
Summary so far
• BioMoby uses ontologies to describe both data types and data syntaxes– This is where the interoperability comes from– These are used to match consumers with
providers during service discovery
• BioMoby uses a simple ontology to describe bioinformatics operations– This ontology is only marginally useful
![Page 63: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/63.jpg)
Seahawk
• Highlight data in your browser and drag/drop it into Moby
• What could be easier than that?!
Paul MK Gordon and Christoph W Sensen BMC Bioinformatics 2007, 8:208
![Page 64: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/64.jpg)
BMC Bioinformatics, in press
Seahawk: A New Moby Client for Biologists
Drag ‘n’ drop, highlight existing data for use with MOBY ServicesPaul Gordon & Christoph Sensen
![Page 65: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/65.jpg)
Seahawk looks like a browser
![Page 66: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/66.jpg)
How do I load data?
![Page 67: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/67.jpg)
How do I load data?
![Page 68: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/68.jpg)
How do I load data?
• Use the “open” button:– Text file (e.g. FASTA sequences)– HTML page (e.g. NCBI Entrez Web page)– RTF document (e.g. conference abstract)– MOBY XML document
• Drag ‘n’ Drop– Web links and desktop files– Highlighted text from open documents
or Web pages
![Page 69: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/69.jpg)
Under the Hood(Beneath the Bonnet?)
• Data has to be converted into Moby XML format to be used by Moby
• Moby data has to be converted back to human-readable text for presentation to the biologist
![Page 70: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/70.jpg)
Again: How do I load data?
![Page 71: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/71.jpg)
How do I Find Services?• Right-click MOB rules are invoked• Resulting Moby XML is used for service search
![Page 72: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/72.jpg)
How do I run a service?
• Click it!
• If necessary, a service’s extra parameters can be set
• Control+click submits using default params
![Page 73: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/73.jpg)
How do I run a service?
• If required inputs are missing, the missing ones must be dragged into place.
• Unrecognized data will be rejected
![Page 74: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/74.jpg)
How do I collate data?
• Seahawk clipboard lets you build collections of objects
• Seahawk “knows” the type of collection and will suggest appropriate Moby services
![Page 75: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/75.jpg)
Seahawk Summary
• Seahawk integrates Moby Web Service discovery and execution into the biologists day-to-day “Web Surfing” activity
• It uses Regular Expressions and XSLT to move normal web or hard-drive-file data into and out of BioMoby
![Page 76: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/76.jpg)
Why doesn’t MobyUse RDF/OWL?
![Page 77: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/77.jpg)
Timeline of Moby/W3C Activities
2000 2001 2002 2003 2004 20062005
RDF CandidateSpec
RDF SchemaCandidateSpec
W3C Launches SemanticWeb (SW) Activity Group
BioMobyProject Established
BioMoby XMLFinalized
BioMobyStable 0.85 APIPublished(>400 services)
RDF/OWLFormal W3CRecommendations
BioMobyStable 1.0 APIPublished
>>>>>>
Extensive SW toolbuilding…
![Page 78: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/78.jpg)
Moby 2.0Getting it right, the second time!
![Page 79: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/79.jpg)
What BioMoby Already Does
SequenceData
BLAST SERVER
Blast Hit
![Page 80: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/80.jpg)
What BioMoby Already Does
SequenceData
Blast Hit
givesBlastResult
Not “Bologically” Meaningful
![Page 81: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/81.jpg)
What BioMoby Already Does
SequenceData
Blast Hit
hasHomologyTo
URIhasHomologyTo
URI
…looks a lot like…
Which is effectively just an RDF triple,
![Page 82: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/82.jpg)
Now think in reverse…
![Page 83: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/83.jpg)
(in case you forgot…)
Moby Registry Query
INPUT TYPE||
TRANSFORMATION TYPE||
OUTPUT TYPE
![Page 84: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/84.jpg)
Moby 2.0Sequence
DataWhat does Have homology to?
hasHomologyTo
Maps to
BLAST SERVICE
Send data
Blast Hit
![Page 85: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/85.jpg)
Query
FIND SERVICES THAT
Consume Sequence Data||
Provide hasHomologyTo Property||
Attached to other Sequence Data
![Page 86: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/86.jpg)
SPARQL
• A Semantic Web query language
• Queries “look like” graphs
Find “X” with predicate “Y”
attached to “Z”
![Page 87: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/87.jpg)
Moby 2.0 extends the SPARQL query language
• SPARQL queries contain concepts and the relationships between them (subject, predicate, object)
• We simply map RDF predicates onto Moby services capable of generating that relationship
• Registry query: “What Moby service consumes [subject] and generates the [predicate] relationship type?”
![Page 88: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/88.jpg)
But wait, there’s more!
![Page 89: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/89.jpg)
Exploit knowledge in OWL ontologies to enhance query
Subject Predicate Look up and execute Moby serviceConsumes proteins and generatesFunctional annotation info
Subject PredicateLook up and execute Moby serviceConsumes STK or proteins and Looks-up inhibitor molecules
Evaluate Query Expression
![Page 90: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/90.jpg)
Exploit knowledge in OWL ontologies to enhance query
This SPARQL query could be posed on a database of RAW, UNANNOTATEDProtein sequences, and be answered
by Moby 2.0 (a.k.a. CardioSHARE)
![Page 91: Photo taken by Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush!](https://reader035.vdocuments.net/reader035/viewer/2022062804/56649d2a5503460f949feecb/html5/thumbnails/91.jpg)
Credits
• Genome Canada/Genome Alberta• myGrid – Carole Goble in particular• Spanish National Institute for
Bioinformatics (INB) through Fundación Genoma España
• Generation Challenge Programme (GCP) of the Consultative Group for International Agricultural Research (CGIAR)
• Heart and Stroke Foundation of BC and Yukon (CardioSHARE)
• Microsoft Research (CardioSHARE)