Protein Arginine Methyltransferase 4 (PRMT4) mediates lymphopenia in experimental sepsis.
Yandong Lai1#, Xiuying Li2#, Tiao Li1, Yan Chen3, Chen Long4, Toru Nyunoya2, Kong Chen1, Georgios D.
Kitsios1, Seyed Mehdi Nouraie1, Yingze Zhang1, Bryan J. McVerry5, Janet S. Lee6, Rama K. Mallampalli7#,
and Chunbin Zou8#*.
1: Division of Pulmonary, Allergy, Critical Care Medicine, Department of Medicine, University of
Pittsburgh School of Medicine, Pittsburgh, PA, USA.
2: Division of Pulmonary, Allergy, Critical Care Medicine, Department of Medicine, University of
Pittsburgh School of Medicine, Pittsburgh, PA, USA; Veterans Affairs Pittsburgh Healthcare System,
Pittsburgh, PA, USA.
3: Division of Pulmonary, Asthma, Critical Care Medicine, Department of Medicine, University of
Pittsburgh School of Medicine, Pittsburgh, PA, USA; Current address: Department of Respiratory
diseases, The Second Xiangya Hospital, Central South University, Changsha, Hunan, China.
4. Division of Pulmonary, Asthma, Critical Care Medicine, Department of Medicine, University of
Pittsburgh School of Medicine, Pittsburgh, PA, USA; Current address: Department of Minimally Invasive
Surgery, The Second Xiangya Hospital, Central South University, Changsha, Hunan, China.
5: Division of Pulmonary, Allergy, Critical Care Medicine, Department of Medicine; Vascular Medicine
Institute, School of Medicine; Department of Environmental and Occupational Health, Graduate School
of Public Health, University of Pittsburgh; Pittsburgh, PA;
6: Division of Pulmonary, Allergy, Critical Care Medicine; Vascular Medicine Institute, University of
Pittsburgh, Pittsburgh, PA, USA
7: Division of Pulmonary, Allergy, Critical Care Medicine, Department of Medicine, University of
Pittsburgh School of Medicine, Pittsburgh, PA; Department of Medicine, Ohio State University College of
Medicine, Columbus, OH, USA.
8: Division of Pulmonary, Allergy, Critical Care Medicine, Department of Medicine, School of Medicine;
Department of Environmental and Occupational Health, Graduate School of Public Health, University of
Pittsburgh; Veterans Affairs Pittsburgh Healthcare System, Pittsburgh, PA, USA.
#: those authors equally contributed to the study.
*: To whom correspondence should be addressed:
Chunbin Zou, MD, PhD., Pulmonary, Allergy and Critical Care Medicine, Montefiore UH NW628, 3459
Fifth Avenue, The University of Pittsburgh, Pittsburgh, PA 15213 Tel.: (412)-624-4404; E-mail:
The authors declare no interest conflict with this manuscript.
Key words: T cell, cell death, PRMT4, FBXO9, ubiquitin proteasome degradation, immunosuppression,
sepsis.
Running title: Impaired PRMT4 stability causes T cell death.
Abstract
One hallmark of sepsis is a reduced number of lymphocytes, termed lymphopenia, that occurs from
decreased lymphocyte proliferation or increased cell death contributing to immune suppression.
Histone modification enzymes regulate immunity by epigenetically modulating chromatin architecture,
however, the role of these enzymes in lymphopenia remains elusive. In this study, we identified that a
chromatin modulator Protein Arginine N-methyltransferase 4/Coactivator-Associated Arginine
Methyltransferase 1 (PRMT4/ CARM1) that is elevated systemically in septic patients and experimental
sepsis, and is crucial for inducing T-lymphocyte apoptosis. An E3 ubiquitin ligase SCFFBXO9 docks on
PRMT4 via a phosphodegron to ubiquitinate the protein at K228 for ubiquitin proteasomal degradation.
High PRMT4 expression resulted from reduced levels of SCFFBXO9 that led to increased lymphocyte cell
death after Escherichia coli or lipopolysaccharide (LPS) exposure. Ectopic expression of PRMT4 protein
caused substantial lymphocyte death via caspase 3 mediated cell death signaling, and knockout of
PRMT4 abolished LPS mediated lymphocyte cell death. PRMT4 inhibition with a small molecule
compound attenuated lymphocyte death in complementary models of sepsis. These findings
demonstrate a previously uncharacterized role of a key chromatin modulator in lymphocyte survival that
may shed light on devising unique therapeutic modalities to lessen severity of septic
immunosuppression.
Introduction
Immunosuppression, i.e. “immune paralysis”, is one sepsis hallmark characterized by inhibited immune
responses to microbial infection that also occurs in chronic infection and cancer. Typical features of
immunosuppression include a reduced population of immune cells, exhaustion and dysfunction of cell
immunity, suppression of pro-inflammatory factor release, or an increase in anti-proinflammatory factor
release (1-5). Immunosuppression is clinically manifested in patients by chronic or recurrent bacterial
and viral infections, or acute infections with opportunistic pathogens leading to sepsis (6-10).
Lymphopenia has emerged as a prominent feature in septic patients that renders a poor prognosis. So
far, studies have revealed that multichannel signal pathways including programmed cell death 1 (PD1),
tumor necrosis factor receptor (TNFR), IL-7, and IL-10 may be important factors in septic
immunosuppression (1, 3, 6, 11-15). Gram-negative bacteria derived LPS can induce apoptosis in NK
cells, B cells, T cells, and dendritic progenitor cells (16). Further, LPS-tolerance remarkably contributes
to mortality in polymicrobial septic models (17, 18). In addition, selective reprogramming of gene
expression substantially affects survival rates in the LPS tolerance model (19-21). Yet, the underlying
molecular mechanism(s) in septic immunosuppression remains to be defined.
Epigenetics governs DNA accessibility and concomitantly coordinates with transcriptional factors to
control lymphocyte development, lineage differentiation, and maturation (22-27). Epigenetic alterations
occur in multi-organ failure, animal models of sepsis, and in critically ill patients (28-32). Bacterial
infection regulates behavior of epigenetic enzymes to reprogram host immune defenses (33-36).
Although epigenetics is crucial to the pathogenesis of immunosuppression as blockade of programmed
cell death protein 1 (PD1) does not reverse the epigenetic changes in exhausted T cells in chronic viral
infection animal models suggesting a role for other effectors that may be linked to the pathobiology of
immunosuppression (37). Interestingly, mRNA levels of several histone deacetylases are increased in
preclinical sepsis models (38). Histone H3K27 methylation has been previously implicated as an
epigenetic mark in septic immunosuppression (39). Nevertheless, our understanding of epigenetic
regulation in sepsis is limited as mechanisms are poorly described.
PRMT4, a type I methyltransferase enzyme belonging to at least eleven members in the protein arginine
methyltransferase family, regulates crucial life processes including gene transcription, proliferation, RNA
splicing, and development (40-44). PRMT4 catalyzes the addition of mono- or asymmetric arginine
residues to the guanidino nitrogens of arginyl residues in histones and non-histone protein substrates.
Coordination with the action of histone acetyltransferases p300 and p160, PRMT4 dependent
asymmetric dimethylation of histone H3 at Arg-17 (H3R17me2a) results in transcriptional activation
(45). PRMT4 proteins are aberrantly expressed in a number of cancer cells including breast, colorectal,
and prostate cancers, and its high level is correlated with a poor prognosis in breast cancer patients (46).
PRMT4 promotes cellular proliferation by binding to the promoter region to enhance cell cycle related
CDK2 gene transcription in breast and prostate cancer cells (47). PRMT4 catalyzes methylation of a
range of non-histone proteins including p300 to exert its diverse biological functions in NF-B mediated
inflammation, in p53 related signal transduction, and in the mRNA maturation process (41). A recent
study revealed that PRMT4 catalyzes methylation of more than 130 substrates in breast cancer cells
(48). Knockout of PRMT4 in mice leads to neonatal death and developmental defects in the respiratory
system, reduced percentage of CD4-CD8 double negative T cells, and a block of thymocyte development
in mice (49-51). However, how bacterial pathogens reprogram PRMT4 at the protein level to regulate
lymphocytes is not fully understood.
The ubiquitin proteasome system degrades most cellular proteins in living cells, and at times in
coordination with the gene transcriptional machinery. Ubiquitination proceeds in an enzymatic cascade,
in which the final step involves an E3 ubiquitin ligase that recognizes a protein substrate to catalyze
ligation of ubiquitin to the substrate. This process often results in substrate disposal within the
proteasome. Among E3 ubiquitin ligases, a family of SCF (Skp1-Cullin1-Fbox) E3 proteins have been
linked to bacterial infection and host defense (26, 34, 35, 52-54). Interestingly, the F-box protein FBXO9,
a component of SCF-FBXO9 E3 ligase complex, was identified in a pooled RNAi screen as LPS-responsive in
the context of IL-6 production to regulate innate immunity (55). FBXO9 may be associated with patient
survival in multiple myeloma, is linked to adipocyte development, and targets peroxisome proliferator-
activated receptor gamma for degradation (56-59). Aside from these studies, our understanding of this
E3 ligase subunit is limited, particularly as it relates to sepsis.
In this study, we identified that microbial factors (i.e. endotoxin) increase PRMT4 expression, by
extending its cellular protein lifespan thereby inducing lymphocyte death and modulate host survival in
experimental sepsis. Our data show that bacterial pathogens down-regulate expression of an E3
ubiquitin ligase, SCF-FBXO9 that targets PRMT4 for its elimination in cells. Further, we observe that PRMT4
exerts an undescribed function by triggering lymphocyte death and by screening putative small molecule
inhibitors of PRMT4, we identified that one compound, TP064, specifically attenuates lymphocyte cell
death and protects mice after LPS lung injury and in polymicrobial sepsis.
Results
Gram-negative bacterial derived endotoxin increases PRMT4 protein expression.
We identified that E. coli derived LPS increased PRMT4 protein levels in human lymphoma Jurkat T cells
(Fig. 1A). LPS-mediated PRMT4 accumulation appeared in a concentration-dependent manner in the
cells. PRMT4 mRNA levels as assayed by quantitative reverse transcription- polymerase chain reaction
(qRT-PCR) showed no remarkable differences in LPS treated and untreated Jurkat cells (Fig. 1B). Live E.
coli increased PRMT4 cellular concentrations in Jurkat cells (Fig. 1C). To assess clinical relevance, we
observed that PRMT4 was barely detected in the de-identified human lung tissue samples, but protein
levels were higher in infected lung tissue samples (Fig. 1D). Further, when we conducted PRMT4
immunoblotting in human peripheral blood leukocytes, PRMT4 protein levels from septic patients were
substantially higher compared to that of normal leukocytes (Fig. 1E). Prmt4 protein levels were
remarkably higher in polymicrobial infected mouse sera as compared to that of untreated control mice
(Fig. 1F). Finally, PRMT4 protein levels were substantially higher in plasma from septic patients as
compared to that without sepsis (Fig. 1G, Table 1). Hence, these data suggest that PRMT4 expression is
induced in human lymphoma Jurkat cells in response to bacterial pathogen and PRMT4 levels are
increased during sepsis in vivo. In addition, bacteria elevate PRMT4 protein levels possibly by impairing
its native pathway for protein degradation.
PRMT4 is a labile protein degraded by the SCFFBXO9 E3 ubiquitin ligase.
The availability of a specific protein in the cells is the result of dynamic homeostasis between its gene
transcription rate, translational efficiency, and rate of protein decay. Our published studies show that
PRMT4 is a labile protein (t½ ≈ 3.5 h) degraded via the ubiquitin proteasomal pathway in lung epithelial
cells (60). However, little is known about the molecular mechanism of PRMT4 protein degradation.
Results show that the half-life of PRMT4 protein is approximately 3.5 h in Jurkat T cells (Fig. 2A, B).
PRMT4 degradation was via the proteasome, but not the lysosome, as the proteasome inhibitor MG132
but not the lysosome inhibitor leupeptin accumulated PRMT4. Proteins degraded via the proteasome
are in general poly-ubiquitinated and ubiquitin could be a limiting factor for protein degradation in a
specified cellular compartment. Ectopic expression of ubiquitin accelerated PRMT4 turnover in a
ubiquitin-dependent manner (Fig.2C). As shown before in epithelia (60), results from
immunoprecipitation (IP) studies showed that PRMT4 was also poly-ubiquitinated in lymphocytes (Fig.
2D, upper panel). By screening a library of SCF-E3 ubiquitin ligases, we identified that SCFFBXO9 specifically
degrades PRMT4 (Fig. 2E). Further, PRMT4 protein was degraded in an FBXO9 plasmid concentration
dependent manner (Fig. 2F, upper panels). As a control, FBXO24, another F-box protein, did not degrade
PRMT4 (Fig. 2F, lower panels). IP studies showed that FBXO9 protein associates with PRMT4, as do the
SCF complex components Skp1 and Cullin1 (Fig. 2G). Moreover, knockdown (Kd) of FBXO9 with small
hairpin RNA (shRNA) stabilized PRMT4 as compared with that of a scramble shRNA control (Fig. 2H).
Overall, these data indicate that PRMT4 is specifically targeted for its cellular disposal by the SCFFBXO9
ubiquitin proteasomal machinery.
SCFFBXO9 ubiquitinates PRMT4 at K228.
We next fine mapped the ubiquitination site (s) within PRMT4. We generated and expressed truncated
PRMT4 constructs in cells to examine protein degradation of the truncations (Fig. 3A). Cellular
expression of constructs harboring carboxyl terminal deletions resulted in PRMT4 accumulation
suggesting that molecular signatures that mediate protein disposal are not localized within the
fragments (Fig. 3B, left panels). In contrast, deletion of the NH2-terminal 150 amino acids (aa) resulted in
lack of PRMT4 accumulation (Fig. 3B, right panels), suggesting that aa100-150 contains a degradation
element. We analyzed the sequence and found that there was no ubiquitin acceptor lysine residue in
the aa100-150, but a nearby lysine residue K228 resided in the truncation mutant containing aa100-608.
We tested if K228 is a ubiquitin acceptor site. As compared with that of wild type (WT) PRMT4 and other
mutants, a K228A mutant was stable from proteasomal degradation (Fig. 3C, D). The K228A mutant was less
ubiquitinated as compared with that of WT PRMT4 (Fig. 3E). In addition, mutation of K228 abrogated
FBXO9 mediated PRMT4 degradation (Fig. 3F). These data suggest that K228 may be one authentic
SCFFBXO9 catalyzed ubiquitin acceptor site.
SCFFBXO9 recognizes a PRMT4 phosphodegron
As SCF E3 ubiquitin ligases often interact with phosphorylated substrates, we next studied the FBXO9
docking site within PRMT4. We focused on the NH2-terminus because the above studies suggested that
aa100-150 contains a degradation element, possibly an E3 ligase docking site. Results from in vitro pull-
down assays showed that deletion of NH2-terminal 150 aa impairs PRMT4 and FBXO9 binding (Fig. 4A).
We further fine mapped the docking site for FBXO9 within PRMT4 by pull-down assays (Fig. 4B, C). Pull
down results showed that amino acids after aa131 were critical for FBXO9 binding. We analyzed the
sequence and identified a phosphorylation motif in this region: 132-TxxxS (Fig. 4D, upper panel, x
donates any amino acid). To test if this motif is a potential phosphodegron, we substituted T132 and S136
with a cysteine to mimic dephosphorylation or introduced an aspartic acid at T132 to mimic a
phosphorylation site. Pull down results suggest that a dephosphorylated T132 and phosphorylated S136
sites constituted an optimal FBXO9 binding motif constituting a phosphodegron for E3 SCF ligase
interaction (Fig. 4D, E). Consistent with these observations, our recent published study showed that
glycogen synthase kinase beta (GSK-3β)-mediated T132 phosphorylation stabilized PRMT4 (60). We
further tested the protein stability with these mutations. T132C and S136D mutants degraded faster than
that of WT PRMT4. A S136C mutant displayed greater protein stability. T132D and T132AS136A double mutants
completely stabilized the protein from degradation. However, a T132CS136D PRMT4 variant when
expressed in cells degraded most rapidly (Fig. 4F, G). In all, these data indicate that SCFFBXO9 engages a
phosphodegron 132-TdxxxSp to ubiquitinate PRMT4 at K228.
LPS induced PRMT4 promotes caspase 3 activation in lymphocytes.
We next assessed a potential pathophysiological role for elevated PRMT4 after bacterial infection.
PRMT4 appeared to be endotoxin-responsive, as LPS increased PRMT4 protein levels in T cell-like Jurkat
cells, in human infected lung tissues, and in human peripheral blood leukocytes and plasma from septic
patients (Fig. 1). PRMT family members regulate apoptosis as PRMT2 inhibits NF-B signaling and
promotes apoptosis in mouse embryo fibroblasts (61). PRMT4 expression induced by high-glucose
loading triggers apoptosis of human retinal pigment epithelial cells via H3R17 dimethylation (62) Thus,
we tested if actions of LPS on lymphocyte death are mediated by PRMT4 through its E3 ligase, SCFFBXO9.
We first studied cell death using activated caspase 3 as a marker in a variety of cell types including Jurkat
cells, mouse splenic T cells, and human peripheral blood pan-T cells after 6 h of LPS stimulation. As
predicted, caspase 3 was activated in all of these cells, and its activation occurred in an LPS
concentration dependent manner (Fig. 5A-C, second upper panels). Notably, LPS down-regulated FBXO9
protein variably in all the tested cells, suggesting a widespread (shared) mechanism whereby LPS
stabilizes PRMT4 in cells via depletion of SCFFBXO9 E3 ubiquitin ligase (Fig. 5A-C, second lower panels). To
understand the potential role(s) of PRMT4 in caspase 3 cleavage in T cells, we ectopically expressed
PRMT4 in Jurkat cells. Immunoblotting results showed that PRMT4 ectopic expression was sufficient to
activate caspase 3 in Jurkat cells (Fig. 5D). Caspase 3 activation occurred in a PRMT4 plasmid
concentration-dependent manner. We then generated PRMT4 knockout (KO) Jurkat cells using
CRISPR/Cas9 to test our observations. Immunoblotting results showed that PRMT4 was completely
depleted in stable KO cells (Fig. 5E). KO of PRMT4 blocked LPS-mediated caspase 3 activation to baseline
levels (Fig. 5F). In contrast, ectopic expression of PRMT4 promoted LPS-induced caspase 3 activation
(Fig. 5G). Results from immunoblotting analysis of the isolated mouse splenic T-cells showed that
expression of PRMT4 promotes LPS-induced caspase 3 activation, and depletion of PRMT4 by shRNA
substantially blocks LPS-induced caspase 3 activation (Fig. 5H). To confirm the role of FBXO9 in PRMT4
F
i
g
.
5
.
L
P
S
d
o
w
mediated caspase 3 activation, we depleted FBXO9 in Jurkat cells by shRNA. Immunoblotting results
showed that depletion of FBXO9 increased PRMT4 mediated caspase 3 activation and this activation is
ablated in PRMT4 KO cells (Fig. 5I). Thus, these data suggest that LPS increases PRMT4 expression
possibly via down-regulation of FBXO9, thereby facilitating the methyltransferase to trigger caspase 3
signaling in lymphocytes.
PRMT4 depletion or chemical inhibition reduces lymphocyte cell death.
To explore the function of LPS-mediated PRMT4 elevation and subsequent caspase 3 activation, we
measured lymphocyte apoptosis. We conducted Annexin V flow-cytometry to confirm the role of PRMT4
in LPS-mediated early stage T cell death. Flow-cytometry results showed that the baseline levels of cell
death were similar in PRMT4 KO Jurkat cells (8.19% and 8.03%) as compared to that of non-targeted
cells (7.86%). LPS treatment substantially promoted cell death in non-targeted cells (26.65%) but not in
PRMT4 KO cells (10.47% and 8. 31%). Interestingly, PRMT4 overexpression promoted Jurkat cell death
(19.75%) and augmented LPS-induced cell death (41.78%) (Fig. 6A, B). To confirm this observation, we
determined the cell viability in LPS treated mouse splenic lymphocytes. As predicted, LPS did not affect
cell survival in PRMT4 depleted mouse splenic T-cells but remarkably reduced cell survival in PRMT4
overexpressed mouse splenic T-cells (Fig. 6C). Since LPS increases PRMT4 protein levels that induces T
cell death, we assessed if a PRMT4 small molecule inhibitor(s) might suppress T cell death. We first
screened commercially available PRMT4 inhibitors in LPS treated Jurkat cells to test if the inhibitor(s)
might inhibit caspase 3 activation. Among the inhibitors screened, a selective and cell active PRMT4
inhibitor TP064 (MedKoo Biosciences, Inc. Cat#: 407418) efficiently and most consistently inhibited
caspase 3 activation at a concentration of ~40 nM (Fig. 6D); TP064 concentration of ~ 10 nM effectively
inhibited PRMT4 mediated histone H3 arginine methylation data not shown). Further, experimental
results suggest that TP064 can block LPS mediated caspase 3 activation at both 25 nM and 50 nM in
mouse splenic T cells (Fig. 6E). These studies link PRMT4 to endotoxin-induced lymphocyte death and
showcase the ability of a PRMT4 specific small molecule inhibitor to effectively antagonize endotoxin-
induced lymphocyte death signaling.
PRMT4 mediates splenic lymphocyte death in experimental acute lung injury.
To test our hypothesis in animal models, we assessed PRMT4 in an LPS lung injury mice model. We
overexpressed PRMT4 or knocked down PRMT4 using lentiviral constructs (1×107 cfu/mouse,
intratracheal [i.t.] administration) in mice (C57BL/6J) for 14 d. LPS (5 mg/kg, i.t. in PBS buffer) was
administrated (i.t.) into mice for 24 h. Prior to the lentivirus administration, we administered a droplet
of lysoPC (20 L, diluted 10 times in PBS, i.t.) to facilitate lentiviral particle migration through the
surfactant layer and cell membrane and promote efficiency of gene transfer. Results from histological
studies showed that administration of LPS caused lung inflammation with inflammatory cell infiltration.
Overexpression of PRMT4 enhanced lung inflammation and knockdown of PRMT4 or application of
PRMT4 inhibitor attenuated lung inflammation (Fig. 7A, upper panels). Results from TUNEL staining
showed that LPS caused cell death in lung tissues, in which, overexpression of PRMT4 enhanced cell
death and knockdown of PRMT4 or application of PRMT4 inhibitor attenuated cell death in the lung (Fig.
7A, lower panels, Fig. 7B). Immunoblotting results from lung indicated that i.t. administration of LPS or
lentiviral particles did modulate PRMT4 protein levels in lung tissue (Fig. 7C). Surprisingly, we observed
that LPS induced substantial cell death in the spleen as evidenced by TUNEL staining. Splenic cell death
occurred in the white pulp, a zone that T cells reside (Fig. 7D, E). Further, overexpression of PRMT4
markedly enhanced LPS-induced lymphocyte death whereas silencing of PRMT4 by shRNA significantly
diminished cell death. TP064 partially protected splenic lymphocytes from death. Lung infection can
serve as a reservoir of microbial products that can disseminate systemically. Thus, we speculated that i.t.
administration of LPS might access the systemic circulation to disseminate to major organs such as the
spleen. We analyzed splenic cell death with flow cytometry and identified that overexpressed PRMT4
enhanced cell death in CD4+ T cells (Fig. 7F, G). In addition, results from survival studies indicated that
PRMT4 overexpressed mice showed a significantly lower survival rate. Depletion of PRMT4 by shRNA or
application of TP064 remarkably improved mouse survival (Fig. 7H). These data suggest that LPS-
enhanced PRMT4 protein expression promotes lymphocyte death and targeting on PRMT4 improves
survival in a LPS mouse lung injury model.
PRMT4 mediates splenic lymphocyte death in a polymicrobial sepsis model.
We next tested our hypothesis in a well characterized polymicrobial septic mouse model, Cecal ligation
and puncture (CLP). Mice were subjected to lenti-PRMT4 overexpression and lenti-shRNA as above, CLP
procedure were followed to induce sepsis (63) in animals. One group of mice receiving lenti-vector only
were given TP064 (0.2 g/mouse) intravenously following CLP. Consistent with above observations,
results from TUNEL staining of the splenic tissues showed that CLP was sufficient to cause splenic T cell
death (Fig. 8A, B). Flow cytometric data confirmed these observations (Fig. 8C, D). Moreover, PRMT4
overexpression mediated splenic CD4+ T cell death in this model whereas silencing of PRMT4 by shRNA
or administration of TP064 attenuated splenic T cell death. Lenti-PRMT4 overexpression during CLP
increased IL-1ra, IL-6, IL-10, IL-17, CCL1-, CXCL1, CXCL9, and CXCL10 levels in mouse sera when
compared to the CLP group (p<0.05). Silencing of PRMT4 by shRNA reduced cytokine levels when
compared to the CLP group (p<0.05). The PRMT4 inhibitor also reduced cytokine levels when compared
to the CLP group (p<0.05) (Fig. 8E). Survival studies showed that lenti-PRMT4 overexpression decreased
mouse survival, and depletion of PRMT4 by shRNA or application of the PRMT4 chemical inhibitor
protected mice from death (Fig. 8F). Consistent with observations in septic rodent models, data from
human septic patients showed that high plasma PRMT4 protein levels were associated with circulating
biomarkers IL-6 (r=0.37, p=0.007) and Ang2 (r=0.37, p=0.007) (Fig. 8G, Table 2). In summary, these
results suggest that PRMT4 is a critical mediator of lymphocyte death and biological inflammatory
responses and that this mechanism may contribute to immunosuppression.
Discussion
There is mounting evidence that a mechanistic centerpiece of sepsis is immune suppression from loss of
effector lymphocytes underscoring an unmet need to identify new molecular targets for therapeutic
intervention. The fundamentally new findings in this study are that (i) PRMT4 protein is elevated in the
serum of human subjects with sepsis, in preclinical models of sepsis, and in lymphocytes exposed to
bacterial endotoxin ; (ii) SCF-FBXO9, via unique molecular signatures, normally targets the labile protein
PRMT4 for its cellular elimination, but the E3 ligase is decreased in cells by endotoxin resulting in
stabilized PRMT4 that mediates lymphocyte apoptosis; and (iii) chemical inhibition or genetic depletion
of PRMT4 attenuates lymphocyte death and protects mice after endotoxin-induced lung injury and
polymicrobial sepsis (Fig. 9). Dysregulation of PRMT4 has been reported in many pathophysiological
settings. PRMT4 is aberrantly expressed in breast, prostate, and colorectal cancers that is associated
with a poor prognosis by promoting tumor progress and cancer metastasis. Consistent with these
observations, we identified that PRMT4 expression is increased in sepsis. PRMT4 protein was
upregulated in cellular and mouse septic models, in human infected lung tissue samples, and in
peripheral blood leukocytes from septic patients. Increased PRMT4 protein caused lymphocyte
apoptosis and this finding may be one mechanism underlying the pathogenesis of septic
immunosuppression, as apoptosis of T lymphocytes is a key feature of sepsis-induced
immunosuppression (64) and lymphopenia that develops during sepsis predicts early and late mortality
(65).
PRMT4 is crucial in lymphocyte lineage differentiation and maturation (49-51). Knockout of PRMT4 in
mice results in less CD4+/CD8+ cells and prevents thymocyte development (provide citation here).
However, these global defects in lymphocyte development prevent assessment of PRMT4 function
during pathophysiologic states when PRMT4 may achieve a high level beyond a physiologic threshold,
and where the gene product may exert functions other than uncovered in a knockout mouse model. It is
not uncommon to observe that some proteins display unexpected functions in the context of aberrant
expression, or low concentrations, or total cellular depletion. For instance, both knockdown and
overexpressed acyl-CoA:lysocardiolipin acyltransferase-1 harms mitochondrial function, with distinct
mechanisms (66). While the significance of the aberrantly expressed PRMT4 in specific disorders has
not been fully characterized, PRMT4 expression in breast cancer is associated with poor prognosis by
promoting tumor progression and cancer metastasis (67). Thus, reduced tumor free survival in breast
cancer may be linked to a similar function posited for the methyltransferase in immunosuppression.
Our studies uncover a unique role for PRMT4 in cell death linked to sepsis. Increased cell death has long
been noticed as a key pathway in sepsis-induced immunosuppression but the factors leading to this
increased cell death has not been fully defined. Immune checkpoint proteins including PD1/PDL1 are
believed to be one of the major pathways that contribute to septic immunosuppression (68). However,
efficacy of anti-PD-L1 application is limited to a portion of patients of whom PD1/PD-L1 signaling is
positive and the efficacy of anti-PDL1 application in septic models remains to be determined. Further,
PD-L1 antibody administration does not reverse the epigenetic changes of immunosuppression in animal
models. Our findings here add a novel mechanism of immunosuppression at the epigenetic level: the
potential for a pathogen-derived product to induce cellular concentrations of chromatin modulator,
PRMT4, that in turn mediates lymphocyte death via caspase 3 related apoptosis, thus serving as a
potential modulator in sepsis. Further studies are indicated to elucidate the molecular mechanisms
whereby PRMT4 regulates apoptosis, epigenetically or via its methylation function driving post-
translational modifications of key regulatory proteins that dictate cellular lifespan. Recent mass
spectrometric studies uncovered more than 130 PRMT4 modified protein substrates in breast cancer
cell lines (69). These targets might be suitable candidates for interrogation of post-translational
modifications by PRMT4 associated with T-cell immunosuppression.
Here we identified a new molecular target of FBXO9 in its control of PRMT4 protein stability that
regulates immune responses through control of T cell lifespan. Before PRMT4 is targeted for
ubiquitination and subsequent degradation, PRMT4 is recognized by the E3 ubiquitin ligase SCFFBXO9
through a phosphodegron. In this motif (132-TdxxxSp), the phosphorylation status of serine and
threonine residues appear to be differentially modified for optimal FBXO9 binding and subsequent
ubiquitination. Phosphodegrons have been widely cited in governing the stability of crucial molecules in
the pathogenesis of diseases. In this regard, we previously identified that oxidative stress reduces
PRMT4 levels via downregulation of a protein kinase GSK3. GSK3 phosphorylates T132 that is crucial
in regulating the affinity between the phosphodegron and the E3 ubiquitin ligase (60). Interestingly, in
the present study, we observed that LPS downregulates the E3 ubiquitin ligase component FBXO9 at the
protein level to promote PRMT4 protein stability.
We observed higher plasma PRMT4 levels in septic patients compared to non-septic patients. PRMT4 is
a protein arginine methyltransferase located in both the cytoplasmic and nuclear compartments (cite
references here). Our results suggest that PRMT4 is highly expressed in leukocytes isolated from septic
patients and PRMT4 is detectable in mouse sera and human plasma. Considering the fact that high levels
of PRMT4 are cytotoxic, we speculate that PRMT4 in plasma of septic patients may originate from dying
or dead cells. In addition, we identified that plasma PRMT4 protein levels were positively correlated
with IL-6 (r=0.37, p=0.006) in septic patients (Fig. 8G). This is consistent with our observation in the
polymicrobial infection mouse model with PRMT4 overexpression, in which IL-6 expression is increased.
Interestingly, FBXO9 is known to control IL-6 production to regulate innate immunity in a LPS cellular
model (55). PRMT4-mediated histone arginine methylation is a transcriptional activation epigenetic
marker (please cite reference). Our data invites the possibility that PRMT4 may enhance IL-6 secretion
possibly through loss of FBXO9 control during endotoxin-mediated cellular stress. Interestingly,
inhibition of PRMT4 by shRNA or with the small molecule inhibitor improved mice survival in both the
LPS lung injury and CLP mouse models, suggesting that lymphocyte death may be a critical factor
underlying the pathogenesis of endotoxin-mediated injury. Therefore, pharmaceutical targeting of
PRMT4 may be a potential alternative therapeutic approach in septic patients with significantly low T
cell counts and immunosuppression.
Materials and Methods
Cell lines and reagents. Human lymphoma Jurkat cells (ATCC) and human primary pan-T cells (StemCell)
were cultured with RPMI1640 (Gibco) containing 10% FBS. Cells were maintained in a 37 °C incubator in
the presence of 5% CO2. V5 antibody, pcDNA3.1D-His-V5-TOPO cloning kit (Cat#: K490001) and
Escherichia coli Top10 competent cells (Cat#: C404006) were from Invitrogen (St. Louis, MO). PRMT4
(Cat#:12495) and Hemagglutinin (HA) tag (Cat#: 3724S, lot: 5) antibody were from Cell Signaling
(Danvers, MA). Ubiquitin (Cat#: sc-166553, lot: A2710) antibody was from Santa Cruz Biotechnology
(Santa Cruz, CA). FBXO9 (Cat#: PA5-23474) antibody was from Thermo (Rockford, IL). Alexa Fluor 647 Rat
Anti-Mouse CD8a and BV421 Rat Anti-Mouse CD45R/B220 were from BD Biosciences (San Jose, CA). The
PRMT4 shRNA was from Origene (Rockville, MD). Cycloheximide (Cat#: ALX-380-269-G001, lot:
01061518), E64D (Cat#: BML-PI107-0001, lot: 08181537), and Ubiquitin aldehyde (Cat#: BML-UW8450-
0050, lot: 07021447) were from Enzo Life Sciences (Farmingdale, NY). β-actin (Cat#: A3853) antibody,
bacterial lipopolysaccharide (LPS) from E. coli O111:B4 (Cat#: L4391, lot: 115M4090V) and L-α-
Lysophosphatidylcholine (lysoPC, Cat#: L-5254) were from Sigma (Carlsbad, CA). MG132 (Cat#: F1101,
lot: F11052079) was from UBPBio (Aurora, CO). TP064 (Cat#: 6008) was from Tocris Bioscience (Ellisville,
MO). QuickChange II XL site-directed mutagenesis kits (Cat#: 200522) were from Agilent Technologies
(Santa Clara, CA). TnT Quick Coupled Transcription/Translation Systems (Cat#: L1170) were from
Promega (Madison, WI). Immobilized protein A/G Agarose beads (Cat#: 20421) were from Pierce
(Rockford, IL). All other reagents were of the highest grade available commercially.
Cloning and mutagenesis. V5-tagged PRMT4 truncations were cloned into pcDNA3.1D-His-V5-TOPO
plasmid using PCR-based approaches as previously described (70). Mutagenesis was introduced by using
a QuickChange II XL site-directed mutagenesis kits according to the manufacturer’s instructions. The
accuracy of the mutagenesis was confirmed by sequencing. The primers used in the construction of
PRMT4 truncations and site-directed mutagenesis were listed in Table 3.
Plasmid transfection. All plasmids were introduced into cells using electroporation executed with a
nuclear transfection apparatus (Amaxa Biosystems, Gaithersburg, MD) with a preset program (X-001 for
Jurkat cells), following the manufacturer’s instructions as previously described (66). Briefly, one million
cells in 100 μL of transfection buffer (20mM Hepes in PBS buffer) were mixed with 3 μg of plasmids
(including expression and shRNA constructs). After electroporation, the cells were cultured with 2 mL
conditional medium in 6 well plates for 24 h for further analyses.
Immunoblotting and co-Immunoprecipitation. Immunoblotting and co-immunoprecipitation were
conducted as previously described (66). Briefly, for immunoblotting, whole cell extracts (normalized to
total protein concentration) were resolved by SDS-PAGE and transferred to membranes by
electroblotting. The membranes were blocked with 5% (w/v) non-fat milk in Tris-buffered saline and
probed with primary antibodies as indicated. Membranes were developed by an enhanced
chemiluminescence (ECL) system. For immunoprecipitation, 1 mg of cell lysates (in PBS with 0.5% Tween
20 plus protease inhibitors) were incubated with specific primary antibodies for 2 h at room
temperature. The mixture was added with 35 µl of protein A/G-agarose beads for an additional 2 h at
room temperature. The precipitated complex was washed for three times with 0.5% Tween 20 in PBS
and analyzed by immunoblotting with ECL system.
Human study and PRMT4 ELISA assays. Subjects with or without sepsis were selected from a cohort of
mechanically-ventilated patients at the University of Pittsburgh Medical Center (UPMC). Eligible
patients were 18 years or older with acute respiratory failure requiring mechanical ventilation via
endotracheal intubation with sepsis as defined by the presence or suspicion of infection and two or
more systemic inflammatory response syndrome (SIRS) criteria. Control patients were intubated and
mechanically ventilated for airway protection without sepsis. Deidentified baseline clinical data
(including demographics, comorbidities, physiologic and laboratory variables), severity of illness
(modified sequential organ failure assessment (SOFA) scores), and clinical outcomes: 30- and 90-day
mortality, duration of ICU stay, incidence of acute kidney injury (defined as elevation of 0.3 mg/dL or
more from baseline creatinine) or shock (defined as need for vasopressors) within 7-days from
intubation (10) were extracted from the registry database (Table 2). Deidentified human infectious lung
samples and normal controls were as described previously (71).
Deidentified cytokine data were extracted from the registry database, and deidentified plasma provided
for assay of PRMT4 expression. PRMT4 levels were determined using PRMT4 ELISA kit (Cat#
MBS3244080 for human PRMT4, and Cat# MBS9339704 for mouse Prmt4, Mybiosource, San Diego, SC,
USA) as directed by the manufacturer. Briefly, the plates, reagents and samples were brought to room
temperature. Plasma samples with a volume of 50 μl and 100 μl HRP-Conjugate Reagent were added to
each well of the 96-well plate. The plate was incubated at 37°C for 60 min and washed with Wash
Solution for 4 times. The results were visualized with addition of 50 μl Chromogen Solution A and B and
incubation of the plate at 37°C for another 15 min. The color reaction was stopped with 50 μl of Stop
Solution and the optical density (OD) was read at 450 nm within 15 min.
Real‐Time Polymerase Chain Reaction (RT‐PCR). Total RNA from cells was isolated with RNeasy Mini
Kit (Qiagen, Valencia, CA, USA), and reverse‐transcribed by using High-Capacity RNA-to-cDNA Kit
(Applied Biosystems, Foster City, CA, USA) following the manufacturer's manual instructions. Single
stranded cDNA was then amplified by RT‐PCR with specific primers of PRMT4 and GAPDH. RT‐PCR
was performed on an ABI Prism 7000 thermocycler (Applied Biosystems, Thermo-Fisher Scientific,
Waltham, MA, USA) with SYBR Green PCR Master Mix (Roche, Basel, Switzerland). For each experiment,
samples (n = 3) were run in triplicate. Relative gene expression was calculated using the comparative CT
method.
in vitro Pull-down assay. We conducted in vitro binding assays to identify the FBXO9 binding domain
within PRMT4. V5-tagged PRMT4 truncated or site directed mutant proteins were in vitro expressed
using a TnT coupled reticulocyte system. Endogenous FBXO9 protein was obtained by FBXO9
immunoprecipitation from Jurkat cell lysate. FBXO9-precipitated protein A/G-agarose beads were
incubated with a variety of PRMT4 truncations or mutants for 2 h. The beads were washed extensively
with 0.5% Tween 20 in PBS and analyzed by V5 and FBXO9 immunoblotting.
Lentivirus production. Lentiviruses were generated by Lenti-X Packaging Single Shots VSV-G (Cat#:
631276, Clontech, CA, USA) according to the manufacturer’s procedures. Lentivirus-containing
supernatants were concentrated using Lenti-X Concentrator (Cat#: 631231). Concentrated lentiviruses
were resuspended in PBS and titrated by Lenti-X GoStix (Cat#: 631280). The samples were aliquoted and
stored at -80°C.
Mouse splenic T cell isolation, flowcytometry, and annexin V apoptosis assay. Mouse spleen were
disrupted in PBS containing 2% FBS. The aggregates and debris were removed by passing suspension
through Falcon 70-μm cell strainer (BD, NJ, USA). Mouse splenic T cells were isolated using EasySep
Mouse T Cell Isolation Kit (Cat#: P19851, Stemcell Technologies, Vancouver, Canada) with EasySep
Magnets (Cat#: 18000) according to the instructions. Above isolated mouse splenic T cells were also
stained with anti-CD4, CD8a or CD45R antibodies combined. The cells were incubated for 15 - 30 min at
room temperature in the dark. After adding 400 μl Annexin V binding buffer, the samples were acquired
on the LSRII flow cytometers (BD Biosciences, MI, USA). All cells were analyzed with Flowjo software
(Tree Star, OR, USA).
FITC Annexin V Apoptosis Detection Kit with Propidium Iodide (PI) (Cat#: 640914, BioLegend, CA, USA)
was employed to detect apoptotic cells. Jurkat cells were harvest and washed twice with cold BioLend
Cell Staining Buffer and resuspend in annexin V binding buffer with cell density about 2.5 ~ 10 × 106
cells/ml. After 100 μl of cells were transferred to a 5ml test tube, 5 μl of FITC annexin V and 10 μl of PI
were added. The cells were gently vortexed and incubated for 15 min at room temperature in the dark.
After adding 400 μl Annexin V Binding Buffer, the samples were analyzed through BD Accuri C6 flow
cytometry (BD Biosciences, MI, USA).
Cytokine proteome profiler array assay. Cytokine proteome profile of mouse sera were measured using
Mouse XL Cytokine Array Kit (Cat#: ARY028, R&D system, MN, USA) according to the manufacturer’s
instructions. Briefly, mouse serum samples were incubated overnight with the membrane. The
membrane was washed to remove unbound material followed by incubation with a cocktail of
biotinylated detection antibodies. Streptavidin-HRP and chemiluminescent detection reagents were
then applied, and a signal is produced at each capture spot corresponding to the amount of protein
bound.
Mouse LPS-induced lung Injury and Cecal ligation and puncture (CLP )procedures. LPS-
induced lung Injury model was conducted as previously described. Briefly, C57BL/6J mice at the age of
10 weeks were anesthetized by injecting intraperitoneally a solution of 1:1 ketamine (75mg/kg) and
xylazine (15mg/kg) throughout the experiment. LPS (7mg/kg) were intratreackally administrated and the
mice were observed for 48 h. Polymicrobial sepsis was induced in mice by cecal ligation and
puncture(72). Briefly, mice were anesthetized throughout the experiment. The abdomen was shaved,
and wiped with 70% alcohol. A 1 to 2 cm midline abdominal incision was performed. The cecum was
exposed and ligated with a sterile silk suture 1 cm from the tip and double punctured with a 19-gauge
needle. The cecum was gently squeezed to extrude a small amount of fecal material and was returned
to the peritoneal cavity. The incision was closed with silk sutures. Mice were resuscitated with i.p.
injection of 1 ml of pre-warmed 0.9% saline solution. Mice were then monitored every 12 hours for
survival or euthanized at different time points for analysis of different parameters.
CRISPR/Cas9 PRMT4 Knock-out cell line. Jurkat cells were co-transfected with PRMT4 CRISPR/Cas9 KO
Plasmid (Cat#: sc-404087-KO-2) and HDR Plasmid (Cat#: sc-404087-HDR-2) using UltraCruz Transfection
Reagent (Cat#: sc-395739). Stable KO cells were selected by puromycin following the instruction from
the CRSPR/Cas9 manufacturer. PRMT4 knockout was confirmed by immnoblotting.
Statistics. The data represent the Mean + standard deviation in the graphs depicting the error bars or as
specifically indicated. Prism 7 (GraphPad software, San Diego, CA) was used to determine statistical
significance. Comparisons between groups were made using unpaired, two-tailed Student’s t-test (two
groups) and one-way analysis of variance (ANOVA) with post-hoc Tukey HSD or Bonferroni and Holm
multiple comparisons. Kaplan Meier estimate was used for survival analysis in mouse septic models.
P < 0.05 indicates statistical significance.
Study approval. All animal protocols and procedures were reviewed and approved by the University of
Pittsburgh Institutional Animal Care and Use Committee (IACUC protocol #: IS00010084). The University
of Pittsburgh Institutional Review Board approved the parent Acute Lung Injury Registry and
Biospecimen Repository (PRO10110387) and the exempt protocol to use deidentified samples and data
for this study (MOD201800140). Written informed consent to participate in the parent registry was
provided by all participants or their surrogates in accordance with the Declaration of Helsinki.
Acknowledgements: This work was in part, supported by a National Institutes of Health R01 grants
HL125435 and HL142997(to CZ), HL096376, HL097376, HL098174, HL081784, and P01 HL114453 (RKM),
HL136143, HL142084, HL143285, and P01 HL114453 (JSL), and grants 5I01CX000105-06 and CX001048
from the US Department of Veterans Affairs (to TN/RKM).
The content is solely the responsibility of the authors and does not necessarily represent the official
views of the National Institutes of Health or any other sponsoring agency.
Authors contributions: CZ conceived science and designed the experiments. YL, XL, YC, TL, JL, CL
conducted immunoblotting analysis. YL and XL performed animal studies. KC helped in flowcytometry
experiments. BJM, YZ, SMN, and GDK provided human samples and conducted human related studies.
TN, JSL, and RKM helped to develop the science. We thank Drs. Prabir Ray and Anuradha Ray for the in-
depth discussion in science. The manuscript was written by YL and CZ and edited by TN, YZ, BJM, GDK,
SMN, JSL, and RKM. All authors read and approved the final manuscript.
References
1. L. Chen et al., Genetic Drivers of Epigenetic and Transcriptional Variation in Human Immune
Cells. Cell 167, 1398-1414 e1324 (2016).
2. K. E. Pauken et al., Epigenetic stability of exhausted T cells limits durability of reinvigoration by
PD-1 blockade. Science 354, 1160-1165 (2016).
3. D. R. Sen et al., The epigenetic landscape of T cell exhaustion. Science 354, 1165-1169 (2016).
4. T. S. Wang, J. C. Deng, Molecular and cellular aspects of sepsis-induced immunosuppression.
Journal of molecular medicine 86, 495-506 (2008).
5. J. S. Boomer, J. M. Green, R. S. Hotchkiss, The changing immune system in sepsis: is
individualized immuno-modulatory therapy the answer? Virulence 5, 45-56 (2014).
6. O. M. Peck-Palmer et al., Modulation of the Bcl-2 family blocks sepsis-induced depletion of
dendritic cells and macrophages. Shock 31, 359-366 (2009).
7. K. C. Chang et al., Blockade of the negative co-stimulatory molecules PD-1 and CTLA-4 improves
survival in primary and secondary fungal sepsis. Crit Care 17, R85 (2013).
8. D. S. Chen, I. Mellman, Elements of cancer immunity and the cancer-immune set point. Nature
541, 321-330 (2017).
9. S. J. Patel et al., Identification of essential genes for cancer immunotherapy. Nature, (2017).
10. E. Cacan, Epigenetic-mediated immune suppression of positive co-stimulatory molecules in
chemoresistant ovarian cancer cells. Cell Biol Int 41, 328-339 (2017).
11. C. L. Day et al., PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and
disease progression. Nature 443, 350-354 (2006).
12. S. J. Im et al., Defining CD8+ T cells that provide the proliferative burst after PD-1 therapy.
Nature 537, 417-421 (2016).
13. M. Pellegrini et al., IL-7 engages multiple mechanisms to overcome chronic viral infection and
limit organ pathology. Cell 144, 601-613 (2011).
14. Y. Shindo, J. Unsinger, C. A. Burnham, J. M. Green, R. S. Hotchkiss, Interleukin-7 and anti-
programmed cell death 1 antibody have differing effects to reverse sepsis-induced immunosuppression.
Shock 43, 334-343 (2015).
15. M. Hiramatsu, R. S. Hotchkiss, I. E. Karl, T. G. Buchman, Cecal ligation and puncture (CLP) induces
apoptosis in thymus, spleen, lung, and gut by an endotoxin and TNF-independent pathway. Shock 7,
247-253 (1997).
16. J. S. Nielsen et al., Rough-Form Lipopolysaccharide Increases Apoptosis in Human CD4(+) and
CD8(+) T Lymphocytes. Scand J Immunol 75, 193-202 (2012).
17. K. Kopanakis et al., Pre-treatment with low-dose endotoxin prolongs survival from experimental
lethal endotoxic shock: Benefit for lethal peritonitis by Escherichia coli. Cytokine 62, 382-388 (2013).
18. K. Chen et al., Super-low dose endotoxin pre-conditioning exacerbates sepsis mortality.
EBioMedicine 2, 324-333 (2015).
19. E. S. Melo et al., Gene expression reprogramming protects macrophage from septic-induced cell
death. Mol Immunol 47, 2587-2593 (2010).
20. E. S. Melo et al., Endotoxin tolerance: selective alterations in gene expression and protection
against lymphocyte death. Immunobiology 215, 435-442 (2010).
21. B. Novakovic et al., beta-Glucan Reverses the Epigenetic State of LPS-Induced Immunological
Tolerance. Cell 167, 1354-1368 e1314 (2016).
22. L. Wang et al., Histone acetyltransferase activity is conserved between yeast and human GCN5
and is required for complementation of growth and transcriptional activation. Molecular and cellular
biology 17, 519-527 (1997).
23. H. H. Qi et al., Histone H4K20/H3K9 demethylase PHF8 regulates zebrafish brain and craniofacial
development. Nature 466, 503-507 (2010).
24. R. Pavri et al., Histone H2B monoubiquitination functions cooperatively with FACT to regulate
elongation by RNA polymerase II. Cell 125, 703-717 (2006).
25. S. J. Nowak, V. G. Corces, Phosphorylation of histone H3: a balancing act between chromosome
condensation and transcriptional activation. Trends in genetics : TIG 20, 214-220 (2004).
26. B. B. Chen et al., F-box protein FBXL2 targets cyclin D2 for ubiquitination and degradation to
inhibit leukemic cell proliferation. Blood 119, 3132-3141 (2012).
27. M. Okada, S. Hibino, K. Someya, A. Yoshmura, Regulation of regulatory T cells: epigenetics and
plasticity. Adv Immunol 124, 249-273 (2014).
28. S. W. Kang et al., Renal kallikrein excretion and epigenetics in human acute kidney injury:
expression, mechanisms and consequences. BMC nephrology 12, 27 (2011).
29. H. F. Li, C. F. Cheng, W. J. Liao, H. Lin, R. B. Yang, ATF3-mediated epigenetic regulation protects
against acute kidney injury. Journal of the American Society of Nephrology : JASN 21, 1003-1013 (2010).
30. W. F. Carson, K. A. Cavassani, Y. Dou, S. L. Kunkel, Epigenetic regulation of immune cell functions
during post-septic immunosuppression. Epigenetics 6, 273-283 (2011).
31. Y. Liu, H. Li, T. Xiao, Q. Lu, Epigenetics in immune-mediated pulmonary diseases. Clinical reviews
in allergy & immunology 45, 314-330 (2013).
32. M. Takebe et al., Inhibition of histone deacetylases protects septic mice from lung and splenic
apoptosis. J Surg Res 187, 559-570 (2014).
33. B. Ellis, L. Kaercher, C. Snavely, Y. Zhao, C. Zou, Lipopolysaccharide triggers nuclear import of
Lpcat1 to regulate inducible gene expression in lung epithelia. World journal of biological chemistry 3,
159-166 (2012).
34. C. Zou et al., SCF(Fbxw15) mediates histone acetyltransferase binding to origin recognition
complex (HBO1) ubiquitin-proteasomal degradation to regulate cell proliferation. The Journal of
biological chemistry 288, 6306-6316 (2013).
35. C. Zou et al., LPS impairs phospholipid synthesis by triggering beta-transducin repeat-containing
protein (beta-TrCP)-mediated polyubiquitination and degradation of the surfactant enzyme acyl-
CoA:lysophosphatidylcholine acyltransferase I (LPCAT1). The Journal of biological chemistry 286, 2719-
2727 (2011).
36. C. Zou et al., Mortality factor 4 like 1 protein mediates epithelial cell death in a mouse model of
pneumonia. Science translational medicine 7, 311ra171 (2015).
37. R. S. Hotchkiss, G. Monneret, D. Payen, Sepsis-induced immunosuppression: from cellular
dysfunctions to immunotherapy. Nature Reviews Immunology 13, 862 (2013).
38. H. T. Aung et al., LPS regulates proinflammatory gene expression in macrophages by altering
histone deacetylase expression. FASEB J 20, 1315-1327 (2006).
39. N. D. Das, K. H. Jung, Y. G. Chai, The role of NF-kappaB and H3K27me3 demethylase, Jmjd3, on
the anthrax lethal toxin tolerance of RAW 264.7 cells. PLoS One 5, e9913 (2010).
40. D. Cheng, J. Cote, S. Shaaban, M. T. Bedford, The arginine methyltransferase CARM1 regulates
the coupling of transcription and mRNA processing. Molecular cell 25, 71-83 (2007).
41. M. Covic et al., Arginine methyltransferase CARM1 is a promoter-specific regulator of NF-
kappaB-dependent gene expression. The EMBO journal 24, 85-96 (2005).
42. N. Yadav et al., Specific protein methylation defects and gene expression perturbations in
coactivator-associated arginine methyltransferase 1-deficient mice. Proc Natl Acad Sci U S A 100, 6464-
6468 (2003).
43. M. A. Kleinschmidt, G. Streubel, B. Samans, M. Krause, U. M. Bauer, The protein arginine
methyltransferases CARM1 and PRMT1 cooperate in gene regulation. Nucleic acids research 36, 3202-
3213 (2008).
44. D. Chen et al., Regulation of transcription by a protein methyltransferase. Science 284, 2174-
2177 (1999).
45. Y. Wei, J. C. Horng, A. C. Vendel, D. P. Raleigh, K. J. Lumb, Contribution to stability and folding of
a buried polar residue at the CARM1 methylation site of the KIX domain of CBP. Biochemistry 42, 7044-
7049 (2003).
46. M. B. Davis et al., Expression and sub-cellular localization of an epigenetic regulator, co-activator
arginine methyltransferase 1 (CARM1), is associated with specific breast cancer subtypes and ethnicity.
Molecular cancer 12, 40 (2013).
47. S. El Messaoudi et al., Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive
regulator of the Cyclin E1 gene. Proc Natl Acad Sci U S A 103, 13351-13356 (2006).
48. E. Shishkova et al., Global mapping of CARM1 substrates defines enzyme specificity and
substrate recognition. Nat Commun 8, 15571 (2017).
49. K. B. O'Brien et al., CARM1 is required for proper control of proliferation and differentiation of
pulmonary epithelial cells. Development 137, 2147-2156 (2010).
50. J. Kim et al., Loss of CARM1 results in hypomethylation of thymocyte cyclic AMP-regulated
phosphoprotein and deregulated early T cell development. The Journal of biological chemistry 279,
25339-25344 (2004).
51. D. Kim et al., Enzymatic activity is required for the in vivo functions of CARM1. The Journal of
biological chemistry 285, 1147-1152 (2010).
52. J. Zhao et al., F-box protein FBXL19-mediated ubiquitination and degradation of the receptor for
IL-33 limits pulmonary inflammation. Nature immunology 13, 651-658 (2012).
53. B. B. Chen et al., A combinatorial F box protein directed pathway controls TRAF adaptor stability
to regulate inflammation. Nature immunology 14, 470-479 (2013).
54. Q. Wang et al., Upregulation of miR-27a contributes to the malignant transformation of human
bronchial epithelial cells induced by SV40 small T antigen. Oncogene 30, 3875-3886 (2011).
55. I. V. Yang et al., Identification of novel genes that mediate innate immunity using inbred mice.
Genetics 183, 1535-1544 (2009).
56. V. Fernandez-Saiz et al., SCFFbxo9 and CK2 direct the cellular response to growth factor
withdrawal via Tel2/Tti1 degradation and promote survival in multiple myeloma. Nat Cell Biol 15, 72-81
(2013).
57. H. Cheng et al., cDNA cloning and expression analysis of a novel human F-box only protein. Mol
Cells 14, 56-59 (2002).
58. K. W. Lee et al., F-box only protein 9 is required for adipocyte differentiation. Biochem Biophys
Res Commun 435, 239-243 (2013).
59. K. W. Lee et al., F-box only protein 9 is an E3 ubiquitin ligase of PPARgamma. Exp Mol Med 48,
e234 (2016).
60. X. Li, Y. Lai, J. Li, M. Zou, C. Zou, Oxidative Stress destabilizes Protein Arginine Methyltransferase
4 Via Glycogen Synthase Kinase 3beta To Impede Lung Epithelial Cell Migration. Am J Physiol Cell Physiol,
ajpcell 00073 02017 (2017).
61. L. Ganesh et al., Protein methyltransferase 2 inhibits NF-κB function and promotes apoptosis.
Molecular and cellular biology 26, 3864-3874 (2006).
62. D.-i. Kim et al., High-glucose-induced CARM1 expression regulates apoptosis of human retinal
pigment epithelial cells via histone 3 arginine 17 dimethylation: role in diabetic retinopathy. Archives of
biochemistry and biophysics 560, 36-43 (2014).
63. D. Rittirsch, M. S. Huber-Lang, M. A. Flierl, P. A. Ward, Immunodesign of experimental sepsis by
cecal ligation and puncture. Nat Protoc 4, 31-36 (2009).
64. J. E. McDunn, R. S. Hotchkiss, Leukocyte phenotyping to stratify septic shock patients. Crit Care
13, 127 (2009).
65. A. M. Drewry et al., Persistent lymphopenia after diagnosis of sepsis predicts mortality. Shock
42, 383-391 (2014).
66. C. Zou et al., LPS impairs oxygen utilization in epithelia by triggering degradation of the
mitochondrial enzyme Alcat1. J Cell Sci 129, 51-64 (2016).
67. H. Cheng et al., Overexpression of CARM1 in breast cancer is correlated with poorly
characterized clinicopathologic parameters and molecular subtypes. Diagn Pathol 8, 129 (2013).
68. R. S. Hotchkiss, G. Monneret, D. Payen, Sepsis-induced immunosuppression: from cellular
dysfunctions to immunotherapy. Nature reviews. Immunology 13, 862-874 (2013).
69. E. Shishkova et al., Global mapping of CARM1 substrates defines enzyme specificity and
substrate recognition. Nature communications 8, 15571 (2017).
70. C. Zou et al., LPS impairs oxygen utilization in epithelia by triggering degradation of the
mitochondrial enzyme Alcat1. J Cell Sci 129, 51-64 (2016).
71. B. B. Chen et al., E3 ligase subunit Fbxo15 and PINK1 kinase regulate cardiolipin synthase 1
stability and mitochondrial function in pneumonia. Cell Rep 7, 476-487 (2014).
72. M. G. Toscano, D. Ganea, A. M. Gamero, Cecal ligation puncture procedure. Journal of visualized
experiments: JoVE, (2011).
Figure and legends
Fig. 1. LPS and bacteria increase PRMT4 protein in human lymphoma Jurkat cells. A. Jurkat cells were
treated with LPS as indicated, cell lysates were immunoblotted with PRMT4 and β-actin antibodies. B.
PRMT4 mRNA levels were determined by qRT-PCR in LPS treated lymphocytes, Student T-test were
conducted. C. Jurkat cells were treated with live E. coli (MOI=10) as indicated, cell lysates were
immunoblotted with PRMT4 and β-actin antibodies. D, E. Lung tissue lysates from deidentified human
lung samples (D) and peripheral blood leukocytes from septic patients (E) were analyzed for PRMT4 and
β-actin by immunoblotting. Experiments n=3. F. C57BL/6J mice were subjected to CLP procedures. At 48
h, mice sera were collected from untreated control group (n=5) and cecal ligation puncture (CLP) group
(n=10) for Prmt4 ELISA analysis. G. PRMT4 protein levels (log transformed) were determined by ELISA
from blood plasma from septic patients (n=53) and non-septic control patients (n=53). Lines indicate the
median and IQR, Mann-Whitney U test, p=0.0004.
Fig. 2. PRMT4 is a labile protein degraded via the SCFFBXO9 E3 ligase machinery in lymphocytes. A. Cells
were treated with cycloheximide (CHX), leupeptin or MG132 as indicated. Cell lysates were
immunoblotted with PRMT4 and β-actin antibodies. B. Densitometry results in A were plotted. C.
Ubiquitin overexpression reduces PRMT4 protein in a concentration dependent manner. D. PRMT4 is
ubiquitinated as shown by co-immunoprecipitation (Co-IP) of precipitates analyzed with ubiquitin and
PRMT4 antibodies. E. Screen of F-box family members revealed that overexpression of FBXO9 degrades
PRMT4. F. FBXO9 degrades PRMT4 in a concentration dependent manner. G. Co-IP studies showing that
PRMT4 interacts with SCFFBXO9. H. Knockdown of FBXO9 stabilizes PRMT4. Experiments n=3.
Fig. 3. SCFFBXO9 ubiquitinates PRMT4 at K228. A. schematic presentation of PRMT4 truncation constructs.
B. Fragment 150-608 does not accumulate after MG132 treatment. C. K228A point mutant does not
accumulate after MG132 treatment. D. K228 mutant is stable after CHX treatment. E. K228A mutant is
less ubiquitinated compared to WT PRMT4. F. K228A is not degraded after FBXO9 overexpression.
Experiments n=3.
Fig. 4. FBXO9 docks on a phosphodegron 132TxxxS within PRMT4. A. Pull-down assays suggest that
aa100-150 of PRMT4 is important for FBXO9 binding. B, C. Fine mapping the FBXO9 binding sites with
pull-down assays indicate that a phosphodegron 132TxxxS is critical for FBXO9 binding. D, E. Pull-down
assays with phosphorylation/ dephosphorylation mimics indicate that T132 dephosphorylation and S136
phosphorylation promote the degron binding to FBXO9. F. T132 dephosphorylation and S136
phosphorylation accelerate PRMT4 degradation using cycloheximide (CHX). G. Densitometry results of F
were plotted. Experiments n=1.
Fig. 5. LPS reduces FBXO9 levels leading to PRMT4 accumulation and caspase 3 activation in
lymphocytes cells. A-C. Jurkat cells, mouse splenic lymphocytes, and human peripheral blood T cells
were treated with LPS as indicated. Cell lysates were analyzed by PRMT4, cleaved caspase 3, FBXO9, and
β-actin immunoblotting. D. Over-expression of PRMT4 increases cleaved caspase 3 baseline levels in
Jurkat cells. E. Knockout of PRMT4 in Jurkat cells with the CRISPR-Cas9 technique. F, G. KO of PRMT4
represses LPS-induced caspase 3 activation (F) and overexpression of PRMT4 enhances LPS-induced
caspase 3 activation in Jurkat cells (G). H. Lentiviral expression of PRMT4 enhances LPS-mediated
caspase 3 activation and depletion of PRMT4 by lenti-shPRMT4 reduces cleaved caspase 3 in mouse
splenic lymphocytes. I. Depletion of FBXO9 by shRNA increases caspase 3 activation and this activation is
ablated in PRMT4 KO cells. Experiments n=3.
Fig. 6. PRMT4 causes lymphocyte death. A, B. FACS analysis of apoptosis in PRMT4 KO or overexpressed
Jurkat cells with or without LPS treatment. Data of A were quantitated and analyzed with One-way
ENOVA in B (n=3). C, Empty vector (Vec), Lenti-PRMT4 (OE), or shRNA (sh) particles were delivered
intratracheally into the mouse for 14 d. Mouse splenic T cells were isolated and treated with LPS for 18
h, viable cells were counted and analyzed with One-way ENOVA (n=3). D. Jurkat cells were treated with
LPS and a range of PRMT4 inhibitors as indicated for 3 h. Cell lysates were analyzed for cleaved caspase
3. E. Isolated mouse splenic T cells were treated with LPS and TP064, cleaved caspase 3 was
immunoblotting analyzed. Experiments n=3.
Fig. 7. Inhibition of PRMT4 suppresses splenic lymphocyte death in a LPS lung injury model. A-D.
PRMT4 was knocked down (kd) or overexpressed by i.t. administrated lentiviral constructs for 14 d. Mice
were given (i.t.) LPS or PRMT4 inhibitor as indicated for 24 h (n=8). Lung tissues were stained with
Hematoxylin Eosin (H&E) staining (A, upper panels) and TUNEL (A, lower panels). TUNEL positive cells in
lung tissues were quantitated and analyzed with One-way ENOVA (B) (n=3). C. PRMT4 overexpression
and knockdown in lung tissues were analyzed by immunoblotting. D. Splenic tissues from above PRMT4
knockdown or overexpression experiments (A) were stained with TUNEL. E. TUNEL positive cells in
splenic tissues were quantitated and analyzed with One-way ENOVA (n=3). F, G. Isolated splenic T cells
were analyzed with flow cytometry. CD4 was used as a T cell marker. The data from E were plotted in F
and analyzed with One-way ENOVA (n=3). H. Survival studies were conducted in the LPS lung injury
model, mice were observed for 48 h (n=10). “*” indicates p<0.05, “**” indicates p<0.01. H. Scale
bar=100 μm.
Fig. 8. Inhibition of PRMT4 suppresses splenic lymphocyte death in a polymicrobial sepsis model. A.
CLP procedures were conducted in above PRMT4 knockdown or overexpressed mice (n=8). TP064 (0.2
g/mouse) was administrated i.v. in one group for 48 h. Spleen tissues were stained with TUNEL. B.
TUNEL positive cells were quantitated in spleen tissues and analyzed by One-way ENOVA (n=3). C, D.
Isolated splenic cells were analyzed with flow cytometry (C). CD4 was used as T cell marker. The data
from C were analyzed by One-way ENOVA and plotted in D (n=3). E. Mouse serum from each group were
subjected to cytokine proteome profile analysis. The densitometry data were natural log transformed
and analyzed by One-way ENOVA. F. Survival studies were conducted in a CLP model, mice were
observed for 5 days, (n=10). G. The correlation of plasma PRMT4 and IL-6 is analyzed and plotted in
septic patients with lung injury (n=53). Pearson correlation analysis was conducted with the natural log
transformation and Partial after adjusting for age. “*” indicates p<0.05, “**” indicates p<0.01. Scale
bar=100 μm.
Fig. 9. Schematic presentation of the role PRMT4 in septic immunosuppression. PRMT4 is
normally degraded via the SCF-FBXO9 E3 ligase mediated ubiquitin proteasomal pathway to
maintain lymphocyte homeostasis. SCF-FBXO9 recognizes PRMT4 via a phosphodegron and poly-
ubiquitinates PRMT4 at K228. Microbial factors such as endotoxin reduce FBXO9 and result in
PRMT4 protein accumulation. Increased PRMT4 activates caspase 3 to induce lymphocyte
apoptosis that leads to lymphopenia or immunosuppression in septic patients.
Table 1 – Patient Characteristics
Control Sepsis
N 53 53
PRMT4, mean (SD, ng/mL) 7.8 (11.0) 18.4 (28.6)
Demographics
Age, mean (SD) 55(15.0) 55 (17.5)
Male, n (%) 31 (58.5) 24 (45.3)
BMI, mean (SD) 28.8 (9.1) 30.9 (9.4)
Comorbidities, n (%)
Diabetes 16 (30.2) 22 (41.5)
COPD 6 (11.3) 11 (20.7)
Immunosuppression 9 (17) 9 (17)
Chronic Cardiac Failure 3 (5.7) 7 (13.2)
Chronic Kidney Disease 6 (11.3) 5 (9.4)
Pulmonary Fibrosis 0 (0) 2 (3.8)
Active Neoplasm 3 (5.7) 3 (5.7)
Chronic Liver Disease 9 (17) 6 (11.3)
Alcohol Use 13 (24.5) 8 (15.1)
Severity of Illness
SOFA score1, mean (SD) 5.2 (2.4) 7.4 (2.6)
PaO2:FiO2 ratio, mean (SD) 224 (152) 196 (88)
Shock, n (%) 10 (18.9) 34 (64.2)
Acute Kidney Injury, n (%) 22 (41.5) 40 (75.5)
ICU LOS, days, mean (SD) 8.5 (9.4) 13.4 (9.8)
30-day mortality, n (%) 6 (11.3) 12 (22.6)
90-day mortality, n (%) 7 (13.2) 13 (24.5)
BMI - body mass index, COPD - chronic obstructive lung disease, SOFA - sequential organ failure assessment, PaO2 - arterial partial pressure of oxygen, FiO2 - fraction of inspired oxygen, ICU - intensive care unit, LOS - length of stay 1 modified SOFA excludes neurologic score
Table 2. The study of association between PRMT4* and cytokines in septic and non-septic
patients
Group 1 (Sepsis) Crude Adjusted for
age
OR (95%CI)
30 day mortality 1.27 (0.72-2.24) 1.23 (0.67-
2.24)
90 day mortality 1.27 (0.73-2.21) 1.23 (0.69-
2.21)
Use of vasopressor 1.70 (0.97-2.99) 1.79 (1.00-
3.23)
Hyperinflammatory phenotype 1.43 (0.85-2.39) 1.42 (0.84-
2.39)
Correlation (P value)
Ang2* 0.37 (0.007) 0.37 (0.007)
IL8* 0.28 (0.048) 0.27 (0.052)
IL6* 0.37 (0.006) 0.37 (0.007)
Procalcitonin* 0.12 (0.40) 0.14 (0.34)
St2* 0.15 (0.28) 0.15 (0.31)
Fractalkine* 0.05 (0.76) 0.02 (0.92)
IL10* 0.17 (0.23) 0.18 (0.22)
Pentraxin3* 0.23 (0.16) 0.22 (0.19)
Rage* -0.03 (0.85) -0.02 (0.92)
TNFr1* 0.27 (0.052) 0.27 (0.059)
* Natural log transformation
Group 2 (Control) Crude Adjusted for
age
OR (95%CI)
30 day mortality 0.75 (0.37-1.53) 0.62 (0.31-1.24)
90 day mortality 0.89 (0.46-1.72) 0.72 (0.38-1.37)
Use of vasopressor 0.95 (0.51-1.77) 1.00 (0.51-1.98)
Hyperinflammatory phenotype 3.01 (1.29-7.02)1 2.29 (0.95-5.51)
Correlation (P value)
Ang2* 0.04 (0.80) -0.03 (0.83)
IL8* 0.10 (0.49) 0.03 (0.83)
IL6* 0.25 (0.07) 0.20 (0.16)
Procalcitonin* 0.24 (0.08) 0.22 (0.12)
St2* 0.03 (0.82) 0.02 (0.89)
Fractalkine* 0.31 (0.035) 0.31 (0.037)
IL10* -0.08 (0.56) -0.12 (0.41)
Pentraxin3* 0.22 (0.14) 0.18 (0.23)
Rage* 0.21 (0.13) 0.17 (0.23)
TNFr1* 0.12 (0.39) 0.06 (0.67)
* Natural log transformation 1 P = 0.011
Table 3. Primers used in the study
Truncation PRMT4F1 CACCATGGCAGCGGCGGCAGCG
PRMT4F2 CACCATGCACGCGGAGCAGCAG
PRMT4F3 CACCATGATCACCCTGGGCTGCAAC
PRMT4F4 CACCATGTTCCAGTTCTATGGC
PRMT4F5 CACCATGTTTTTTGCTGCTCAAGC
PRMT4F6 CACCATGCAAGTGGACATTATC
PRMT4F7 CACCATGGAACAGCTCTACATGG
PRMT4R1 ACTCCCATAGTGCATGGTGTTG
PRMT4R2 GGAGTGGGTGTGATTGACAATC
PRMT4R3 TGTTCCACATATTCTCCGAGG
PRMT4R4 GTCATAGCTCTGTCTTTTG
PRMT4R5 TATGGAGCCAATGAAAGCAAC
PRMT4R6 CATCAGGATCCGGATGTCAAATG
DN131f CACCATGACACTGGAGCGCTCTGTGTTC
DN132f CACCATGCTGGAGCGCTCTGTGTTCAG
DN133f CACCATGGAGCGCTCTGTGTTCAGTG
DN134f CACCATGCGCTCTGTGTTCAGTGAG
DN135f CACCATGTCTGTGTTCAGTGAGCGGAC
DN136f CACCATGGTGTTCAGTGAGCGGACAG
DN137f CACCATGTTCAGTGAGCGGACAGAGG
DN138f CACCATGAGTGAGCGGACAGAGGAATC
DN105f CACCATGAACAGCGTCCTCATCCAG
DN110f CACCATGCAGTTTGCCACACCCCACG
DN115f CACCATGCACGATTTCTGTTCTTTCTAC
DN120f CACCATGTTCTACAACATCCTGAAAAC
DN130f CACCATGCACACACTGGAGCGCTCTG
DN140f CACCATGCGGACAGAGGAATCCTCAG
Mutagenesis T132Cf CCTGTCGGGGCCACTGCCTGGAGCGCTCTGTG
T132Cr CACAGAGCGCTCCAGGCAGTGGCCCCGACAGG
T132Df CCTGTCGGGGCCACGACCTGGAGCGCTCTGTG
T132Dr CACAGAGCGCTCCAGGTCGTGGCCCCGACAGG
S136Cf CCACACACTGGAGCGCTGTGTGTTCAGTGAGCGG
S136Cr CCGCTCACTGAACACACAGCGCTCCAGTGTGTGG
S136Df CCACACACTGGAGCGCGATGTGTTCAGTGAGCGG
S136Dr CCGCTCACTGAACACATCGCGCTCCAGTGTGTGG
T132AS136Af CCACGCACTGGAGCGCGCTGTGTTCAGTGAGCGG
T132AS136Ar CCGCTCACTGAACACAGCGCGCTCCAGTGCGTGG
T132CS136Df CCACTGCCTGGAGCGCGATGTGTTCAGTGAGCGG
T132CS136Dr CCGCTCACTGAACACATCGCGCTCCAGGCAGTGG
K463Af GACCAGACAGGCTCCGCGTCCAGTAACCTGCTGG
K463Ar CCAGCAGGTTACTGGACGCGGAGCCTGTCTGGTC
K471Af GTAACCTGCTGGATCTAGCGAACCCCTTCTTCAGG
K471Ar CCTGAAGAAGGGGTTCGCTAGATCCAGCAGGTTAC
K310Af CATGGAGCAGTTCACCGCAGCCAACTTCTGGTACC
K310Ar GGTACCAGAAGTTGGCTGCGGTGAACTGCTCCATG
K228Af GCAGAGGTCCTGGTGGCGAGTAACAATCTGACAG
K228Ar CTGTCAGATTGTTACTCGCCACCAGGACCTCTGC
K242Af CGTGGTCATCCCTGGCGCAGTAGAGGAGGTCTC
K242Ar GAGACCTCCTCTACTGCGCCAGGGATGACCACG
The orientation of the all primers are in 5’ to 3’ direction.
