Download - Senescence Doxorubicin

doi:10.1152/ajpheart.00068.2009 297:H2169-H2181, 2009. First published 2 October 2009;Am J Physiol Heart Circ Physiol

BrunelliBarisione, Giorgio Ghigliotti, Giuseppina Fugazza, Antonio Barsotti and Claudio Paolo Spallarossa, Paola Altieri, Concetta Aloi, Silvano Garibaldi, Chiaralevels of the telomere binding factors 1 and 2neonatal cardiomyocytes by regulating the expression Doxorubicin induces senescence or apoptosis in rat

You might find this additional info useful...

62 articles, 35 of which can be accessed free at:This article cites http://ajpheart.physiology.org/content/297/6/H2169.full.html#ref-list-1

including high resolution figures, can be found at:Updated information and services http://ajpheart.physiology.org/content/297/6/H2169.full.html

can be found at:AJP - Heart and Circulatory Physiologyabout Additional material and information http://www.the-aps.org/publications/ajpheart

This information is current as of June 25, 2012.

ISSN: 0363-6135, ESSN: 1522-1539. Visit our website at http://www.the-aps.org/.Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2009 by the American Physiological Society. intact animal to the cellular, subcellular, and molecular levels. It is published 12 times a year (monthly) by the Americanlymphatics, including experimental and theoretical studies of cardiovascular function at all levels of organization ranging from the

publishes original investigations on the physiology of the heart, blood vessels, andAJP - Heart and Circulatory Physiology

on June 25, 2012ajpheart.physiology.org

Dow

nloaded from

http://ajpheart.physiology.org/content/297/6/H2169.full.html#ref-list-1

http://ajpheart.physiology.org/content/297/6/H2169.full.html

http://ajpheart.physiology.org/

Doxorubicin induces senescence or apoptosis in rat neonatal cardiomyocytesby regulating the expression levels of the telomere binding factors 1 and 2

Paolo Spallarossa,1* Paola Altieri,1* Concetta Aloi,1 Silvano Garibaldi,1 Chiara Barisione,1

Giorgio Ghigliotti,1 Giuseppina Fugazza,2 Antonio Barsotti,1 and Claudio Brunelli11Research Center of Cardiovascular Biology, Division of Cardiology, and 2Laboratory of Cytogenetics, Departmentof Internal Medicine, University of Genoa, Italy

Submitted 21 January 2009; accepted in final form 28 September 2009

Spallarossa P, Altieri P, Aloi C, Garibaldi S, Barisione C,Ghigliotti G, Fugazza G, Barsotti A, Brunelli C. Doxorubicininduces senescence or apoptosis in rat neonatal cardiomyocytes byregulating the expression levels of the telomere binding factors 1 and2. Am J Physiol Heart Circ Physiol 297: H2169–H2181, 2009. Firstpublished October 2, 2009; doi:10.1152/ajpheart.00068.2009.—Lowor high doses of doxorubicin induce either senescence or apoptosis,respectively, in cardiomyocytes. The mechanism by which differentdoses of doxorubicin may induce different stress-response cellularprograms is not well understood. A recent study showed that the levelof telomere dysfunction may induce senescence or apoptosis. Weinvestigated the pathways to both apoptosis and senescence in neo-natal rat cardiomyocytes and in H9c2 cells exposed to a single pulsedincubation with low or high doses of doxorubicin. High-dose doxo-rubicin strongly reduces TRF2 expression while enhancing TRF1expression, and it determines early apoptosis. Low-dose doxorubicininduces downregulation of both TRF2 and TRF1, and it also increasesthe senescence-associated-�-galactosidase activity, downregulates thecheckpoint kinase Chk2, induces chromosomal abnormalities, andalters the cell cycle. The involvement of TRF1 and TRF2 withapoptosis and senescence was assessed by short interfering RNAinterference. The cells maintain telomere dysfunction and a senescentphenotype over time and undergo late death. The increase in the phase�4N and the presence of micronuclei and anaphase bridges indicatethat cells die by mitotic catastrophe. p38 modulates TRF2 expression,whereas JNK and cytoplasmic p53 regulate TRF1. Pretreatment withspecific inhibitors of MAPKs and p53 may either attenuate thedamage induced by doxorubicin or shift the cellular response to stressfrom senescence to apoptosis. In conclusion, various doses of doxo-rubicin induce differential regulation of TRF1 and TRF2 through p53and MAPK, which is responsible for inducing either early apoptosis orsenescence and late death due to mitotic catastrophe.

p53; mitogen-activated protein kinases; anthracyclines

THE CLINICAL USE OF ANTHRACYCLINES in anti-cancer treatment islimited by their adverse cardiotoxic effects, which includecardiomyopathy and heart failure (22). At high doses, cardio-toxicity often occurs within a few months, whereas low dosesrarely cause deterioration of ventricular function in the firstyear after therapy (58). However, there is now increasingevidence that, several years after therapy, one of three patientstreated with low-dose anthracyclines develops hypokineticcardiomyopathy (21). A number of mechanisms have beenproposed to explain anthracycline cardiotoxicity. Although themost accredited hypothesis states that anthracyclines inducemyocyte loss through oxidative stress and apoptotic cell death

(3, 48), there is controversy whether apoptosis contributes tolate onset cardiotoxicity induced by low doses of doxorubicin(4). Maejima et al. (34) recently showed that when culturedneonatal rat cardiomyocytes are exposed to low concentra-tions of doxorubicin, the cells do not enter apoptotic pro-gram but exhibit a senescence-like phenotype. The hallmarkof cellular senescence is the cell cycle arrest that is accom-panied by important changes in many aspects of cell mor-phology (20, 38). Senescence is the result of changes in theexpression of many proteins that regulates cell cycle, cy-toskeletal function, and cellular architecture and causesimpairment of cell functions, including the regenerativecapacity (19, 30, 53, 57).

Studies performed on tumor cells indicate that low doses ofdoxorubicin, as well as several anti-cancer agents, inducemitotic catastrophe, a phenomenon that is characterized bychromosomal abnormalities and abnormal mitosis that leads tolate cell death. It also has been shown that cells that ultimatelydie of mitotic catastrophe initially show a senescence-likephenotype (18). Therefore, the induction of senescence hasbeen proposed as a novel mechanism of cardiotoxicity inducedby low doses of doxorubicin (34).

A number of studies suggest that telomere dysfunction playsa main role in the stress-induced senescence program and inapoptosis (29). Telomeres are specialized, repetitive, noncod-ing sequences of DNA bound by several proteins, includingtelomere binding factors 1 and 2 (TRF1 and TRF2), which playa crucial role in telomere biology and govern chromosomalstability. The TRF1 multiprotein complex regulates telomerelength and specifically affects mitotic progression, whereasTRF2 is critical for maintaining the telomere t-loop “end-capping” structure, whose function is to prevent chromosomeend-to-end fusion and chromosome abnormalities (50, 55).

It is believed that telomeric dysfunction beyond a certain limittriggers a DNA damage response mediated by p53, a tumorsuppressor protein, and by mitogen-activated protein kinases(MAPKs) (23, 47). MAPKs are highly conserved serine/threoninekinases that are activated in response to a wide variety of stimuliand play a role in numerous cell functions including survival,growth, and proliferation (54, 61, 62). Both p53 and MAPKs areinvolved in doxorubicin-induced cardiotoxicity (31, 49). Thesignal transduction pathways of doxorubicin-induced senescenceand the mechanism by which different doses of the same stressingagent may induce either apoptosis or senescence and mitoticcatastrophe are still poorly understood.

In the present study we investigated the cellular response tostress that occurs in rat neonatal cardiomyocytes exposed to apulsed incubation with apoptotic and subapoptotic concentra-tions of doxorubicin. Our results confirm that subapoptotic

* P. Spallarossa and P. Altieri contributed equally to this work.Address for reprint requests and other correspondence: P. Altieri, Research

Center of Cardiovascular Biology, Division of Cardiology, Univ. of Genoa,Viale Benedetto XV, 6, 16132 Genoa, Italy (e-mail: [email protected]).

Am J Physiol Heart Circ Physiol 297: H2169–H2181, 2009.First published October 2, 2009; doi:10.1152/ajpheart.00068.2009.

0363-6135/09 $8.00 Copyright © 2009 the American Physiological Societyhttp://www.ajpheart.org H2169


Dow

nloaded from


doses of doxorubicin induce senescence, and, for the first time,we have demonstrated the following: 1) cardiomyocytes with asenescence-like phenotype undergo late cardiac death by mi-totic catastrophe; 2) various doses of doxorubicin induce adifferential regulation of TRF1 and TRF2 that is associatedwith the induction of either apoptosis or senescence; 3) p53 andMAPK activation is not only downstream to telomere dysfunc-tion, as suggested by previous literature, but is also a doxoru-bicin-induced signal that affects TRF1 and TRF2 expression;and 4) increases in p53 expression levels, as well as thecytoplasmic accumulation of p53, which are the result of lowdoses of doxorubicin, downregulate TRF1 and play an activerole in inducing senescence, whereas the inhibition of p53results in a transition of the cellular response to doxorubicintreatment from senescence to apoptosis.

MATERIALS AND METHODS

All materials, unless otherwise indicated, were supplied by Sigma-Aldrich (Poole, UK).

Cell and Culture Conditions

Ventricular myocytes from 2-day-old Sprague-Dawley rats were pur-chased (Lonza) and cultured as described (2). H9c2 rat heart-derivedembryonic myocytes (American Type Culture Collection) were cultured aspreviously described (49). Cells were always used at �70% of confluence.

Cells were preincubated for 1 h with or without the ERK1/2pathway inhibitor PD-98059 (50 �M; Calbiochem), the JNK inhibitorSP-600125 (20 �M), or the p38 MAPK inhibitor SB-203580 (3 �M),and with the p53 inhibitor pifithrin-� (PFT; 5 �M) (31). They werethen incubated with or without different doses of doxorubicin for 3 h(14) and analyzed at the time indicated for each experiment. Toevaluate MAPK phosphorylation, we incubated cells with variousdoses of doxorubicin for 20 min. Since both PFT and the MAPKinhibitors were dissolved in 0.1% dimethyl sulfoxide, an equivalentamount of vehicle was added to both the control and the drug-treatedsamples when the experiments were performed with these inhibitors.

Reverse Transcriptase-Polymerase Chain Reaction

Reverse transcriptase-polymerase chain reaction (RT-PCR) wasperformed using the previously described procedure (49). The quan-tity of mRNA was normalized for glyceraldehyde-3-phosphate dehy-drogenase (GAPDH).

Amplification of the cDNA by PCR was performed using theprimers shown in Table 1. The PCR products were quantified by a geldocumentation system with analysis software (Syngene).

Immunoblotting

Immunoblotting was performed using the previously describedprocedure (49). After various treatments, cells were processed to

determine the levels of TRF2 (clone 4S794.15; Imgenex), TRF1(C-19; Santa Cruz Biotechnology), p53 (clone C6A5; BioVision),�-tubulin (B-7; Santa Cruz Biotechnology), actin (I-19; Santa CruzBiotechnology), the phosphorylated MAPK p-p38 (D-8; Santa CruzBiotechnology), p-ERK (E-4; Santa Cruz Biotechnology), and p-JNK(G-7; Santa Cruz Biotechnology). The quantity of protein was nor-malized for GAPDH (0411; Santa Cruz Biotechnology).

Senescence-Associated �-Galactosidase Activity

Cells were stained for �-galactosidase activity as described byDimri et al. (16). The number of senescence-associated �-galactosi-dase staining (SA-�-gal)-positive cells was determined in 100 ran-domly chosen low-power fields (�100) and expressed as a percentageof all counted cells (35).

Annexin V-FITC/Propidium Iodide Staining

Cells were labeled with annexin V-FITC and propidium iodide(A/PI), and 100 randomly selected fields were counted using afluorescence microscope (48). The number of stained cells was nor-malized to the total number of cells as counted by phase-contrastmicroscopy of the same field. Images from independent fields werecaptured and processed using MetaMorph software (Universal Imag-ing, Downingtown, PA).

Trypan Blue Exclusion

Trypan blue exclusion was used to determine the viability of cardio-myocytes. After treatments as described above, cells were trypsinized andincubated with 0.4% trypan blue dye for 2 min and observed with the useof a hemocytometer under a light microscope. Cells that were able toexclude the stain were considered viable, and the percentage of non-bluecells over total cell number was used as an index of viability.

Cell Immunofluorescence

TRF1, TRF2, and p53 expression were all documented by immu-nofluorescence as described by Verzola et al. (56). Cardiomyocyteswere grown on chamber slides to subconfluence and incubated for 3 hin the presence or absence of doxorubicin in cells that had beenpretreated with or without MAPK inhibitors, after which they wereanalyzed. Subsequently, the cells were washed with cold PBS andfixed in 2% paraformaldehyde for 10 min. After an overnight incu-bation with anti-TRF1, anti-TRF2, or anti-p53 antibodies at 4°C, cellswere washed extensively with PBS and exposed to biotinylatedconjugated secondary antibody (Vector) for 30 min. After beingwashed, cells were incubated with FITC-streptavidin (Sigma) for 30min. Slides were observed under a fluorescence microscope. Imagesfrom independent fields were captured and processed using the Meta-Morph software.

Flow Cytometric Analysis

Nuclear DNA content. Trypsinized and floating cells were pooled,washed twice with PBS, and resuspended in 400 �l of hypotonic

Table 1. PCR primer sequences, PCR product size, and GenBank accession number

Primers PCR Primer Sequences, 5�-3� Forward and Reverse PCR Product Size, bp GenBank Accession No.

GAPDH GAGGGGCCATCCACAGTCTT 506 XM_221254TTCATTGACCTCAACTACAT

TRF1 ATCTGGTGTCTCCCTTACGG 154 RNU65656GTGCAGTGATGTCCGACAAC

TRF2 GGACAGCGAGACACTAAAGGC 250 NM_031055CTGGATGACAATGTCTGCTTC

Bax CCAAGAAGCTGAGCGAGTGTCTC 146 NM_017059AGTTGCCGTCTGCAAACATGTCA

Bcl-2 AGCTGCACCTGACGCCCTT 308 NM_016993CAGCCAGGAGAAATCAAACAGAGG

TRF1 and TFR2, telomere binding factors 1 and 2.

H2170 TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

AJP-Heart Circ Physiol • VOL 297 • DECEMBER 2009 • www.ajpheart.org


Dow

nloaded from


solution labeled with PI [5 �g/ml PI, 0.1% (wt/vol) Na-citrate, and0.1% Triton X-100 in sterile water]. Cells were incubated on ice for30 min until DNA content analysis.

PI labeling. Trypsinized and floating cells were pooled, washedtwice with PBS, and suspended in PI solution. All test cells weremonitored by fluorescence-activated cell sorting (FACS; Becton-Dickinson), and data were analyzed using CellQuest software (BectonDickinson).

Chromosome Analysis

Twenty-four hours after treatment with doxorubicin, cells wereexposed to colcemid (0.04 �g/ml) for 90 min at 37°C and to hypotonictreatment (0.075 M KCl) for 15 min at room temperature. Cells werefixed in a methanol and acetic acid (3:1 by volume) mixture for 15min and then washed three times in the fixative. The slides wereair-dried and stained with Giemsa for analysis (37).

F-Actin Detection

Cardiomyocytes growing on slides were fixed, permeabilized, andlabeled simultaneously in PBS containing 50 �g/ml lysopalmi-toylphospatidylcholine, 3.7% formaldehyde, and 5 U/ml fluorescentphallotoxin (A-12379 Alexa488 phalloidin; Molecular Probes). Cellswere rapidly washed three times with PBS and viewed by fluorescentmicroscopy. To quantify the fluorescence and to measure cells area,we performed image analysis using the Leica Q500 MC imageanalysis system (Leica, Cambridge, UK). Three hundred cells wererandomly analyzed for each sample, and the optical density of thesignals was quantitated by a computer. The video image was gener-ated by a charge-coupled device camera connected through a framegrabber to a computer. Single images were digitized for imageanalysis at 256 gray levels. Imported data were quantitatively ana-lyzed using Q500MC Software-Qwin (Leica). The single cells were

randomly selected by the operators by using the cursor, and thenpositive areas were automatically estimated. Constant optical thresh-old and filter combination were used.

TRF1 and TRF2 siRNA Transfection

ON-TARGETplus SMARTpool short interfering RNAs (siRNA),for silencing the expression of target genes TRF1 and TRF2, andON-TARGETplus Non-targeting Pool as a control were purchasedfrom Dharmacon. All transfections were carried out using the manu-facturer’s protocol with DharmaFECT1 transfection reagent (Dhar-macon). Briefly, cardiomyocytes were trypsinized, counted, andplated at a density of 104 cells/cm2. After 24 h, cells were transfectedwith 10, 50, or 100 nM of SMARTpool siRNA or control siRNAusing DharmaFECT1 reagent and analyzed after 24, 48, or 72 h withA/PI staining, SA-�-gal activity, and Western blot analysis.

Statistical Analysis

Data are means � SE of four independent experiments. Statisticalanalysis was performed by one-way ANOVA followed by the Bon-ferroni post hoc test and Wilcoxon signed rank test when appropriate.

RESULTS

Low and High Doses of Doxorubicin Have Different Effectson Plasma Membrane Integrity and Bax-�/Bcl-2Protein Ratio

Twenty-four and forty-eight hours after having been ex-posed to doxorubicin for 3 h, A/PI double staining revealedthe typical pattern of early-stage apoptosis [A()/PI(-)] andlate-stage apoptosis [A()/PI()] only in cells that hadbeen exposed to 1 �M doxorubicin (Fig. 1, A and B). After

Fig. 1. Low-dose doxorubicin induces nonapoptotic cardiacdamage. A: representative photographs of annexin-V (A)/propidium iodide (PI) staining of neonatal rat cardiomyocytestreated with 2 different doses (0.1 or 1 �M) of doxorubicin.ct, Control. B: percentage of A and/or PI-positive () cells atthe indicated doses and time points (magnification, �200).C: mRNA Bax and Bcl-2 expression 6 h after treatment with0.1 or 1 �M doxorubicin. Histograms illustrate the mRNABax/Bcl-2 expression ratio. *P � 0.05 vs. ct.

H2171TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY



Dow

nloaded from


treatment with 0.1 �M doxorubicin, we observed that thepercentage of A() cells was lower, and that 86% of theA() cells were PI() at 24 h, suggesting that the integrityof the plasma membrane was precociously lost. As a furtherapoptosis index, we measured the Bax-Bcl-2 ratio, whichincreased threefold after treatment with 1 �M doxorubicin,whereas it remained unchanged in cells treated with 0.1 �Mdoxorubicin (Fig. 1C). Enhancement of the ratio indicatesthat cells underwent apoptosis. Thus these results suggestthat 0.1 �M doxorubicin induces nonapoptotic cardiac dam-age.

Low Doses of Doxorubicin Induce Abnormal MitosisAssociated With a Senescent-Like Phenotype and Alterationsof Cytoskeletal Protein Levels

Senescent cells can be identified by the expression of enzy-matic SA-�-gal activity at pH 6.0 and by an enlarged, flattenedphenotype (16). Forty-eight hours after having been exposed todoxorubicin for 3 h, SA-�-gal activity expression was 34, 20,and 8% in cells treated with 0.1, 0.05, and 0.01 �M doxoru-bicin, respectively, whereas it remained unchanged in cellstreated with higher doses (Fig. 2A). Cells treated with 0.1 �M

Fig. 2. A: quantitation of senescence-associ-ated �-galactosidase (SA-�-gal) activity in car-diomyocytes treated with different doses ofdoxorubicin (left). *P � 0.05 vs. ct. Represen-tative images are shown at right (magnification,�200). B: representative images showing themorphological changes and SA-�-gal activityin cardiomyocytes treated with 0.1 and 1 �Mdoxorubicin. Cells were counterstained withGiemsa solution (magnification, �400). C: rep-resentative image showing anaphase bridges incardiomyocytes treated with 0.1 �M doxorubi-cin and stained with 4,6-diamidino-2-phenylin-dole (magnification, �1,000). D: bar graphshowing cell viability determined by trypanblue exclusion analysis after exposure to 0.1, 1,and 10 �M doxorubicin. ^P � 0.05 vs. day 0.§P � 0.05 vs. day 1. ‡P � 0.05 vs. day 2. #P �0.05 vs. day 3. E: representative images show-ing phalloidin staining for F-actin filaments incardiomyocytes treated with 0.1 and 1 �Mdoxorubicin (magnification, �1,000). Bargraphs show changes in F-actin density and cellsize in cardiomyocytes treated with 0.1 or 1 �Mdoxorubicin. *P � 0.05 vs. ct. F: Western blotanalysis showing the levels of actin and �-tu-bulin in cells incubated with 0.1 �M doxorubi-cin. *P � 0.05 vs. ct.




Dow

nloaded from


doxorubicin showed enlarged volume, flattened morphology,and the appearance of vacuolated cells (Fig. 2B). Some cellsalso contained several nuclei of unequal size, including micro-nuclei (Fig. 2B), whereas nuclei staining documented thepresence of anaphase bridges (Fig. 2C).

Cells treated with 1 �M doxorubicin exhibited condensednuclei, which are characteristic of apoptotic cells, (Fig. 2B).Cell viability, determined by trypan blue exclusion analysis,was maintained for the first 4 days after exposure to 0.1 �Mdoxorubicin, whereas it decreased in a dose-dependent mannerafter exposure to 1 and 10 �M doxorubicin (Fig. 2D).

We then examined how pulsed incubation with doxorubicinaffects cytoskeletal remodeling. Phalloidin staining showedthat at a dose of 0.1 �M, doxorubicin increased cell size andboth the length and density of the cytoplasmic actin fibers,whereas at a dose of 1 �M, it led to the disruption of the actinfibers (Fig. 2E). Western blot analysis showed a 300% increasein actin levels and a 50% reduction in �-tubulin levels in cellsincubated with 0.1 �M doxorubicin (Fig. 2F).

Flow cytometric analysis was used to assess changes in DNAcontent. At 48 h, cells treated with 1 �M doxorubicin demon-strated an increase in the sub-G1 phase and a decrease in the G2/Mphase, whereas cells treated with 0.1 �M doxorubicin showed anincrease in the S phase and in the hyperploid (�4N DNA) cellpopulation (Fig. 3A). In 0.1 �M doxorubicin-treated cells, wealso observed both a downregulation of the expression of theDNA damage-induced checkpoint kinase Chk2, which nor-mally prevents the induction of mitosis, and polyploid met-aphases with several chromosomal abnormalities, includingdicentric chromosome, end-to-end fusion, and ring and stringconfiguration (Fig. 3, B and C). These findings indicate thepresence of mitotic catastrophe.

Doxorubicin Regulates Expression of TRF1 and TRF2

Doxorubicin at 0.1 �M decreased protein and mRNA levelsof TRF1 and TRF2, whereas at 1 �M, it reduced TRF2 andenhanced TRF1 expression (Fig. 4, A and B). These resultswere confirmed by fluorescence analysis (Fig. 4C).

To analyze the influence of TRF1 and TRF2 levels oncellular response, we selectively silenced TRF1 or TRF2 usingthe siRNA transfection technique. By performing transfectionwith various doses of siRNA targeting TRF2, we obtained adose-dependent downregulation of the TRF2 protein levels(Fig. 5A). The 10 nM siRNA induced 18% knockdown ofTRF2 protein that was associated with senescent morphologychanges, including SA-�-gal positivity, marked increase in cellsize, flattened morphology, and early PI positivity, whereas the100 nM siRNA induced a 55% knockdown of the TRF2 proteinthat was associated with apoptosis. siRNA at a dose of 50 nMproduced a 35% knockdown of TRF2 protein that was associ-ated with the presence of both senescent and apoptotic cells(Fig. 5C), which is likely the result of the various levels ofTRF2 silencing in each cell. By performing transfection with100 nM siRNA targeting TRF1, we obtained a 60% knock-down of the TRF1 protein (Fig. 5B). As shown in Fig. 5C, thetransfection with siRNA targeting TRF1 did not alter the cells.

Doxorubicin Regulates TRF1 and TRF2 Expression ThroughMAPK- and p53-Mediated Pathways

We observed that 0.1, 1, and 10 �M doxorubicin induceddose-dependent phosphorylation of p38 and JNK, whereas ERK1/2 was only activated by 10 �M doxorubicin. We found nochanges in total MAPK protein levels (Fig. 6A). Using specificinhibitors, we analyzed the role played by p38, JNK, and p53 inmediating the effect of doxorubicin on TRF1 and TRF2 expres-

Fig. 3. A: changes in DNA content followingtreatment with 0.1 or 1 �M doxorubicin. Cellswere cultured for 24 h after treatment, followedby ethanol permeabilization and PI staining forcell cycle analysis. B: mRNA checkpoint ki-nase Chk2 expression evaluated 6 h after doxo-rubicin treatment. *P � 0.05 vs. ct. §P � 0.05vs. 1 �M doxorubicin. C: metaphase spread incardiomyocytes analyzed 24 h after treatmentwith 0.1 �M doxorubicin. Giemsa stainingshows chromosomal abnormalities and en-doreduplications (magnification, �1,000).




Dow

nloaded from


sion (Fig. 6B). Pretreatment with the p38 inhibitor SB-203580attenuated the downregulation of TRF2 induced by both 0.1 and1 �M doxorubicin but did not modify the effects of doxorubicinon the TRF1 expression. Conversely, pretreatment with the JNKinhibitor SP-600125 did not influence the effects of doxorubicinon the expression of TRF2 but blunted both the 1 �M doxorubi-cin-induced TRF1 upregulation and the 0.1 �M doxorubicin-induced TRF1 downregulation. Pretreatment with the p53 inhib-itor PFT did not influence the effects of doxorubicin on theexpression of TRF2 but did modulate the effects on TRF1 ex-pression. PFT abolished the downregulation of TRF1 in cellsincubated with 0.1 �M doxorubicin and increased the TRF1upregulation in cells incubated with 1 �M doxorubicin.

We then analyzed whether pretreatment with these inhibitorsinfluenced the effects of doxorubicin on the number of SA-�-gal and A() cells (Fig. 6, C and D). We observed that in cellsexposed to 1 �M doxorubicin, pretreatment with SB-203580drastically reduced the number of A() cells, specifically thenumber of cells in late apoptosis characterized by A()/PI()double positivity, whereas pretreatment with SP-600125 orPFT did not produce any effects. When we used 0.1 �Mdoxorubicin, we found that pretreatment with SB-203580,SP-600125, and PFT reduced the number of SA-�-gal cellsfrom 34% to 7, 18, and 16% respectively. Pretreatment withSB-203580 decreased the number of A()/PI() cells,whereas pretreatment with SP-600125 and PFT not only in-creased the number of damaged cells but also induced theappearance of the A()/PI() cell population. These resultsindicate that when doxorubicin is used at subapoptotic doses,

pretreatment with SP-600125 or PFT switches the cell responseto the stress from senescence to apoptosis. Since pretreatmentwith PFT and SP-600125 on cells treated with 0.1 �M doxo-rubicin produced similar effects on TRF1 expression, such assenescence-like phenotype and A()/PI() staining, thisprompted us to investigate the relationship between p53 andJNK. We observed that the 0.1 �M doxorubicin-induced ex-pression of p53 is JNK dependent (Fig. 7A). Fluorescencemicroscopy confirmed these results and showed that p53 ac-cumulation occurs in the cytoplasm and not in the nucleus,where it is considered a marker of p53-mediated apoptosis(Fig. 7B). This result further confirms that the 0.1 �M doxo-rubicin dose is not apoptotic.

Together, these data prove that TRF1 and TRF2 are at thecenter of the pathways that lead to senescence or apoptosis inresponse to doxorubicin. Figure 8 shows the putative signalingpathways involved in doxorubicin-induced senescence or apoptosis.

Effects of a Single Pulsed Incubation With Low-DoseDoxorubicin Are Still Detectable 21 Days Later

Neonatal rat cardiomyocytes cannot be cultured at length;therefore, in an attempt to examine the long-term effects (21 days)of a 3-h pulsed exposure to low-dose doxorubicin, we used H9c2cardiomyocytes. We repeated all the experiments described in theprevious paragraphs and obtained the same results that we hadfound with neonatal rat cardiomyocytes. FACS analysis showedthat the percentage of PI() cell population increased from 8 to58% at day 6 and decreased to 53% at day 15 and to 24% at day

Fig. 4. Dose-dependent effects of doxorubicin on the expres-sion of telomere binding factors 1 and 2 (TRF1 and TRF2) asanalyzed by Western blot (A), RT-PCR (B), and immunofluo-rescence (C; magnification, �200). Immunofluorescence andWestern blot analysis were performed 24 h after treatment;RT-PCR analysis was performed 6 h after treatment. *P � 0.05vs. ct.




Dow

nloaded from


21, a percentage that was three times the basal value (Fig. 9A).Both cell size (Fig. 9, A and B) and the percentage of SA-�-gal-positive cells (Fig. 9C) increased following doxorubicin treatmentand peaked at day 6, still remaining above the basal values at day21. TRF1 and TRF2 protein expression remarkably decreased atday 6 and was still lower than the basal value at day 21 (Fig. 9D).No significant differences were observed in cells incubated with-out doxorubicin. These experiments show that brief exposure tolow-dose doxorubicin induces cell damage that lasts over time.

DISCUSSION

Different Doses of Doxorubicin Induce Senescence orApoptosis Through Different Modulation of TRF1 and TRF2Expression Levels

This study, which investigated the physiological bases ofdoxorubicin-induced senescence, was conceived moving fromtwo lines of evidence. The first arises from the study by Eomet al. (18), who found that chronic exposure of hepatoma cells

Fig. 5. Effects of silencing of the TRF1 and TRF2 genes usingspecific short interfering RNAs (siRNAs). Cardiomyocyteswere transfected with 100, 50, and 10 nM siRNA-targetingTRF2 or with 100 nM siRNA-targeting TRF1. Western blotanalysis at 72 h of TRF2 (A) and TRF1 (B) expression levelswas performed. Cells not transfected (No Trfx) were used asthe endogenous control for transfection. C: representative im-ages showing, from left to right, SA-�-gal activity (magnifi-cation, �200), SA-�-gal activity/counterstaining with Giemsa(magnification, �400), and A/PI staining (magnification,�200) in cells analyzed after 48 h of treatment. Bar graphsshow percentage of SA-�-gal-positive cells (D) and percentageof A/PI-positive cells (E). *P � 0.05 vs. ct.




Dow

nloaded from


to high doses of doxorubicin induced apoptosis, whereas lowerdoses induced senescence and late death by mitotic catastro-phe, and from the study by Maejima et al. (34), who were thefirst to demonstrate that low doses of doxorubicin inducedsenescence in neonatal cardiomyocytes. The second line ofevidence is represented by the study of Lechel et al. (29), whodemonstrated that low and high levels of TRF2 inhibition arerespectively associated with senescence and apoptosis. The

data of the present study indicate that different doses ofdoxorubicin affect the expression of the telomeric bindingproteins TRF1 and TRF2 differently and that these, in turn,decide the type of response to the stress, i.e., senescence orapoptosis. Our data also show that TRF2 plays a prominentrole in deciding the type of cellular response. Using the siRNAtechnique, we have confirmed that high levels of TRF2 down-regulation induce apoptosis and low levels of TRF2 downregu-

Fig. 6. A: effects of exposure to various doses ofdoxorubicin on MAPKs. Total cell lysates wereanalyzed after 20 min of exposure to doxorubicinby Western blotting (top), using antibodies spe-cific for phosphorylated (Ph) and total forms ofMAPK. Bar graph (bottom) shows values forph-MAPK normalized to the amount of total en-zyme and expressed as the relative increase abovecontrol value, which was set at 100. B–D: effects ofthe p38 MAPK inhibitor SB-203580 (SB), theJNK inhibitor SP-600125 (SP), and the p53 in-hibitor pifithrin-� (PFT) on TRF1 and TRF2protein expression levels (B), the percentage ofSA-�-gal active positive cells (C), and the per-centage of A/PI-positive cells (D). Dox, doxoru-bicin. Western blot analysis was performed 24 hafter treatment; SA-�-gal activity and A/PI stain-ing were assessed 48 h after treatment. *P � 0.05vs. ct. §P � 0.05 vs. 0.1 �M doxorubicin. ‡P �0.05 vs. 1 �M doxorubicin. #P � 0.05 vs. SB.

Fig. 7. Effects of 0.1 �M doxorubicin on p53protein expression levels evaluated by West-ern blot analysis (A) and immunofluorescence(B) after pretreatment with or without SB orSP. Analyses were performed 24 h after treat-ment. *P � 0.05 vs. ct. §P � 0.05 vs. 0.1 �Mdoxorubicin.




Dow

nloaded from


lation induce senescence, and we also found that the selectiveknockdown of TRF1 induces neither senescence nor apoptosis.These results are in agreement with a number of studies findingthat a dominant negative allele of human TRF1 does not affectthe growth and viability of a variety of primary and trans-formed human cells (12, 25, 26, 55).

We documented that if doxorubicin induces high levels ofTRF2 downregulation, apoptosis occurs regardless of the levelof TRF1 expression. Conversely, if the stress induces a mod-erate level of TRF2 downregulation, as it does with 0.1 �Mdoxorubicin, TRF1 is crucial for deciding cell response. Aconsensual reduction of TRF1 expression induces senescence;otherwise, apoptosis occurs.

This finding is in line with previous studies demonstratingthat in particular cellular conditions, TRF1 can affect cell cycleprogression and is an important signal for cell survival. Luet al. (33) observed that TRF1 inhibition suppresses the abilityof the mitotic kinase NIMA to induce premature mitotic entryand apoptosis. Kishi et al. (27) found that TRF1 overexpressioncan induce apoptosis in cells with short telomeres but not inthose containing long telomeres. The similarity between ourand Kishi’s data may be better appreciated by keeping in mindthat short telomeres and TRF2 downregulation have similareffects on cell biology (24).

Doxorubicin-induced senescent cardiomyocytes show mor-phologically flattened and enlarged cell shapes associated withcytoskeleton remodeling that is characterized by a significantincrease in the level of actin protein with clearly visiblepolymerized F-actin filaments crossing the whole cell and by adecrease in tubulin levels. Cytoskeletal components are keyregulators of cellular architecture. Functionally, the enhancedactin fibers may construct a frame structure that is needed tosupport the enlarged cells (1, 9). Cytoskeletal components alsoare involved in cellular processes such as cell differentiationand cell cycle regulation and are essential mediators of the cellsignaling pathways that regulate senescence (38, 39). Thereduction of �-tubulin levels in senescent cells has beenviewed as a process that impairs cellular microtubule integrityand may disrupt the normal mitotic processes (51).

Some structural alterations of senescent cells are specific forthe cell type. For example, whereas our data and those ofAlexander et al. (1) document an association between thesenescent phenotype and overexpression of actin in cardiomy-

ocytes and human osteosarcoma cells, Nishio and Inoue (39)documented a reduction in the levels of actin protein insenescent fibroblasts. Differently from neonatal cardiomyo-cytes that do not express vimentin (28, 42), senescent fibro-blasts show an extraordinary production of vimentin (38) that,by anchoring cytoplasmic p53, prevents nuclear import of p53and p53-dependent apoptosis (39).

We found that a pulsed, brief incubation with doxorubicin at1 �M induced apoptosis through a p53-independent pathway.This result is in agreement with previous studies that employedsimilar doses of doxorubicin (60) but contrasts with otherstudies that used higher concentrations of doxorubicin and/orfor a longer amount of time, leading to the discovery thatapoptosis occurs through a p53-dependent pathway (11, 46).Accordingly, we think that the role of p53 in doxorubicin-induced apoptosis in cardiac muscle cells may vary dependingon the concentration and duration of treatment.

We also found that doxorubicin at 0.1 �M induces a senes-cent phenotype, accompanied by an increase in the p53 levelsthat accumulate in the cytoplasm. Many studies have demon-strated that cytoplasmic p53 may contribute to apoptosisthrough transcription-independent mechanisms by amplifyingthe transcription-dependent apoptotic signals triggered by nu-clear p53 (46). However, there also are studies that suggest aprotective role for cytoplasmic p53. In agreement with theabove-mentioned study by Nishio and Inoue (39), Qu et al. (43)also demonstrated that p53 cytoplasmic accumulation inducedby endoplasmic reticulum stress prevents p53 stabilization andp53-mediated apoptosis upon DNA damage.

Nithipongvanitch et al. (40) found nuclear, cytoplasmic, andmitochondrial accumulation of p53 following acute doxorubi-cin treatment and demonstrated that the loss of mitochondrialp53 renders mitochondrial DNA more susceptible to oxidativestress, thus suggesting that mitochondrial p53 accumulationmay participate in mitochondrial DNA repair as a rapid adap-tive response to oxidative stress in cardiomyocytes.

Our data show that p53 plays an active, protective role. Infact, if the incubation of low, prosenescent doses of doxorubi-cin was preceded by pretreatment with PFT, the p53 inhibitor,then cells underwent apoptosis rather than showing a senes-cence phenotype. This finding is in agreement with a study byElmore et al. (17), who found that breast tumor cells that areacutely exposed to doxorubicin exhibit an increase in p53activity and a dramatic increase in �-galactosidase. They alsofound that inactivation of wild-type p53 results in a transitionof the cellular response to doxorubicin treatment from replica-tive senescence to delayed apoptosis (17).

Both the literature as well as our own experimental datacollectively suggest that the following mechanisms may beinvolved in doxorubicin-induced senescence. Doxorubicin in-duces TRF2 downregulation, which causes telomere uncappingand ultimately cell death. At low doses, doxorubicin alsoinduces TRF1 knockdown. Although TRF1 inhibition does notplay a crucial role in unstressed cells, it is of great importancein cells treated with low doses of doxorubicin, because itprevents premature mitotic entry and apoptosis. p53 plays akey role in downregulating TRF1 in cells treated with lowdoses of doxorubicin. If p53 activity is inhibited by PFT, theexposure to low doses of doxorubicin produces TRF1 overex-pression; thus the cellular response program to doxorubicinshifts from senescence to apoptosis. How p53 regulates TRF1

Fig. 8. Proposed signaling pathways involved in apoptosis and senescenceinduced by doxorubicin in cardiac myocytes.




Dow

nloaded from


expression is an open question. We hypothesize that p53 mayfunction in the cytoplasm by relaying a negative regulator ofTRF1 transcription.

The present study shows that p53 and MAPK activation isa doxorubicin-induced signaling that regulates TRF1 andTRF2 expression: p38 mediates the effects on TRF2,whereas JNK regulates TRF1 through p53 activation at lowdoses of doxorubicin and in a p53-independent manner athigh doses of the drug. Previous studies have shown thatp38 and p53 are senescence-executing molecules that areactivated by telomere dysfunction (23, 25). We do notbelieve that the previous observations conflict with ourpresent results, since the point of MAPK and p53 activationcan be either upstream or downstream from telomere dys-function. This is in agreement with the study by Iwasa et al.(23), who found that p38 is activated by H2O2 and that p38activation persists after H2O2 removal. It may be argued thatdoxorubicin directly induces MAPK and p53 activation,which determines telomere dysfunction, which in turn in-creases their activation.

Cells With Doxorubicin-Induced Senescent Like PhenotypeMay Die of Mitotic Catastrophe

In an attempt to better understand the mechanism involvedin doxorubicin-induced late cardiac toxicity, we chose to ex-pose cells to a pulsed, short-term incubation with doxorubicin,because it has been shown that prolonged treatment is lethaleven if the doses of the drug are low (18). We observed thatwhereas 1 �M doxorubicin led to rapid death through apopto-sis, 0.1 �M doxorubicin induced a senescent-like phenotypeand caused death through mitotic catastrophe of a lower num-ber of treated cells. In addition, we found that a relevantnumber of surviving myocytes had a senescent phenotype thatwas documented 21 days after treatment by the increase of cellvolume, the presence of SA-�-gal activity, and the downregu-lation of TRF2 and TRF1 expression.

Mitotic catastrophe is a mode of death slower than apoptosisthat results from DNA damage coupled with altered functions ofthe various checkpoint mechanisms whose role is to arrest pro-gression into mitosis until repair (7). In the present study we

Fig. 9. Time-response analysis of the effects of asingle treatment of 0.1 �M doxorubicin on H9c2 cells.A: representative fluorescence-activated cell sorting(FACS) dot plots of PI staining. B: representativeFACS histograms of cell size (top). Gray shaded area,day 0; red line, day 6; blue line, day 15; and green line,day 21. Table (bottom) shows median and coefficientof variation values for the same experiment. C: per-centage of SA-�-gal-positive cells. D: Western blotanalysis of TRF1 and TRF2 expression. *P � 0.05 vs.day 0. §P � 0.05 vs. day 4. ‡P � 0.05 vs. day 6.




Dow

nloaded from


observed the typical biochemical and morphological features ofmitotic catastrophe, which include the presence of multinucleatedcells with micronuclei and/or nuclei of unequal size (likely arisingthrough abnormal mitosis), anaphase bridges, changes in DNAcontent (�4N), and evidence of chromosomal abnormalities (18,29, 59). In agreement with Castedo et al. (8), who found that thedoxorubicin-induced inhibition of Chk2 facilitates the inductionof mitotic catastrophe, we observed a downregulation of theChk2, a cell cycle checkpoint that governs the order and timing ofcell cycle transition to ensure completion of one cellular eventbefore the commencement of another and therefore acts as anegative regulator of mitotic catastrophe.

It is well-known that polyploidy and chromosomal aberra-tions are the consequence of TRF2 downregulation. In fact,TRF2 downregulation determines the molecular disassemblyof the telomere complex and causes the deprotection of chro-mosome ends, which then become the substrate of repairactivities, resulting in covalent fusion of two chromosomes andthe appearance of anaphase bridges, which must be torn awayto allow the mitosis to proceed. As a result, each daughter cellwill inherit a chromosome with a double-strand break at oneend that will be fused to another uncapped end, perpetuating acycle of breakage-fusion-bridge that may lead to cell death(13). If cells do not escape from this cycle, cell death mayoccur even much later on and several mitoses after the appli-cation of the stress (32).

Do Telomere Dysfunction and Senescence Play a Role inDoxorubicin-Induced Heart Failure Cardiomyopathy?

Until a few years ago, the prevailing belief was that the heart isa terminally differentiated organ whose response to pathologicalloads or cell death can only be accomplished by hypertrophy ofdifferentiated cells. In the past few years, a number of studies havedemonstrated that the heart contains a pool of stem cells that areable to create new myocytes (5, 36, 41).

More recently, it has been shown that the heart is characterizedby a heterogeneous population of myocytes and that small, im-mature dividing myocytes can be found together with the old,hypertrophied nonreplicating ones (10). There is currently increas-ing evidence of a slow, on-going turnover of cardiomyocytes inthe normal heart involving the death of cardiomyocytes and thegeneration of new cardiomyocytes (6, 19, 53). A number ofstudies have demonstrated that the heart contains a pool ofresident progenitor cells (36) and a population of small, immaturedividing p16INK4a-negative myocytes with long telomeres (45)that have been considered the link between progenitor cells andmore differentiated, nonreplicating cardiomyocytes. Conceptu-ally, heart failure may now be considered a myocyte-deficiencydisease in which pump dysfunction supervenes when cell loss isnot compensated by hypertrophy of the existing myocytes andregeneration of new myocytes. It must be kept in mind that we arealready well aware of a model in which the impaired function ofregenerative cells contributes to myocardial dysfunction, i.e.,aging. This is a process in which the impaired function ofprogenitor cells significantly contributes to the dysregulation ofendogenous repair mechanisms and explains the increased sever-ity of cardiovascular pathophysiology that is observed in thegeriatric population (15, 19, 44, 52).

Neonatal rat cardiomyocytes share some characteristics withthe population of small, immature replicating cells that are present

in the adult heart and that are reminiscent of a fetal/neonatalphenotype (10). Thus our experimental model may be considereda convenient indicator of what might happen to these young andcardioregenerative cells when the heart is exposed to doxorubicin.Current research in the field of cardioregenerative medicine ismainly focused on ways to stimulate and strengthen the regener-ative capacity of progenitor cells in response to stress. Futureresearch also should look into the possibility of protecting pro-genitor cells themselves from dangerous stress.

DISCLOSURES

No conflicts of interest are declared by the author(s).

REFERENCES

1. Alexander K, Yang HS, Hinds PW. Cellular senescence requires CDK5repression of Rac1 activity. Mol Cell Biol 24: 2808–2819, 2004.

2. Antos CL, McKinsey TA, Dreitz M, Hollingsworth LM, Zhang CL,Schreiber K, Rindt H, Gorczysnki RJ, Olson EN. Dose-dependentblockade to cardiomyocyte hypertrophy by histone deacetylase inhibitors.J Biol Chem 278: 28930–28937, 2003.

3. Arola OJ, Saraste A, Pulkki K, Kallajoki M, Parvinen M, Voipio-Pulkki LM. Acute doxorubicin cardiotoxicity involves cardiomyocyteapoptosis. Cancer Res 60: 1789–1792, 2000.

4. Auner HW, Tinchon C, Linkesch W, Halwachs-Baumann G, Sill H.Correspondence re: O. J. Arola et al., acute doxorubicin cardiotoxicityinvolves cardiomyocyte apoptosis. Cancer Res 60: 1789–1792, 2000.Cancer Res 61: 2335–2336, 2001.

5. Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, ChimentiS, Kasahara H, Rota M, Musso E, Urbanek K, Leri A, Kajstura J,Nadal-Ginard B, Anversa P. Adult cardiac stem cells are multipotent andsupport myocardial regeneration. Cell 114: 763–776, 2003.

6. Boni A, Urbanek K, Nascimbene A, Hosoda T, Zheng H, Delucchi F,Amano K, Gonzalez A, Vitale S, Ojaimi C, Rizzi R, Bolli R, Yutzey KE,Rota M, Kajstura J, Anversa P, Leri A. Notch1 regulates the fate of cardiacprogenitor cells. Proc Natl Acad Sci USA 105: 15529–15534, 2008.

7. Castedo M, Perfettini JL, Roumier T, Andreau K, Medema R, Kro-emer G. Cell death by mitotic catastrophe: a molecular definition. Onco-gene 23: 2825–2837, 2004.

8. Castedo M, Perfettini JL, Roumier T, Yakushijin K, Horne D,Medema R, Kroemer G. The cell cycle checkpoint kinase Chk2 is anegative regulator of mitotic catastrophe. Oncogene 23: 4353–4361, 2004.

9. Chen QM, Tu VC, Catania J, Burton M, Toussaint O, Dilley T.Involvement of Rb family proteins, focal adhesion proteins and proteinsynthesis in senescent morphogenesis induced by hydrogen peroxide.J Cell Sci 113: 4087–4097, 2000.

10. Chen X, Wilson RM, Kubo H, Berretta RM, Harris DM, Zhang X,Jaleel N, MacDonnell SM, Bearzi C, Tillmanns J, Trofimova I,Hosoda T, Mosna F, Cribbs L, Leri A, Kajstura J, Anversa P, HouserSR. Adolescent feline heart contains a population of small, proliferativeventricular myocytes with immature physiological properties. Circ Res100: 536–544, 2007.

11. Chua CC, Liu X, Gao J, Hamdy RC, Chua BH. Multiple actions ofpifithrin-alpha on doxorubicin-induced apoptosis in rat myoblastic H9c2cells. Am J Physiol Heart Circ Physiol 290: H2606–H2613, 2006.

12. Cooley C, Baird KM, Faure V, Wenner T, Stewart JL, Modino S,Slijepcevic P, Farr CJ, Morrison CG. Trf1 is not required for prolifer-ation or functional telomere maintenance in chicken DT40 cells. Mol BiolCell 20: 2563–2571, 2009.

13. de Lange T. Protection of mammalian telomeres. Oncogene 21: 532–540,2002.

14. de Magalhaes JP, Chainiaux F, Remacle J, Toussaint O. Stress-inducedpremature senescence in BJ and hTERT-BJ1 human foreskin fibroblasts.FEBS Lett 523: 157–162, 2002.

15. Dimmeler S, Leri A. Aging and disease as modifiers of efficacy of celltherapy. Circ Res 102: 1319–30, 2008.

16. Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, MedranoEE, Linskens M, Rubelj I, Pereira-Smith O, Peacocke M, Campisi J.A biomarker that identifies senescent human cells in culture and in agingskin in vivo. Proc Natl Acad Sci USA 92: 9363–9367, 1995.

17. Elmore LW, Rehder CW, Di X, McChesney PA, Jackson-Cook CK,Gewirtz DA, Holt SE. Adriamycin-induced senescence in breast tumor




Dow

nloaded from


cells involves functional p53 and telomere dysfunction. J Biol Chem 277:35509–35515, 2002.

18. Eom YW, Kim MA, Park SS, Goo MJ, Kwon HJ, Sohn S, Kim WH,Yoon G, Choi KS. Two distinct modes of cell death induced by doxoru-bicin: apoptosis and cell death through mitotic catastrophe accompaniedby senescence-like phenotype. Oncogene 24: 4765–4777, 2005.

19. Gonzalez A, Rota M, Nurzynska D, Misao Y, Tillmanns J, Ojaimi C,Padin-Iruegas ME, Muller P, Esposito G, Bearzi C, Vitale S, Dawn B,Sanganalmath SK, Baker M, Hintze TH, Bolli R, Urbanek K, HosodaT, Anversa P, Kajstura J, Leri A. Activation of cardiac progenitor cellsreverses the failing heart senescent phenotype and prolongs lifespan. CircRes 102: 597–606, 2008.

20. Hayflick L, Moorhead PS. The serial cultivation of human diploid cellstrains. Exp Cell Res 25: 585–621, 1961.

21. Hequet O, Le QH, Moullet I, Pauli E, Salles G, Espinouse D, Dumon-tet C, Thieblemont C, Arnaud P, Antal D, Bouafia F, Coiffier B.Subclinical late cardiomyopathy after doxorubicin therapy for lymphomain adults. J Clin Oncol 22: 1864–71, 2004.

22. Hershman DL, McBride RB, Eisenberger A, Tsai WY, Grann VR,Jacobson JS. Doxorubicin, cardiac risk factors, and cardiac toxicity inelderly patients with diffuse B-cell non-Hodgkin’s lymphoma. J ClinOncol 26: 3159–3165, 2008.

23. Iwasa H, Han J, Ishikawa F. Mitogen-activated protein kinase p38defines the common senescence-signalling pathway. Genes Cells 8: 131–144, 2003.

24. Jacobs JJ, de Lange T. p16INK4a as a second effector of the telomeredamage pathway. Cell Cycle 4: 1364–1368, 2005.

25. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- andATM-dependent apoptosis induced by telomeres lacking TRF2. Science283: 1321–1325, 1999.

26. Karlseder J, Smogorzewska A, de Lange T. Senescence induced byaltered telomere state, not telomere loss. Science 295: 2446–2449, 2002.

27. Kishi S, Wulf G, Nakamura M, Lu KP. Telomeric protein Pin2/TRF1induces mitotic entry and apoptosis in cells with short telomeres and isdown-regulated in human breast tumors. Oncogene 20: 1497–1508, 2001.

28. LaFramboise WA, Guthrie RD, Scalise D, Elborne V, Bombach KL,Armanious CS, Magovern JA. Effect of muscle origin and phenotype onsatellite cell muscle-specific gene expression. J Mol Cell Cardiol 35:1307–1318, 2003.

29. Lechel A, Satyanarayana A, Ju Z, Plentz RR, Schaetzlein S, Rudolph C,Wilkens L, Wiemann SU, Saretzki G, Malek NP, Manns MP, Buer J,Rudolph KL. The cellular level of telomere dysfunction determines inductionof senescence or apoptosis in vivo. EMBO Rep 6: 275–281, 2005.

30. Lin AW, Barradas M, Stone JC, van Aelst L, Serrano M, Lowe SW.Premature senescence involving p53 and p16 is activated in response toconstitutive MEK/MAPK mitogenic signaling. Genes Dev 12: 3008–3019, 1998.

31. Liu X, Chua CC, Gao J, Chen Z, Landy CL, Hamdy R, Chua BH.Pifithrin-� protects against doxorubicin-induced apoptosis and acute cardio-toxicity in mice. Am J Physiol Heart Circ Physiol 286: H933–H939, 2004.

32. Londono-Vallejo JA. Telomere instability and cancer. Biochimie 90:73–82, 2008.

33. Lu KP, Hanes SD, Hunter T. A human peptidyl-prolyl isomeraseessential for regulation of mitosis. Nature 380: 544–547, 1996.

34. Maejima Y, Adachi S, Ito H, Hirao K, Isobe M. Induction of prematuresenescence in cardiomyocytes by doxorubicin as a novel mechanism ofmyocardial damage. Aging Cell 7: 125–136, 2008.

35. Martin-Ruiz C, Saretzki G, Petrie J, Ladhoff J, Jeyapalan J, Wei W,Sedivy J, von Zglinicki T. Stochastic variation in telomere shortening ratecauses heterogeneity of human fibroblast replicative life span. J Biol Chem279: 17826–17833, 2004.

36. Messina E, De Angelis L, Frati G, Morrone S, Chimenti S, FiordalisoF, Salio M, Battaglia M, Latronico MV, Coletta M, Vivarelli E, FratiL, Cossu G, Giacomello A. Isolation and expansion of adult cardiac stemcells from human and murine heart. Circ Res 95: 911–921, 2004.

37. Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkeyDJ, Newman RA, Pathak S. Caspase-dependent apoptosis induced bytelomere cleavage and TRF2 loss. Neoplasia 2: 339–345, 2000.

38. Nishio K, Inoue A, Qiao S, Kondo K, Mimura A. Senescence andcytoskeleton: overproduction of vimentin induces senescent-like morphol-ogy in human fibroblasts. Histochem Cell Biol 116: 321–327, 2001.

39. Nishio K, Inoue A. Senescence-associated alterations of cytoskeleton:extraordinary production of vimentin that anchors cytoplasmic p53 insenescent human fibroblasts. Histochem Cell Biol 123: 263–273, 2005.

40. Nithipongvanitch R, Ittarat W, Velez JM, Zhao R, St Clair DK,Oberley TD. Evidence for p53 as guardian of the cardiomyocyte mito-chondrial genome following acute adriamycin treatment. J HistochemCytochem 55: 629–639, 2007.

41. Oh H, Bradfute SB, Gallardo TD, Nakamura T, Gaussin V, MishinaY, Pocius J, Michael LH, Behringer RR, Garry DJ, Entman ML,Schneider MD. Cardiac progenitor cells from adult myocardium: homing,differentiation, and fusion after infarction. Proc Natl Acad Sci USA 100:12313–12318, 2003.

42. Øie E, Vinge LE, Andersen GØ, Yndestad A, Krobert KA, SandbergC, Ahmed MS, Haug T, Levy FO, Skomedal T, Attramadal H. RAMP2and RAMP3 mRNA levels are increased in failing rat cardiomyocytes andassociated with increased responsiveness to adrenomedullin. J Mol CellCardiol 38: 145–151, 2005.

43. Qu L, Huang S, Baltzis D, Rivas-Estilla AM, Pluquet O, Hatzoglou M,Koumenis C, Taya Y, Yoshimura A, Koromilas AE. Endoplasmicreticulum stress induces p53 cytoplasmic localization and prevents p53-dependent apoptosis by a pathway involving glycogen synthase kinase-3beta. Genes Dev 18: 261–277, 2004.

44. Rota M, LeCapitaine N, Hosoda T, Boni A, De Angelis A, Padin-Iruegas ME, Esposito G, Vitale S, Urbanek K, Casarsa C, Giorgio M,Luscher TF, Pelicci PG, Anversa P, Leri A, Kajstura J. Diabetespromotes cardiac stem cell aging and heart failure, which are prevented bydeletion of the p66shc gene. Circ Res 99: 42–52, 2006.

45. Rota M, Hosoda T, De Angelis A, Arcarese ML, Esposito G, Rizzi R,Tillmanns J, Tugal D, Musso E, Rimoldi O, Bearzi C, Urbanek K,Anversa P, Leri A, Kajstura J. The young mouse heart is composed ofmyocytes heterogeneous in age and function. Circ Res 101: 387–99, 2007.

46. Sardao VA, Oliveira PJ, Holy J, Oliveira CR, Wallace KB. Doxoru-bicin-induced mitochondrial dysfunction is secondary to nuclear p53activation in H9c2 cardiomyoblasts. Cancer Chemother Pharmacol 64:811–827, 2009.

47. Smogorzewska A, de Lange T. Different telomere damage signalingpathways in human and mouse cells. EMBO J 21:4338–4348, 2002.

48. Spallarossa P, Garibaldi S, Altieri P, Fabbi P, Manca V, Nasti S,Rossettin P, Ghigliotti G, Ballestrero A, Patrone F, Barsotti A, BrunelliC. Carvedilol prevents doxorubicin-induced free radical release and apoptosisin cardiomyocytes in vitro. J Mol Cell Cardiol 37: 837–846, 2004.

49. Spallarossa P, Altieri P, Garibaldi S, Ghigliotti G, Barisione C, Manca V,Fabbi P, Ballestrero A, Brunelli C, Barsotti A. Matrix metalloproteinase-2and -9 are induced differently by doxorubicin in H9c2 cells: the role of MAPkinases and NAD(P)H oxidase. Cardiovasc Res 69: 736–745, 2006.

50. Stansel RM, de Lange T, Griffith JD. T-loop assembly in vitro involvesbinding of TRF2 near the 3� telomeric overhang. EMBO J 20: 5532–5540,2001.

51. Tierno MB, Kitchens CA, Petrik B, Graham TH, Wipf P, Xu FL,Saunders WS, Raccor BS, Balachandran R, Day BW, Stout JR,Walczak CE, Ducruet AP, Reese CE, Lazo JS. Microtubule binding anddisruption and induction of premature senescence by disorazole C1.J Pharmacol Exp Ther 328: 715–22, 2009.

52. Torella D, Rota M, Nurzynska D, Musso E, Monsen A, Shiraishi I,Zias E, Walsh K, Rosenzweig A, Sussman MA, Urbanek K, Nadal-Ginard B, Kajstura J, Anversa P, Leri A. Cardiac stem cell andmyocyte aging, heart failure, and insulin-like growth factor-1 overexpres-sion. Circ Res 94: 514–524, 2004.

53. Urbanek K, Torella D, Sheikh F, De Angelis A, Nurzynska D, SilvestriF, Beltrami CA, Bussani R, Beltrami AP, Quaini F, Bolli R, Leri A,Kajstura J, Anversa P. Myocardial regeneration by activation of multi-potent cardiac stem cells in ischemic heart failure. Proc Natl Acad Sci USA102: 8692–8697, 2005.

54. Valledor AF, Comalada M, Xaus J, Celada A. The differential time-course of extracellular-regulated kinase activity correlates with the mac-rophage response toward proliferation or activation. J Biol Chem 275:7403–7409, 2000.

55. van Steensel B, de Lange T. Control of telomere length by the humantelomeric protein TRF1. Nature 385: 740–743, 1997.

56. Verzola D, Gandolfo MT, Salvatore F, Villaggio B, Gianiorio F,Traverso P, Deferrari G, Garibotto G. Testosterone promotes apoptoticdamage in human renal tubular cells. Kidney Int 65: 1252–1261, 2004.

57. Vigneron A, Roninson IB, Gamelin E, Coqueret O. Src inhibits adria-mycin-induced senescence and G2 checkpoint arrest by blocking theinduction of p21waf1. Cancer Res 65: 8927–8935, 2005.




Dow

nloaded from


58. Von Hoff DD, Layard MW, Basa P, Davis HL Jr, Von Hoff AL,Rozencweig M, Muggia FM. Risk factors for doxorubicin-induced con-gestive heart failure. Ann Intern Med 91: 710–717, 1979.

59. Walen KH. Origin of diplochromosomal polyploidy in near-senescentfibroblast cultures: heterochromatin, telomeres and chromosomal instabil-ity (CIN). Cell Biol Int 31: 1447–1455, 2007.

60. Wang S, Konorev EA, Kotamraju S, Joseph J, Kalivendi S, Kaly-anaraman B. Doxorubicin induces apoptosis in normal and tumor cells

via distinctly different mechanisms: intermediacy of H2O2- and p53-dependent pathways. J Biol Chem 279: 25535–25543, 2004.

61. Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. Opposingeffects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270:1326–1331, 1995.

62. Yujiri T, Sather S, Fanger CR, Johnson GL. Role of MEKK1 in cellsurvival and activation of JNK and ERK pathways defined by targetedgene disruption. Science 282: 1911–1914, 1998.




Dow

nloaded from


Download - Senescence Doxorubicin

Top Related