![Page 1: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/1.jpg)
STRUCTURE DETERMINATION OF THE APO-FORM OF HUMAN INOSINE 5'-MONOPHOSPHATE
DEHYDROGENASE TYPE I I
Steve Bryson
A thesis submitted in confomity with the requirements
for the degree of Doctor of Philosophy
Graduate Department of Biochemistry
University of Toronto
O Copyright by Steve Bryson 2001
![Page 2: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/2.jpg)
National Library I*( of Canada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395, nie Wellington Ottawa ON K1A ON4 OttawaON K1AON4 Canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distrihte or seLi reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d' auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels m2y be printed or otheMnse de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
![Page 3: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/3.jpg)
STRUCTURE DETERMINATION OF THE APO-FORM OF HUMAN INOSINE 5'-MONOPHOSPHATE
DEHYDROGENASE TYPE II
Steve Bryson Ph.D. 2001 Department of Biochemistry
University of Toronto
Abstract
Human inosine 5'-monophosphate dehydrogenase (IMPDH) controls a key
metabolic step in the regulation of cell differentiation and growth. The catalytic
reaction involves the NAD-dependent oxidation of inosine 5'-monophosphate
(IMP) to xanthosine 5'-monophosphate (XMP), which is the rate-limiting step in
the de novo biosynthesis of guanine nucleotides. There are two identifiable
isoforms of IMPDH, type I and type II. Type I is a tissue-specific, constituatively
expressed protein while the type II isoform is significantly up-regulated in
neoplastic and differentiating cells. As a consequence. IMPDH has been
validated as a target in antitumor and irnmunosuppressive drug design.
A method was developed to obtain rnilligram quantities of the human type II
IMPDH isoform by amplification of the coding region cDNA by PCR, recombining
the cDNA into a bacterial nigh-level expression plasmid. and large-scale protein
purification to obtain between 25 and 30 mg of protein per liter of bacterial culture.
Large. single crystals of the apo-form of the enzyme were reproducibly grown.
They were suitable for X-ray diffraction analysis and diffraction data were
collected to 3.2 A resolution. The crystal structure was solved by molecular
![Page 4: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/4.jpg)
replacement using the hamster IMPDH II structure as a search model followed by
model building and refinement. The residuals for the final model were RWst =
23.0% and Rt,,, = 28.9%.
Analysis of the model demonstrated that the main fold of the enzyme was
an d p barrel. It was also revealed that parts of the protein surrounding the active
site were disordered. When comparing the human apo-form of IMPDH II to the
human IMPDH II structure that was complexed with ligands, these regions
becorne ordered upon ligand association. Sequence alignments indicated that
these regions are conserved throughout evolution and that this type of ordering
was most probably fundamental to the proper function of the enzyme. These
structural data were consistent with published functional data that showed that
IMPDH undergoes significant conformational changes on substrate association
and that the apo-fom of IMPDH has multiple structural conformations.
![Page 5: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/5.jpg)
Acknowledgments
I would like to acknowledge the people who directly and indirectly
contributed to this work. The first person I would like to recognize is Yvette
Losier. She is my lover, my best friend, and the mother of my daughter. EmJ.
She never expected anything less of me, while never being too concerned about
the outcome. She supported me during my undergraduate years aiid stayed
home to raise Our daughter throughout the entirety of this work. In fact, she
worked far harder than I on a project far more important. I would like to thank my
supervisor, Dr. Emil F. Pai of the Department of Biochemistry, University of
Toronto. He allowed me to follow my own learning path and attain the goals that I
had established for myself from the beginning; and, cutting me a few new paths in
the process. I would also like to acknowledge my graduate committee, Dr. B.
Sarkar (Hospital For Sick Children) and Dr. Dave Rose (Ontario Cancer Institute)
for always providing me with positive encouragement and advice.
I would like to give a great deal of thanks to my good friend Annie
Cunningham. who sat at my back for 7 years and always making it fun to corne
work. She was the driving force behind the high level of moral that was constant
in the Pai lab. I would like to recognize the assistance of Vinnie Stoll and Rosi
Hynes, who taught me the practice of protein crystallography; Piotr Sliz and Abdu
Djebli, who showed me the quickest way to do things on the cornputers; Emma
MacFarlane, for teaching me the practice of molecular biology (and telling me
![Page 6: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/6.jpg)
what I could do and not what I should do); and, Uli Eikmanns who taught me the
practice of protein expression and purification (and showed me how to get the job
done, even if you don't have the equiprnent to do it).
I would like to acknowledge sorne of the people in the Department of
Biochemistry. First I would like to thank the Biochemistry office staff. specifically
Suzanne Delvise, Carol Justice, Anna Vanek. and Carrie Harber. for always
having a smile and a kind word for me (and sorne cookies and water for my
daughter). I would also like to thank Pat Bronskill for making teaching easy and
telling me 1 was her favorite TA; Dr. Mariam Packham. for recognizing my
potential as a scientist and giving me a great letter of reference which helped me
get rny first laboratory job in the Pai lab; and Theo Hoffman, for showing me that
the desire and motivation for science cornes frorn a youthful curiosity to learn new
things - even if your in your seventies.
Finally, I would like to recognize the roll that my family played in this work.
I would like to acknowledge the efforts of my mom, Sheila Rooney (nee Hogan),
who, following the death of my father. raised my two brothers and myself on her
own. She provided us with a safe and stable home, which gave us the roots to
stand on Our own. I would also like to thank my step-father Larry Rooney, for
providing me with an example of how tu be hard-working and self-sufficient; and
finally my brother Paul Rooney, who always bestowed upon me a unique
prospective on life, which kept rny "intellectual feet" firmly planted on the ground.
![Page 7: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/7.jpg)
Dedication
l dedicate my Ph.D. thesis to my daughter Emily Jane Losier-Bryson (EmJ).
Her life - and this project - were born coincidentally.
![Page 8: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/8.jpg)
![Page 9: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/9.jpg)
3 . Resul ts ....................................................................................... 3.1. Molecular Biology ...............................................................
3.1 . 1. Cloning of human IMPDH II cDNA ............................. 3.1.2. Sub-cloning human IMPDH II cDNA ..........................
....................... 3.1.3. Expression of human IMPDH II cDNA 3.2. Biochemistry ....................................................................
................................ 3.2.1 . Purification of human IMPDH II ................................................... 3.2.2. Enzyme kinetics
...................................................... 3.3. Protein Crystallography 3.3.1. Preliminary crystallization screens ............................
....................... 3.3.2. Crystallization of human apo-IMPDH II 3.3.3. X-ray diffraction data collection and processing ...........
........................................... 3.3.4. Molecular replacement ................................. 3.3.5. Model building and refinernent
3.4. Human apo-IMPDH II mode1 analysis .................................... 3.4.1. Global Fold .......................................................... 3.4.2. Active Site ............................................................
......................................... 3.5. Amino acid sequence alignments .................................................. 3 5 .1 . Overall sequence
3.5.2. Active site ............................................................ ......................................................... 3.5.3. Sub-domain
4 . Discussion ................................................................................. 4.1. Molecular Biology ...............................................................
............................. 4.1.1. Cloning of human IMPDH II cDNA ........................... 4.1.2. Sub-cloning human IMPDH II cDNA
4.1.3. Expression of human IMPDH II cDNA ........................ 4.2. Biochemistry ....................................................................
4.2.1. Purification of human IMPDH II ................................ ................................................... 4.2.2. Enzyme kinetics
...................................................... 4.3. Protein Crystallography 4.3.1 . Preliminary crystallization screens ............................ 4.3.2. Crystallization of human apo-IMPDH II ....................... 4.3.3. X-ray diffraction data collection and processing ............
........................................... 4.3.4. Molecular replacement 4.3.5. Model building and refinernent .................................
.................................... 4.5. Human apo-IMPDH II mode1 anaiysis 4.5.1. Global Fold ..........................................................
......................................................... 4.5.2. Sub-domain 4.5.3. Active Site ............................................................
4.6. Future work on human IMPDH II ................................. .... .....
![Page 10: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/10.jpg)
................................................................................. 5 . References
6 . Appendix ................................................................................... 6.1. Cloning and protein expression of human IMPDH I cDNA ....... 6.2. Crystallization of IMPlMPA complexed human IMPDH II ......... 6.3. Expression . purification . and crystallization of E.coli IMPDH ....
![Page 11: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/11.jpg)
List of Tables
Table 1 List of percentages of IMPDH sequence arnino acid identities .........
Table 2 Purification table for human IMPOH II .........................................
Table 3 Summary of reflection intensities and R., values by resolution shell .
Table 4 Summary of x-ray diffraction observation redundancies .................
Table 5 AMORE molecular replacement solutions with the highest peaks ....
Table 6 Final refinement statistics ........................................................
Table 7 Km and kat values for human type II IMPDHs ...............................
Table 8 List of published IMPDH crystal structures ...................................
![Page 12: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/12.jpg)
List of Figures
Figure 1 Branch-point of the de novo purine biosynthetic pathway ..............
Figure 2 Molecular structures of potent IMPDH in hibitors ..........................
Figure 3 PCR amplification of human lMPDH II cDNA ..............................
Figure 4 Plasrnids isolated frorn positive E . coli transfomants ...................
Figure 5 EcoRI digest sampies of recombinant ligation products ................
Figure 6 Recombination site DNA sequence ..........................................
Figure 7 Expression analysis of pSE420-human IMPDH II recombinants .....
Figure 8 Analysis of the purification of human IMPDH II ...........................
Figure 9 Elution profile of the Heparin-65OM column ................................
Figure 10 Elution profile of the IMP-sepharose column .............................
Figure 1 1 Human apo-IMPDH II microcrystals ........................................
Figure 12 lmproved human apo-IMPDH II crystals ...................................
Figure 13 Large human apo-IMPDH II crystal ..........................................
Figure 14 Two orientations of the hurnan apo-IMPDH II monomer model ......
Figure 15 Two orientations of the human apo-IMPDH II tetramer model .........
Figure 16 Human apo-IMPDH II octameric structure in the 1422 crystal .........
Figure 17 B-factors of the a-carbon atoms of the human IMPDH II tetramer .
Figure 18 Electron density map of human apo-IMPDH II active site heiix ......
Figure 19 Electron density map of human apo-IMPDH II active site flap ........
Figure 20 Overlay of u/P barre1 active site residues ..................................
Figure 21 Electron density map of human apo-IMPDH II C-terminal .............
Figure 22 SDS-PAGE analysis of a re-dissolved human apo-IMPDH II crystal .
![Page 13: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/13.jpg)
Figure 23 Sequence alignments of structurally known IMPDHs ..................
Figure 24 Multiple sequence alignment of the active site helix region ...........
Figure 25 Multiple sequence alignrnent of the active site flap region ............
Figure 26 Multiple sequence alignment of the phosphate-binding region .......
......................... Figure 27 Multiple sequence alignment of the sub-domain
................................. Figure 28 Superposition of various IMPDH structures
Figure 29 Hurnan IMPDH II electron density map in the area of the subdomain . 91
Figure 30 Structural overlays of the phosphate-binding region ...................
............................. Figure A l PCR amplification of human IMPDH I cDNA
..... Figure A2 Expression analysis of pET2l a-human [MPDH I recombinants
Figure A3 Analysis of pET2l a-human IMPDH I - BL21 (DE3) cell lysis .........
............................... Figure A4 Analysis of heparin-650M column fractions
......... Figure A5 A crystal of human IMPDH II complexed with MPA and IMP
............................... Figure A6 Analysis of the purification of E . coli IMPDH
........................................................ Figure A7 An E . coli IMPDH crystal
![Page 14: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/14.jpg)
List of abbreviations
AMP,
AMoRe,
APRT,
ATP,
PME,
BLAST,
8-factor,
CD,
6-CI-IMP,
CTAB,
CTP,
dATP,
dCTP,
dGTP,
DNA,
Dnase,
DTT,
dTTP'
E. coli,
EDTA,
IF1 *
FAD,
adenosine 5'-monophosphate
automated package for molecular replacement (corn puter program package)
adenine phosphoribosyl transferase
adenosine 5'-triphosp hate
P-mercaptoethanol
basic local alignment search tool (computer program package)
isotropic thermal factor
circular dich romisrn
6-chloropurine riboside 5'-monophosphate
hexadecyltrimethylammonium bromide
cytidine 5'-triphosphate
deoxyadenosine 5'-triphosphate
deoxycytosine 5'-triphosphate
deoxyguanosine 5'-triphosphate
deoxyribonucleic acid
deoxyribonuclease
dithiothreitol
deoxythymidine 5'-triphosphate
Eschenchia coli
ethylenediaminetetraacetic acid
structure factor amplitude
flavin adenine dinucleotide
![Page 15: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/15.jpg)
GMP,
GTP,
HGPRT,
IMP,
IPTG,
MES,
MPA,
MPYD.
NAD,
NADH,
PAGE,
PCR,
PEG,
PMSF,
PDB,
PRPP,
RMSD,
RNA,
SAD,
SDS,
TAD,
TAE,
TRIS,
guanosine 5'-monophosphate
guanosine 5'-triphosphate
hypoxanthine-guanine phosphoribosyl transferase
inosine 5'-monophosphate
isopropylthiogalactoside
morpholinoethyl sulfonic acid
mycophenolic acid
1 methyl-2-pyrrolid inone
nicotinamide adenine dinuclueotide, oxidized form
nicotinamide adenine dinuclueotide, reduced form
polyacrylamide gel electrophoresis
polyrnerase chah reaction
polyethylene glycol
phenylmethylsulfonyl fiuoride
Protein Data Bank
5-phosphoribosyl-1 -pyrophosphate
root mean squared deviation
ribonucleic acid
selenazole-4-carboxamide adenine dinucleotide
sodium dodecyl sulfate
thiazole-4-carboxamide adenine dinucleotide
TRIS, acetate, EDTA
Tris(hydroxymethyl)aminomethane
xiii
![Page 16: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/16.jpg)
TTP,
UMP,
UTP,
X-Gal,
XMP,
thymidine 5'-triphosphate
uracil 5'-monophosphate
uracil 5'-triphosp hate
5-bromo-4-chloro-3-indolyl-beta-D-galactoside
xanthosine 5'-monophosphate
xiv
![Page 17: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/17.jpg)
1. Introduction
1.1. Biological Overview
The biosynthesis of nucleotides is fundamental to the existence of life on
Earth. These compounds are involved in many key roles in almost al1
biochemical processes. Not only are they the activated precursors of
deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), they are also the
activated precursors in many biosynthetic reactions, act as metabolic regulators
and energy carriers, and are the major components of the coenzymes NAD.
FAD, and CoA (Stryer, L.. 1988). The de novo biosyntheses of both purine and
pyrimidine nucleotides have been well-characterized (Hoffee, P .A.. and Jones.
M.E.. 1978) and involve many catalytic steps and metabolic intermediates.
The pathways that lead to the purine and pyrimidine nucleotides are
distinctly different. In the de novo pyrimidine biosynthetic pathway, the
pyrimidine ring is synthesized first from carbamoyl phosphate and aspartate and
is then attached to 5-phosphoribosyl-1 -pyrophosphate (PRPP) to form uridine-5'-
monop hop hate (UMP). Cytidine-5'4riphosphate (CTP) is formed by the
amination of uridine-5'-triphosphate (UTP) and the methylation of the uracil ring
produces the thymine ring.
![Page 18: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/18.jpg)
Ribose-S'phosphate
lnosine monophosphate (IMP)
Asp + GTP
GDP + adenylosuccinate synthetase
Adenylosuccinate
adenylosuctmate iyase
fumarate 1
Ribose-S'phosphate
Adenosine monophosphate (AMP)
IMP dehydrogenase
Xanthosine monophsphate (XMP)
Gln + ATP + i+O
GMP synthase
Glu + AMP + PF:
Ribose-S'phosphate
Guanosine monophosphate (GMP)
Figure 1. Branch-point of the de novo purine biosynthetic pathway.
3
![Page 19: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/19.jpg)
In the de novo purine biosynthetic pathway, the purine ring, in contrast. is
assembled on the ribose phosphate moiety PRPP itself. The purine ring is
formed from atoms frorn CO2, aspartate. glycine, glutamine, and N10-
formyltetrahydrafolate via ten enzymatic steps beginning with PRPP to produce
inosine-5'-monophosphate (IMP). IMP is then shuttled into the two distinct
pathways that lead to the formation of adenosine-5'-monophosphate (AMP) and
guanosine-5'-monop hosp hate (GMP) (Figure 1 ). Deoxyribonucleotides are
subsequently synthesized by the reduction of ribonucleotide diphosphates
(Stryer, L.. 1988).
There are also secondary purine nucleotide biosynthetic pathways called
the purine salvage pathways. One such pathway involves the direct attachment
of free purine bases to the ribose phosphate moiety PRPP. Adenine
phosphoribosyl transferase (APRT) catalyzes the formation of AMP from
adenine and PRPP, and hypoxanthine-guanine phosphoribosyl transferase
(HGPRT) catalyzes the formation of both IMP and GMP. Another salvage path
involves the nicotinamide adenine dinucleotide phosphate (NADPH)-dependent
reduction of GMP to IMP catalyzed by GMP reductase (Stryer, L., 1988).
IMP, AM?, and GMP are al1 feedback inhibitors of purine nucleotide
biosynthesis (Hershfield and Seegmiller. 1976, Dixon et al., 1970. Henderson
and Mercer. 1966). These three nucleotides control levels of PRPP by inhibiting
5-phosphoribosyl-1 -pyrophosphate synthetase (PRPPS). AMP and GMP inhibit
![Page 20: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/20.jpg)
PRPP arnidotransferase, the enzyme that catalyzes the first step in the purine
biosynthetic pathway leading from PRPP to IMP. Other sites of feedback
inhibition are the reactions that lead away from inosinate. AMP and GMP,
respectively. inhibit the formation of adenyisuccinate and XMP from IMP.
As mentioned above, nucleotides act as metabolic regulators. Adenine
and guanine nucleotides are used in molecular regulation more frequently than
other nucleotides and act to modulate important biochemical reactions in al1
aspects of cellular processes (Pall, M.L.. 1985). Specifically, ATP and GTP
function as essential components of growth signal transduction pathways by
providing the high energy output of the phosphate bond cleavage to affect
macromolecular conformational changes (Lehninger. A.L. 1975). Covalent
phosphoryltransfer is preferentially employed in ATP-dependent mechanisms
(Hunter. T. 1995) whereas phosphate hydrolysis is primarily used in GTP-
dependent rnechanisms (Chant, J. and Stowers. L. 1995). These nucleotides
also act as noncovalent allosteric effecton. Due to the central role played by
ATP and GTP in signal transduction. their metabolism should be significant in
cellular signaling processes.
![Page 21: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/21.jpg)
1.2. lnosine 5'-monophosphate dehydrogenase (IMPDH)
1.2.1. Catalytic Reaction
The mechanistic motif common to the de novo AM? and GMP specific
pathways is the displacement of a carbonyl group with an amino group (Figure
1). The first, and committed step in the pathway leading to the formation of GMP
is the oxidation of the C2 carbon atom of IMP to form xanthosine-5'-
monophosphate (XMP). Inosine-5'-monophosphate dehydrogenase (IMPDH; EC
1.1.1.205) is the enzyme that catalyzes the nicotinamide adenine dinucleotide
(NAD)-dependent oxidation of IMP to XMP.
The reaction is initiated by the attack of a nucleophilic cysteine residue
(Cys 331 in human IMPDH I & II) on the C-2 position of IMP, resulting in hydride
transfer and the formation of an enzyme-XMP* intermediate, which is
subsequently hydrolyzed to XMP (Huete-Perez et al 1996, Link and Straub,
1995; Sintchak et al., 1996). K' ions are required for catalysis for al1 IMPDHs
with the exception of the IMPDH from the anaerobic protozoan parasite
Tntnchornonas foetus (Xiang et al., 1996; Verham et al, 1987). Product inhibition
studies have led to the conclusion that the reaction follows an ordered bi bi
kinetic rnechanism where IMP binds before NAD, and NADH is released prior to
XMP (Holrnes, et a1.,1974; Carr, et al., 1993; Verham, et al., 1987; Anderson and
Sartorelli, 1968; Xiang, et al., 1996). This order of substrate association and
![Page 22: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/22.jpg)
product dissociation would be opposite to other NAD-dependent
dehydrogenases where cofactor binding causes conformational changes that
promote substrate binding and catalysis (Cantor and Schimmel. 1980).
However, recent studies focusing on human IMPDH, utilizing deuterium isotope
effects. have suggested, while product dissociation is ordered, substrate
association is random (Wang and Hedstrom, 1997).
1.2.2. Amino acid sequence conservation
The significant role that IMPDH plays in the fundamental mechanisms of
nature is reflected in the conservation of IMPDH amino acid sequences between
a wide range of species. Table 1 shows the percentage of identities (in
descending order) from IMPDH arnino acid sequence alignments between
species with IMPDH sequences deposited in the SWISS-PROTEIN database.
Amino acid sequences from the three kingdoms of life are represented.
Phylogenetic analysis of the sequences revealed that the general evolutionary
relationships of IMPDH sequences are maintained, with the exception of the
apparently strongly divergent sequence from Trifrichamonas foetus (Collart et al.,
1996). The numbers indicate that al1 IMPDH s adopt the sarne global fold.
1.2.3. Human lsozymes
IMPDH activity in hurnans has been shown to be the product of two
different, but highly conserved enzymes (Natsumeda. Y.. et al.. 1990). These
![Page 23: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/23.jpg)
Table 1. List of percentages of IMPDH sequence amino acid identities (asterisks denote putative IMPDH sequences).
classificalion soecies
eukaryolae Honio sapieris type II Cricetulus grrseus type II Mus niusculus type I I Homo sapens type I Mus niusculus type I
Drosophrla melanogasler
Candrda albicans'
S~cct)eromyces cerevrsrese'
Pneumocystrs cartn~i
Trypanosome brucer brtrcei
Leishrnariin dorioverir
Arabidopsis thalraria
Borrelrs bergdorlen
Trilrrchomorias loetus
eubacteria Bactllus subl~lrs
Mycobaclerrun~ lubercuksrs
Mycobacterruni loprae
Acrnefobacter calcoacetrcus
Escherrchra colr Slreptococcus pyogeries
Helrcobacter pylori
Haemophrlus nfluenzae
archae bacleria Mett~ariococcus~aririasct~~~
Pyrococclls funolrslls
![Page 24: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/24.jpg)
isozymes have been named type I and type II, and both types have also been
found in mice as well (Table 1). Two separate genes located on different
chromosomes encode these proteins: type I and type II on chromosomes 7 and
3, respectively (Gu. J.J.. et al.. 1994 and Glesne, D., et al.. 1993). Phylogenetic
and gene sequence analysis indicated that the genes for these proteins diverged
prior to the division of rodents and humans by gene duplication (Collart et al.,
1996; Zimmermann, A., et al.. 1996). 80th isozymes have been shown to be
homotetrameric and are indistinguishable with respect to their catalytic activity,
substrate affmities, and K, values for known IMPDH inhibitors (Konno, Y.. et ai.,
1991 ; Carr. S.. et al., 1993; Hagar, P., et al., 1995).
1.2.4. Differentially regulated isozyme expression
Differentially regulated expression of type I and type II isozymes has
significant functional importance for mammalian cells. Studies of the expression
levels of IMPDH specific mRNA revealed relatively high levels of the type I
transcript in kidney. pancreas. colon, peripheral blood leukocytes, fetal heart,
brain, and kidney (Senda, M. and Natsumeda, Y.. 1994). Three promoters have
been identified in the type I gene that are involved in its differential regulation at
the transcriptional level in a highly tissue- or cell-specific manner (Gu. J.J., et al..
1997).
![Page 25: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/25.jpg)
Expression of the type II transcript was shown to Vary less with different tissue
types. but generally had higher expression levels than type I mRNA (Nagai. M.,
et al.. 1992). More interestingly, increased human IMPDH type II mRNA
expression and IMPDH activity has been obsewed during cellular proliferation
(Jackson, R.C.. and Weber, G.. 1975). It decreased sharply in response to
induced cellular differentiation, while type I was shown to be constitutively
expressed. (Nagai. M., et al., 1991; Nagai, M.. et al., 1992). It has been
suggested that the roles of the two isoforms are divided between "housekeeping"
duties. performed by the type I isoform when a small amount of de novo GTP
synthesis is required in differentiated cells and "production" duties, carried out by
the type II isoform, to provide a higher rate of GTP synthesis for cellular
proliferation. (Yalowitz. J.A., and Jayaram,H.N.. 2000). Regulation of human
IMPDH II gene expression has been shown to be transcriptional in nature as a
result of post-translational modification of pre-bound transcription factors andlor
secondary protein-protein interactions (Zimmermann, A., et al.. 1995;
Zimmermann, A., et al., 1997). lncreased expression. however, of both type I
and type II transcripts. with a concomitant 15-fold increase in IMPDH activity, has
been shown to accompany T lymphocyte activation (Dayton, J.S., 1994).
The role of the p53 gene in cell growth regulation has been well
characterized (Levine and Momand, 1990; Donehower and Bradley. 1993;
Gottlieb and Oren. 1996) and mutations that eliminate wild-type p53 function are
the most prevalent genetic defect observed in a diverse number of human tumon
![Page 26: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/26.jpg)
(Hollstein et al., 1991). Recently, an association has been found between
IMPDH and p53. Initially, induced p53 expression was associated with a
reduction in guanine ribonucleotide biosynthesis due to the reduction in the
expression of IMPDH. As well, the increased formation of guanine
ribonucleotides, by the addition of nucleoside precursors, prevented growth
suppression in the absence of IMPDH function (Sherley, 1991 ; Sherley, 1995).
Most recently, IMPDH has been shown to be a rate-determining mediator
of p53-dependent growth regulation (Liu, et al.. 1998). A gene transfer strategy
was used to demonstrate that the transfection of a constitutively expressed
IMPDH cDNA elirninated p53-dependent growth suppression despite growth-
suppression levels of wild-type p53 protein. Although the normal cellular
functions of p53 are still debated, it has been suggested that one of its primary
functions is to regulate IMPDH activity by controlling IMPDH gene expression
that modulates the levels of guanine ribonucleotides which in turn are involved in
the molecular regulation of cell growth signals (Sherley, 1991 ; Sherley, 1996; Liu,
et al., 1998). This makes IMPDH an attractive target for the purpose of
modulating cell growth by modulating IMPDH activity.
![Page 27: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/27.jpg)
1.3. Inhibition of IMPDH
1 . X I . Effects of IMPDH inhibition
The fundamental role that IMPDH plays in the biosynthesis of guanine
nucleotides and in cell division control is reflected in the observation that
inhibition of IMPDH with specific IMPDH inhibitors causes cell growth arrest in
the late G1 phase of the cell cycle (Cohen et al.. 1981; Cohen and Sadee, 1983;
Lui. 1984; Lee et al.. 1985: Turka et al., 1991). It also induces differentiation. in
vitro. in a wide variety of cell types (Kiguchi et a1.,1990a; Kiguchi et al.. 1990b;
Olah et al.. 1988; Sololoski et al., 1986; Dayton, 1992). These characteristics of
IMPDH inhibition are of particular importance in the treatment of cancer, where
elevated levels of 1 MPDH expression and activity. associated with cellular
proliferation. have been observed to be linked to neoplasia and malignancy
(Jackson et al.. 1975; Jackson et al., 1976; Proffitt et al.. 1983; Konno et al..
1991; Collart et al.. 1992; Weber et al., 1992; Nagai et al, 1991; Nagai et al.
1992). These data prompted the search for. and development of IMPDH specific
inhibitors to be used in the treatment of cancer.
Tiazofurin
One of the best-characterized IMPDH inhibitors is the C-nucleoside
tiazofurin (2-P-D-ribofuranosylthiazole-4-carboxamine) (Figure 2). Tiazofurin is a
![Page 28: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/28.jpg)
pro-drug that is converted by sensitive cells in two enzyrnatic steps to the active
meta bolite thiazole-+carboxamide adenine dinucleotide (TAD) (Fig ure2). TAD
acts to inhibit IMPDH by interacting with its NAD binding site with orders of
magnitude higher affinity than NAD itself (K, approximately 700 nM) (Weber.
1983; Yamada et al., 1988). As well. TAD was shown to be uncornpetitive with
respect to NAD. which is consistent with the view that XMP binding and product
release precedes NAD binding and NADH release, respectively. Other studies
have indicated that TAD binds to IMPDH with 1 to 2 orders of magnitude higher
affinity than to other dehydrogenase enzymes again implying specificity
(Goldstein et al.. IWO).
![Page 29: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/29.jpg)
A Tiazofurin
HO OH
I/ ATP
1) Nicotinamide kinase 2) NMN:ATP-adenylyl transferase
4 o o II O-P-O-P-O h~ 1' AH -,$
HO OH HO OH
MPA
I
TAD
Figure 2. Molecular structures of potent lM PDH inhibitors. A, Tiazofurin reacts (enzymatically) with adenosine triphosphate (ATP) which produces 2-9-0- ribofuranosylthiazole4-carboxamide (TAD) and inorganic phosphate (P,). 8, Mycophenolic acid (MPA).
![Page 30: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/30.jpg)
Crystal structures of tiazofurin and its analogues have revealed a close
intermolecular contact between the thiazole sulfur atom and the furanose ring
oxygen (Goldstein et al., 1983; Goldstein et al., 1983: Burling and Goldstein,
1989). It had been suggested that this interaction is maintained in the NAD
binding site of IMPDH, establishing a low energy conformation of TAD that would
be disrupted when binding to other dehydrogenases (Goldstein et al., 1990).
ln vitro, tiazofurin has been shown to be effective against human lung,
breast, colon, pancreatic, and lymphoid tumor cell lines (Earle and Glazer. 1983;
Carney et al.. 1985: Jabobson et al.. Szekeres et al.. 1992: Sidi et al., 1990) and
in vivo, was curative for murine Lewis lung carcinoma (Robins et al., 1982).
More significantly, however, tiazofurin has been effective in the treatment of
human myeloid leukemias (Tricot et al. 1987). In vitro studies on the human
leukemic cell lines HL-60 (promyelocytic leukemia) and K562 (erythriod
leukemia) have shown that treatment with tiazofurin decreased IMPDH specific
activity and GTP concentrations, and induced differentiation (Lucus et al, 1983;
Sokowski et al., 1986: Knight et al., 1987; Olah et al. 1988) and apoptosis (Vitale
et al., 1997) in a tirne- and dose-dependent rnanner.
Down-regulation of two proto-oncogenes, c-rnyc and c-Ha-ras, were also
observed as a result of tiazofurin in human K562 cells, and human and rat
hepatoma cell lines (Olah et al., 1989; Olah et al.. 1990). The c-myc gene
product is a DNA-binding, nuclear phosphoprotein involved in cellular
![Page 31: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/31.jpg)
proliferation and DNA synthesis (Bishop, 1987) and the ras oncogene products
are associated with the plasma membrane and share structural and biochemical
properties with the guanine nucleotide binding regulatory G-proteins (Hurley et
al.. 1984). In al1 of the above studies. the addition of exogenous guanine
nucleotides abrogated the tiazofurin-induced differentiation and apoptosis.
illustrating the critical role that the levels of these nucleotides play in cell
signaling and growth.
In clinical studies. the sarne correlation between the emergence of a
differentiated phenotype and IMPDH activity and GTP concentrations was
observed (Tricot et al., 1990) as well as the down-regulation of c-ras and c-myc
expression (Weber et al., 1991). The most consistent responses to tiazofurin
occurred in patients with chronic myeloid leukemia (Tricot et al.. IWO). This
response was amplified by the addition of allopurinol. which induces high levels
of serum hypoxanthine that inhibited HGPRT activity in the purine salvage
pathway as described above (Weber et al.. 1994). Approximately 30% of
patients attained a complete remission. 7% showed hematological improvement.
and 13% showed a marked anti-leukemic effect (Tricot, 1989; Tricot et SI.. 1990).
A review of the clinical trials reported that the most consistent side effects were
neurotoxic, such as strong headaches, agitation, seizures. sudden coma. and
ventricular fibrillation (Tricot. 1 989).
![Page 32: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/32.jpg)
lncreased IMPDH expression and activity have also been observed in
proliferating B- and T-lymphocytes (Dayton, J.S., 1994; Natsumeda and Carr,
1993). Moreover, the purine salvage pathway catalyzed by HGPRTase was not
required for lymphocyte proliferation, meaning that the de novo pathway is critical
(Allison et al.. 1975; Allison et al., 1977). HGPRTase and PRPP
amidotransferase (the enzyme that catalyzes the first committed step in the de
novo purine biosynthetic pathway , as described above) expression was observed
to be tissue-dependent, with the brain cells showing the greatest dependence on
the salvage pathway and lymphocytes showing the least (Stryer, 1988; Allison et
al.. 1975; Allison et al.. 1977). This singular dependence on the de novo
pathway for guanine nucleotides has marked IMPDH as a target for
immunosuppression.
1 3.3. Mycophenolic acid
Mycophenolic acid (MPA) (Figure 2 ) is another well-characterized l MPDH
selective inhibitor. MPA was first isolated as an antimicrobial agent from
fermentation products of several Penicillium species (Gosio, 1896) and later was
shown to inhibit the proliferation of cultured lymphocytes (Allison and Eugai,
1993; Wu. 1994). MPA has high affinity for IMPDH, with Ki's for the type I and
type II isoforms deterrnined to be 11-37 nM and 6-10 nM, respectively (Carr et
al.. 1993; Hagar et al., 1995). The antiproliferative effects of MPA are to
![Page 33: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/33.jpg)
decrease the cellular pools of guanine nucleotides. Consequently, the addition of
guanine reverses the effects of MPA (Allison et al., 1993).
Interestingly. MPA had no effect on the early signal transduction systems
in T-lymphocytes (Eugui et al.. 1991; Dayton et al, 1992) but inhibited the transfer
of fucose and mannose moieties to glycoproteins (Allison et al., 1993). This may
prevent the interaction of lymphocytes with target cells. Also, complete inhibition
of antibody formation by polycionally activated human B-lymphocytes was
observed by the addition of 100 nM MPA (Eugai et al., 1991). The recent
approval by the U.S. Federal Drug Administration (FDA) of the oral prodrug of
mycophenolic acid. mycophenolate rnofetil. for use in combination with other
immunosuppressive agents to prevent acute rejection of kidney transplants
(Shaw et al.. 1995; Sollinger, 1995) has illustrated the clinical proof-of-principle
for IMPDH as a viable molecular target.
1.4. Thesis proposal
At the beginning of this study. there was no structural information available
on IMPDH. As described above, most of the studies on IMPDH had focused on
its role as an anti-proliferation target for tiazofurin. Although the cDNAs for both
type I and type II human IMPDH had been cloned. (Collart and Huberman, 1988;
Natsumeda et al.. 1990) an atternpt to overexpress the proteins in E. coii as
lacZ'-fusion proteins produced only very modest results (Konno et al.. 1991). 1
![Page 34: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/34.jpg)
decided to attempt to obtain the cDNA for the isozymes by polymerase chain
reaction (PCR) amplification based on the published nucleotide sequences
(Collart and Hubeman, 1988; Natsumeda et al., 1990). The cDNA comprising
only the coding region would be sub-cloned into a high output protein expression
plasmid and the proteins would be overexpressed in E. coli cells. isolated, and
screened for conditions that would produce single protein crystals suitable for X-
ray diffraction. X-ray crystallographic techniques would be applied to solve the
three-dimensional structures of both isozymes and the resulting structural
information would be analyzed. Structural information on IMPDH should be
important in the development of chemotherapeutic agents in the treatment of
cancer and immunosuppression.
Currently, 5 X-ray crystal structures of IMPDH have been solved: human
l M PDH type I I ternary corn plex with selenazole-4-carboxamide adenine
dinucleotide (SAD) and 6-chloropurine riboside 5'-monophosphate (6-CI-IMP)
(Colby et al.. 1999). Chinese hamster IMPDH type II ternary complex with
mycophenolic acid (MPA) and the partially turned over inosine 5'-
monophosphate intenediate (IMP), xanthosine 5'-monophosphate* (XMP*)
covalently bound to the active site (Sintchak et al., 1996), Borrelia bergdorfen
IMPDH complexed with SOa (McMillan et a1.,2000), Tntnchomonas foetus IMPDH
both apo- and XMP-complexed (Whitby et al., 1997), and Streptococcus
pyogenes IMPDH with IMP (Zhang et al., 1999).
![Page 35: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/35.jpg)
These structures have shown that the basic fold of IMPDH is an dp barrel
with a small flanking domain dubbed the sub-domain which is inserted between
the second u-helix and the third p-strand of the dB barrel. As well, there
appears to be considerable structural variation in the vicinity of the active site.
Two regions in particular, named the 'active site helix' and the 'active site flap'.
have been observed to have basic differences in their backbone structures when
the active site is occupied by either substrates or other ligands. This has been
reported for the ternary complexes of both the human- and hamster-IMPDH type
Il (Colby et al., 1999. Sintchak et al., 1996), whereby the amino acid sequence of
these two proteins are virtually identical to each other (Table 1).
There is independent evidence that there are significant structural
differences between the ternary complex of IMPDH II and its apo form. In vitro
proteolytic susceptibility, hydrophobic fluorescent dye binding, far-UV circular
dichromism spectra and urea-induced denaturation experiments have shown that
IMPDH II undergoes conformational changes and is stabilized by ligand binding
and MPA inhibition (Nimmesgern et al., 1996). High-precision titration
microcalorimetry has revealed allosteric properties of IMPDH II upon IMP and
MPA binding (Bruuese and Connelly, 1997). As well, the temperature
dependence of the heat capacity function associated with the ligand binding
reaction suggested that an equilibrium exists between at least two structural
forms of apo-IMPDH II (Bruuese and Connelly. 1997). Therefore. the structural
detenination of the unliganded forrn of IMPDH can provide significant details as
![Page 36: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/36.jpg)
to the structural differences between the cornplexed and free forms of IMPDH
with respect to its conformation and allosteric behavior. Also, sequence
alignments and structural comparisons between IMPDHs and other proteins may
reveal amino acids that are critical to structure and function of IMPDH.
I report here the successful amplification, sub-cloning, and overexpression
of the cDNAs for both type I and type II human IMPDH. As well. the type II
isozyme was purified to homogeneity, crystallized and the crystal structure of the
apo form of this enzyme was solved. However, as reported in the appendix. the
type I isozyme was insoluble in aqueous media also reflected in its accumulation
in bacterial inclusion bodies. Also described in the Appendix is the crystallization
of the human IMPDH II complexed with MPA and IMP, and the expression,
purification, and crystallization of IMPDH from E. coli.
![Page 37: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/37.jpg)
2. Materials and Methods
2.1. Molecular Biology
2.1.1. Cloning of human IMPDH Il cDNA
cDNA containing the coding region of human IMPDH II was amplified by
the polyrnerase chah reaction (PCR) (Sambrook et al.. 1989) from a human
peripheral blood leukocyte i.gtl0 cDNA library (Invitrogen). The RNA source for
the library were peripheral blood leukocytes from an adult fernale with acute
promyelocytic leukemia (HL 60) (Collins, 1990).
The sequence of primer A was 5'-CAGCCTGGTTAAGTCCAA-
GCTGAATTC-3' and was complimentary to the sequence immediately upstream
of the Eco RI cloning site of ÀgtlO. The sequence of primer B was
5'-CCGAGGAGGTGTTCTAGATCCC-3' and was complirnentary to the sequence
imrnediateiy downstream of the termination codon of the human IMPDH II
encoding cDNA.
2.5 pl aliquots of the lambda phage preparation at 2.0 X 10" pfulml were
added to 72.5 pl of distilled water. Sarnples were incubated at 70°C for 5 minutes
and transferred to wet ice for cooling. 25 pl of a 4 X PCR master buffer
(Sambrook et al., 1989) containing buffer. salts, gelatin, dNTPs, primers, and
![Page 38: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/38.jpg)
Taq polymerase were added. Three 100 pl reaction samples were mixed, each
contained 5. 10. and 15 mM MgCI2, as well as 50 mM KCI, 10 mM TRlSlHCl (pH
8.3). 0.01% gelatin. 0.20 mM each of dATP. dCTP. dGTP, and dTTP, 1.0 pM
each of oligonucleotide primer and overlaid with 100 pl of mineral oil. 0.5U of
Taq polymerase was used. The reaction vessels were incubated at 95OC for 1
minute and 20 seconds. 65OC for 2 minutes, and 7 2 ' ~ for 3 minutes. This was
repeated 29 times. 10 pl aliquots of the final reaction mixtures were applied to a
1% agarose gel. Two 5 pl aliquots of the PCR product from the sample that
contained 15 mM MgCl* were each incubated with the restriction enzymes Eco
RI and Pst I for analysis.
The remaining PCR reaction mixture was treated with 2U of Klenow
polymerase in the presence of 40 FM each of dATP. dCTP, dGTP, and dTTP.
The PCR reaction products were ligated by blunt-end ligation to pTZ19R
(BlueWhiteScreening) digested with Hinc II and dephosphorylated with alkaline
phosphotase. The total volume of the ligation reaction was 15 pl and contained
ligation buffer. 200ng of PCR product, 200 ng of pTZ18R. 1 U of T4 ligase. and
was incubated at 16OC for 16 hours. 5 pl of the ligation reaction mixture were
added to 80 pl electrocompetent TG2 E m l i cells in water. After electroporation.
1 ml of LB (Lucia's Broth: 10 gil tryptone, 5 gll Yeast extract, 5 gll NaCl) was
added to the cells and the suspension was incubated at 37OC for 1 hour. 200 pl
of cell suspension were spread on LBiagar plates treated with 0.1 mglrnl
ampicillin, 20 pl of 50 mM IPTG, and 50 pl of 2% X-Gal. The plates were
![Page 39: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/39.jpg)
incubated overnight at 37OC. 10 white E. coli colonies were picked and added to
3 ml of LB containing 0.1 mglm1 ampicillin. These were allowed to grow
overnight at 37OC. The plasmid DNAs frorn each of the overnight growth
suspensions were isolated by mini-prep (Sambrook et al., 1989) and an aliquot
of each sarnple was applied to a 1 % TAE-agarose gel.
Selected sarnples were digested with EcoRl and applied to a 1% agarose
gel. Samples that produced the correct fragment sizes were sequenced by the
T7 sequencing method (Kristensen et al.. 1988). One plasmid. pTZ19R-
HIMPDH 11Tr8. found to contain the complete hurnan IMPDH II coding region
without mutations was isolated in large quantities by maxi-prep (Sambrook et al..
1989). An overview of the cloning strategy is outlined in Scheme 1.
2.1.2. Sub-cloning of human IMPDH II cDNA.
The pTZ19R-HIMPDH 11K8 plasmid was digested to completion by the
restriction endonuclease Hind III. The resulting DNA was partially digested with
Ncol (5U Ncolll pg of DNA) for 10 minutes at 37OC. The reaction was stopped
by the addition of EDTA to a final concentration of 20 mM. The digest was
applied to a 1 % agarose preparation gel and the 1,600 bp fragment was excised
and
![Page 40: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/40.jpg)
EcoRl EcoRl
Hurnan peripheral blood leukocyte ÀgtlO cDNA library
PCR Amplification
Human IMPDH II coding cDNA :=
Blunt-end Iigation to Hincll digested pTZ19R
Scheme 1. Cloning strategy for human IMPDH II cDNA. A and 6 represent the PCR primers which were used to amplify hurnan IMPDH II cDNA from the human peripheral blood leukocyte Àgtl0 cDNA library. Following amplification. the product was ligated to the pTZ1 SR plasrnid. The resulting plasmid ( pTZ19R-HIMPDH II) is shown. bla (ApR). ampicillin resistance gene; rep (pMB1). E. coli origin of replication; f l (IG). f l phage origin of replication; IacZ. P-lactosidase gene.
![Page 41: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/41.jpg)
Ncol partial digest / fragment purification
- - d
O u O 8 o .- c Z z Z Z
Hind III digested
Human IMPDH Il coding cONA
pTZ19R-HIMPDH II 5'
Ligated to NcollHind Ill digested pSE420
3'
niiiii-cistroii
Hiinidri
bla (ApR)
Scheme 2. Subtloning strategy for human IMPDH II cDNA. Hind III digested pTZ19R-HIMPDH II was subjected to a Ncol partial digest to isolate the entire coding cDNA of human IMPDH II. This fragment was ligated to a NcollHindlll digested pSE420 plasmid. The resulting plasmid (pSE420-HIMPOH II) is shown. Trp. trp promoter; Lac. lac operator; bla (ApR). ampicillin resistance gene; ColEl. E. coli origin of replication; laclq. lac repressor gene.
![Page 42: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/42.jpg)
purified from the agarose by gel extraction (Sambrook et al.. 1989). The 1,600
bp fragment was ligated to an Nco IlHind III digested pSE420 expression plasmid
using T4 DNA ligase. The ligation mixture was transformed into E. coli TOP10
cells by electroporation and spread on LBlagar plates treated with 0.1 mg1 ml
ampicillin. The plates were incubated at 37OC for 16 hours. Positive
transformant colonies were selected, grown, and the plasmids isolated by mini-
prep (Sambrook et al.. 1989). The plasmids were separately digested with the
restriction endonucleases EcoRl and Pst I and aliquots of the digests were
applied to a 1% TEA-agarose gel. An overview of the sub-cloning strategy is
outlined in Scheme 2.
2.1.3. Expression of human IMPDH II
E. coli TOP10 suspensions with the pSE420 plasmids that contained the
human IMPDH II coding cDNA were tested for expression. 1.0 ml of the E. coli
TOP10 (pSE420-HIMPDH II) suspensions were added to 50 ml of 2XYT (16 gll
tryptone, 10 gll yeast extract. 5 gll NaCI) containing 0.1 mglml ampicillin and
incubated with shaking at 37'C until the optical density (O.D.) was 0.8, measured
at 600 nm. IPTG was added to a final concentration of 1 mM and the cells were
allowed to grow for 3 hours. 1 ml aliquots were removed and the cells were
collected by centrifugation. The cells were resuspended in 100 pl of distilled
water and 100 pl of 2X SDS-PAGE sample buffer (50 mM TRISICI, pH 7.5, 2%
SDS, 100 mM PME, and 0.01% bromophenol blue). The samples were
![Page 43: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/43.jpg)
incubated at 95OC for 3 minutes and applied to a 12% SDS-PAGE gel. The
remaining cells were collected by centrifugation and resuspended in a buffer
containing 10% glycerol. 10% urea, 150 mM NaCI, 50 mM TRISIHCI (pH 8.0), 2
mM EDTA. 2 mM PME. 1 mM PMSF, 1 pglml pepstatin. 1 pglml leupeptin, 0.1
mglml lysozyme, and 0.1 mglml DNase. The suspension was passed through a
French press 3 times and the cellular debris was removed by centrifugation. The
soluble cell extracts were tested for IMPDH activity. Samples that showed the
over-expression of recombinant human IMPDH II al1 had IMPDH activity and
were mixed with 116 volume of sterile 100% glycerol, shock frozen in liquid
nitrogen. and stored at -70°C.
2.2. Biochemistry
2.2.1. Purification of human IMPDH II
E. coli TOP10 (pSE420-HIMPDH II) cells were thawed and spread on an
LB plate treated with 0.1 mglml ampicillin and incubatec: at 37OC for 16 hours. A
single colony was picked and added to 1.0 ml of LB broth with 0.1 mglml
ampicillin and incubated at 37OC for 6 hours. The 1 .O ml suspension was added
to 20 ml of 2XYT with 0.1 mglml ampicillin and grown for 16 hours. The 20 ml
suspension was added to 1 .O L of 2XYT with ampicillin and the cells were grown
at 37% with shaking until the absorbance at 600 nm was approximately 0.8.
IPTG was added to a final concentration of 1 mM and the cells were grown for
![Page 44: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/44.jpg)
3.5 hours at 37OC. The cells were collected by centrifugation and resuspended in
a buffer solution as described in the small-scale expression experiments above
(2.1.3.).
The soluble cell extract was applied directly to a heparin-650M column (30
ml) equilibrated with 20 mM Na phosphate buffer (pH 7.2). 2 mM DTT, and 5%
urea. The column was washed with 4 volumes of buffer and the protein was
eluted with a O - 500 mM NaCl gradient over 200 ml. Fractions were assayed for
IMPDH activity by adding a 20 pl aliquot to a 1 .O ml assay solution containing
100 mM TRlSlHCl (pH 8.0). 100 mM KCI. 3 mM EDTA. 2 mM DTT and 1 mM
each of IMP and NAD. The reaction was monitored by the increase in the
absorbance at 340 nm due to the formation of NADH. Fractions containing
IMPDH activity were pooled, concentrated. and applied to an IMP - sepharose
column (100 ml) equilibrated with a buffer solution containing 20 mM TRlSlHCl
(pH 8.0), 2 mM DTT. 5% urea. The column was washed with 4 column volumes
of buffer and the IMPDH was eluted with the buffer containing 10 mM IMP.
Fractions containing IMPDH activity were pooled, concentrated. and dialyzed
against 10 mM TRISIHCI (pH 8.0). 300 mM KCI. 2 mM EDTA, and 2 mM PME.
Aliquots from the soluble cell extract, and the pooled fractions each from the
Heparin-65OM and the IMP-sepharose columns, were applied to a 12% SDS-
PAGE gel for analysis.
![Page 45: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/45.jpg)
2.2.2. Enzyme kinetics
All assays were carried out with 100 mM TRlSlHCl (pH 8.0), 100 mM KCI.
3 mM EDTA. and 5 mM D I T at 23OC. IMP and NAD coiicentrations were varied
from 5 to 200 pM and the enzyme concentrations used varied from 10 to 100 nM.
The data were collected by measuring the change in absorbance at 340nm per
unit tirne, following the reduction of NAD (Ultraspec 2000 UVNisible
Spectrophotometer - Amersham Pharmacia Biotech). Total assay volume was
1.0 ml and the Km and V,,, values were detenined by steady-state kinetic
methods (Cleland. 1 979).
2.3. Protein Crystallography
2.3.1. Prelirninary crystallization screens
Human lMPDH II was dissolved at 5 mglrnl in the dialysis buffer described
above. Hampton Research's Crystal Screen and Crystal Screen 2, as well as
their Grid Screen and the Detergent Screen were used in the initial screens for
crystallization conditions.
![Page 46: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/46.jpg)
2.3.2. Crystallization of human apo-IMPDH II
Purified human IMPDH II was dissolved to 20 mglml in a buffer solution
containing 10% glycerol, 10 mM TRlSlHCl (pH 8.0), 300 mM KCI, 2 mM EDTA.
and 2 mM PME. 2 pl of protein preparation was added to 4 pl of a reservoir
soluiion containing 100 mM MES (pH 5.8). 8-12% PEG 6000, 0.8-1.2 M LiCI, 1
mM EDTA, 40 mM PME. 2% methyl pyrrolidinone [v/v] (MpyD). The drop was
incubated above 0.5 ml of the reservoir solution for 4-6 weeks. The crystals grew
as elongated rectangular bricks whereby two dimensions where equal and the
crystal grew out along the third dimension.
2.3.3. X-ray diffraction data collection and processing
A large single crystal (1 .O mm X 0.5 mm X 0.5 mm) was dipped into the
well solution that also contained 15% glycerol and was Rash-frozen in a liquid N2
stream at 100°K. The x-ray source was synchrotron radiation from the CHESS
bearnline at Cornell University and the diffraction data were recorded by a Fuji
image plate detector. 45 frames of data were collected using a I0oscillation
angle. The data from one frame was corrupted and was discarded. The data
were processed using the programs DENZO and SCALEPACK (Otwinowski.
1993).
![Page 47: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/47.jpg)
2.3.4. Molecular replacement
A complete model of the Chinese Hamster IMPDH monomer structure
(Syntchack et al.. 1996) were used as the search model. The molecular
replacement program used was AMORE (Navaza, 1994). The resolution range
used was 15.0 to 4.0 A and the interatomic vector cut-off was 20 A. Molecular
replacement calculations were performed both with the coordinates of the
subdomain included and removed from the search model.
2.3.5. Model building and refinement.
The best AMORE rotation and translation matrices were applied to the
hamster IMPDH II coordinates. AH of the residues in the resulting coordinate file
were converted to alanine residues to minimize model bias. The program O
(Kleywegt et al., 1994 and Jones et al., 1991) was used for graphical
representations of electron density and protein models. A 40 step rigid body
refinernent was performed and a 2 X (FOI - IF,I electron density map was
calculated (Brunger et al., 1987, Brunger et al., 1990, Brunger, 1992 and Brunger
et al., 1997). Using the program O (Kleywegt et al.. 1994 and Jones et al..
1991), alanine residues were mutated to the appropriate human IMPDH II
residues whenever electron density was seen extending beyond the p-carbon of
![Page 48: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/48.jpg)
those residues. CNS was used for model refinement, which included a bulk
solvent correction and an overall anisotropic B-factor correction (Brunger et al.,
1987, Brunger et al., 1990, Brunger, 1992. Brunger et al., 1997).
All refinements were conducted within a resolution range from 10.0 A to
3.2 A. A 40 step positional refinement was performed following each round of
modeling. Residues were removed where no electron density was visible. As
well, residues of the N-terminus and sub-domain, that were not part of the search
model but showed electron density. were added and refined. Simulated
annealing and group B-factor refinements were also employed. The initial model
was overlaid with the modified model and regions of significant structural
variability were selected. These regions were then omitted for simulated
annealing refinement and electron density map calculation. Appropriate
structural adjustments were made to the initial model and multiple rounds of
simulated annealing-, positional-, and group B-factor-refinements were
performed. The "cross-validated maximum likelihood function" was used as the
refinement target.
2.4. Amino acid sequence alignments
Sequence alignments were perfomed by using the Gapped-BLAST
(Altschul et al., 1997) program as implemented at the NCBl lnternet page
(www.ncbi.nlm.nih.gov).
![Page 49: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/49.jpg)
2.5 Human apo-IMPDH II model analysis
Structural analysis and comparisons were done using the programs O
(Kleywegt et al., 1994 and Jones et al., 1991) and Swiss-PDB Viewer (Guex and
Peitsch, 1996).
![Page 50: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/50.jpg)
3.1 . Molecular Biology
3.1 . l . Cloning of human IMPDH II cDNA
The PCR products were visualized on a TEA-agarose gel. stained with 5
mglml ETBr. and viewed under U.V. light. Figure 3 shows the PCR products
along with the DNA markers Hind III and Bst 1 digested i. DNA. DNA with an
approximate size of 1,600 base pairs (bp) was produced from the reactions
containing 10 and 15 mM MgCI2. The higher stringency sample, containing 5
mM MgCI2, did not show DNA amplification.
The products were further analyzed by EcoRl and Pstl restriction digest
and TEA-agarose gel electrophoresis (data not shown). The EcoRl digest
produced fragments with the approximate size of 1,200 bp and 300 bp. These
fragments match the expected fragment sizes (1,278 bp and 294 bp ) by EcoRl
digestion of the coding region for human IMPDH II. The fragments produced
from the Pstl digest were approximately 1.000 bp and 450 bp. These fragments
also match the expected fragment sizes (965 bp, 467 bp, and 140 bp) for Pstl
digestion.
![Page 51: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/51.jpg)
Figure 3. PCR amplification of human IMPDH II cDNA. Visualized an a 1% TEA-agarose gel, stained with 5 mg/ml ethiduim bromide. Lane 1: A Hind III markers (500 ng), lane 2: PCR-1 (20 pl) (5 rnM MgCl*). lane 3: PCR-2 1 (20 pl) (10 mM MgC12), lane 4: PCR-3 1 (20 pl) (15 mM mgC12), lane 5: i. BstE II markers (500 ng) (bp, base pairs).
Figure 4. Plasmids isolated from positive E. coli transforrnants. Ligation products of PCR fragments to Hinc II digested pTZ19R. Lane 1: Hind Ill markers (500 ng), lane 2: pTZl9R undigested plasmid (1 00 ng), lane 3-1 2: samples #1-10 (1 0 pl), lane 13: pTZ19R undigested, lane 14: h Hind III markers (500 ng) (bp, base pairs).
![Page 52: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/52.jpg)
Based on the restriction enzyme digest results, the PCR products were
ligated to the pTZ19R plasmid via blunt-ended ligation. Plasmids isolated from
positive transformants are shown in Figure 4. Samples #2 and # I O were
religated plasmids. The remaining samples al1 showed recombination. Samples
#1, 3. 4. 8, and 9 were selected for EcoRl restriction enzyme digest analysis.
The resulting fragments are shown in Figure 5.
Sample #1 was not cleaved by EcoRl digestion. The remaining samples
(#3, 4. 8. and 9) were al1 cleaved by EcoRl digestion. The fragments produced
(approx. 4100 bp and 300 bp ) were consistent with the human IMPDH II coding
DNA inserted into the multicloning site of the pTZ19R. oriented with the human
IMPDH II start codon at the 5' end of the multicloning site. The opposite
orientation would have produced fragments with the approximate sizes of 3100
and 1300 bp. The insertion region of samples #3, 4, 8, 9 were completely
sequenced. Sample #8 was found to contain the entire coding region for hurnan
IMPDH II with no mutations (the remaining sample al1 showed nucleotide
changes). Figure 6 shows the sequence of the region surrounding the
recombination sites between the ?CR products and the pTZI9R plasmid. These
results confirm the above restriction enzyme digest experiments with respect to
gene insertion and orientation.
![Page 53: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/53.jpg)
Figure 5. EcoRl digest samples of recombinant ligation products. Lane 1: É. BstE II markers (500 ng), lane 2-6: samples #1, 3, 4, 8, 9, resp. (20 pl), lane 7: EcoRl digested pTZ19R (100 ng), lane 8: h Hind Ill markers (500 ng) (bp, base pairs).
** r t p i 2 1 SR muitidoning site r- W HIMPOH II coding ONA
Recombinatian site
HIMPDH II coding DNA - pTZ19R rnulttdoning site
Pst t Hind III +\ rch7
5'- GGCmC~~GGGGGATCTAGAACACCTCCTCGGACCTGCAGGCATGCAAGCTTTCCCTA
Stop codon t Recombinatton sile
Figure 6. Recombination site DNA sequence. DNA sequence at the 5'- and 3'- regions of the PCR products and the pTZ19R plasrnid. A. Start codon region, B. Stop codon region.
![Page 54: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/54.jpg)
3.1.2. Sub-cloning of human IMPDH II cDNA
Due to the Ncol restriction site located at the start codon for the human
IMPDH II gene (Figure 6), Ncol digestion of the Hind III digested pTZ19R-human
IMPDH II produced a fragment of approximately 1600 bp containing the entire
human IMPDH II coding region. However, additional Ncol sites at positions 208
and 1258 of the human IMPDH II gene made a simple Ncol digest unavailable.
Thus, a partial digest protocol was designed and irnplemented. The 1600 bp
fragment was isolated and ligated to an NcollHindlll digested pSE420 plasmid.
Plasmids isolated from the positive transformants of the ligation reaction were
screened by EcoRl and Pstl restriction digestion (data not shown). AH samples
showed the correct size of fragments consistent with presence of the human
IMPDH II gene inserted into the pSE420 plasmid in the correct orientation for
expression. Positive recombinants were screened for expression in small
quantities.
3.1.3. Expression of human IMPDH II cDNA
Aliquots of the induced cells were applied to an SDS-PAGE gel and are
shown in Figure 7. Negative controls for expression (TOP10 cells and TOP10
cells with the pSE420 plasmid) showed no expression as expected. Three of the
four samples show expression in both the uninduced and ind uced aliquots,
![Page 55: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/55.jpg)
although more protein was evident in the induced samples. Following cell lysis,
al1 three samples that showed over-expression had IMPDH activity.
Figure 7. Expression analysis of pSE420-human IMPDH II recombinants. 12% SDS-PAGE gel with 20 LLI samples from the expression of pSE420-hurnan IMPDH II recombinants in E. coli TOPlO cells. Lane 1: TOPlO cells uninduced, lane 2: TOPlO cells induced. lane 3: pSE420rTOP10 cells-uninduced, lane 4: pSE420KOP10 cells-induced, lane 5: sarnple #1- uninduced, lane 6: sarnple #1-induced, lane 7: sample #2-uninduced, lane 8: sample #2-induced. lane 91: sample #3-uninduced, lane 10: sample #3-induced. lane 11: sample #4 uninduced, lane 12: sample #4-induced, Iane 13: Molecular weight markers (1 2 pg).
![Page 56: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/56.jpg)
3.2. Biochemistry
3.2.1, Purification of human IMPDH II
Figures 8, 9, 10, and Table 2 describe the process involved in the
purification of human IMPDH 11. 10% urea was required to ensure a significant
amount of human IMPDH II dissolved in the soluble cell lysate.
Figure 8. Analysis of the purification of human IMPDH 11. 12% SDS-PAGE gel with sarnples (20 pg) from the purification of human IMPDH II. Lane 1: Molecular weight markers (30 pg)? lane 2: soluble ce11 extract, lane 3: pooled fractions following the Heparin-650M column. Iane 4: pooled fractions following the IMP-sepharose column.
![Page 57: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/57.jpg)
IMPDH Activity
f-5
20 40 60 Fraction number
Figure 9. Elution profile of the Heparin-650M colurnn. 5.0 ml fractions were collected at a flow rate of 2.5 rnllrnl. The NaCl gradient began at fraction #30. IMPDH activity was detected in fractions 62 to 74.
IMPDH Activity
20 40 60 Fraction num ber
Figure 10. Elution profile of the IMP-sepharose column. 5.0 ml fractions were collected at a flow rate of 2.5 rnlfmin. The [NaCl] was increased to 0.3M between fractions 15 to 44. IMPDH activity was detected in fractions 55 to 64. Note: the increase in absorbance at 280nm after fraction 55 was due to the IMP in the column buffer. IMPDH eluted with the IMP.
![Page 58: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/58.jpg)
Table 2. Purification table for human IMPDH II. Enzyme kinetic data was obtained by the method described in section 2.2.2. 1 mM of IMP and NAD were used in these assays. SCL, soluble cell lysate. Samples frorn columns are the pooled fractions. 1 Unit = 1 prnol/min.
SCL
Heparin column
IMP column
Lane 2 in Figure 8 shows the large band of human IMPDH Il under
denaturationlreducing conditions with an approximate molecular weight of 55000.
Heparin was reported to interact strongly with nucleotide binding enzymes
(Muszynska et al., 1985). Human IMPDH II eluted from the Heparin-65OM
column at approximately 300 mM NaCI. Washing the column with 1.0 M NaCl
showed little protein that remained bound following human lMPDH II elution
(Figure 9). A significant reduction in the amount of bacterial proteins is evident
from lane 3 of the SDS-PAGE gel and the corresporiding kinetic data in Table 2.
The elution profile for this column (Figure 9) shows a single peak eluting with
IMPDH activity. The elution profile for the IMP-sepharose column (Figure 10)
shows contaminating proteins flowing through the column without binding.
lncreasing the concentration of NaCl to 0.3 M removed proteins that were non-
specifically bound. Lane 4 of the gel (Figure 8) shows the pooled fractions from
the IMP-sepharose column. Most of the remaining contaminating bacterial
proteins were removed leaving a highly purified preparation of human IMPDH II.
Volume [Protein] Protein Unitslml Units,,, Unitslmg % Purification (m 1) (mglml) (mg) Yield fold
26. O 10.0 260 O. 57 14.8 0.057
46.0 0.92 42.3 0.26 12.0 0.28 81 4.9
36.0 O. 74 26.6 0.25 9.0 0.34 61 6.0
![Page 59: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/59.jpg)
Between 25 mg and 30 mg of purified hurnan IMPDH II were isolated from
each 1 .O L suspension of E. coli TOP1 01pSE420-human IMPDH II. Following
dialysis, the highest concentration of human IMPDH II achieved was 5 mgfml.
When the protein was incubated on ice at this concentration, it was obsewed to
form a gel. This state dissolves following a 5 to 10 minute incubation at roorn
temperature (23OC). Aliquots of human IMPDH II that were stored at -70°C did
not show reduction in activity upon thawing, however when the protein was
stored at 4OC. a 50% reduction in activity was obsewed over a 24 hour period.
The crystals grew as elongated rectangular bricks whereby two dimensions were
equal and the crystal grew out along the third dimension.
3.2.2. Enzyme kinetics
Michaelis-Menten enzyme kinetics were done to detemine if the human
IMPDH II had comparable Km and Ka values to other recombinant IMPDHs and
human IMPDH II isolated from tissue sources. The Km values for IMP and NAD
were determined to be 6.4 pM (+/-2.0 pM) and 32 pM (+/- 3.0 FM), respectively.
The kat was found to be 0.91 s-' .
![Page 60: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/60.jpg)
3.3. Protein Crystallography
3.3.1. Preliminary crystallization screens
Microcrystals were produced from Crystal Screen 2. condition #48 which
contained 0.1 M bicine (pH 9.0), 10 % PEG 20K, and 2 % dioxane (Figure 11).
Variations in the concentration and molecular weight of PEG. pH and buffer type.
dioxane concentration and organic solvent type had no effect on crystal size and
shape. The addition of 2% CTAB from the Detergent Screen produced slightly
larger microcrystals. Similar microcrystals were produced from Crystal Screen 2,
condition #IO which contained 0.1 M Na acetate (pH 4.6). 30 % MPD. and 0.2 M
NaCI. Variations in MPD concentration, pH and buffer type, and NaCl
concentration had no effect on crystal size and shape. Microcrystals were also
produced from Crystal Screen 2, condition #41 which contained 0.1 M TRlSlHCl
(pH 8.5). 1.0 M LiCI, and 0.01 M NiCI. Again, variations in each of the
components had no effect on crystal size and shape.
Srnall twinned brick-shaped crystals were produced from the pH vs.
[PEGILiCI] Grid Screen. Variations of pH, buffer type, PEG concentration and
size. and LiCl concentration were attempted. The conditions that produced the
largest crystals of these were 0.1 M MES (pH 6.0), 1.0 to 1.2 M LiCI, and PEG
4K to 8K from 6 % to 12 % (Figure 12). Variations in crystallization method,
protein
![Page 61: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/61.jpg)
Figure 11. Human apo-IMPDH II microcrystals. Photograph of the type of microcrystals produced from the initial screening of apo-human IMPDH II.
Figure 12. lmproved human apo-IMPDH II crystals. Photograph of the Iargest microcrystals grown. Average size of the crystals is approximately 100p X 20p X 20p. These crystals grew using the hanging drop rnethod with a well solution containing 0.1 M MES (pH 6.0), 1.0 M LiCI, and 8% PEG 4K. 2 pl of protein solution plus 2 pl of well solution were mixed and incubated at 23 OC for 5 days.
![Page 62: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/62.jpg)
concentration, and temperature did not improve the size and shape of the
crystals.
3.3.2. Crystallization of human apo-IMPDH II
The addition of 10% glycerol to the dialysis buffer allowed for a more
concentrated preparation of human IMPDH II. The addition of between 2% and
5% 1-methyl-2-pyrrolidinone (MPyD) [vlv] to the above conditions that produced
the small twinned brick-shaped microcrystals (from pH vs. [PEGILiCI] Grid
Screen) produced larger twinned crystals. The twinning was eliminated by the
addition of 20 mM to 50 mM PME. The largest single crystals were grown at
room temperature and when the well volume was decreased to 0.5 ml (Figure
13).
![Page 63: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/63.jpg)
Figure 13. Large human apo-IMPDH II crystal. Photograph of an apo-human IMPDH II crystal ( 6 0 0 ~ X 200~1 X 2 0 0 ~ ) grown by hanging drop vapor diffusion with a well solution containing O. 1 M MES, pH 5.8, 10% PEG 4000, 1.0 M LiCi, 40 mM PME, 2% MPyD. 4 pl of protein (dissolved in 10 mM TRISICI. pH 8.0, 0.3 M KCI, 10% glycerol, 1 mM EDTA, 2 mM PME at 20 mglml) was mixed with 2 LAI of well solution and incubated at 23OC for 4 to 6 weeks.
3.3.3. X-ray diffraction data collection and processing .
The crystal form, obtained under the conditions found in 3.3.3., was
tetragonal with unit cell dimensions a = b = 145.90 A, c = 129.35 A, and angles u
= p = 7 = 90". Based on symmetry of reflection intensities and systematic
absences, the space group was detemiined to be 1422. Table 3 shows the data
redundancies and Table 4 shows the final statistics from the data processing.
The data were processed from 15.0 A to 2.8 A and found to be essentially
![Page 64: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/64.jpg)
complete. However, below 3.15 A the data were weak and the Rsym values were
above 40%.
Table 3. Summary of reflection intensities
Resolution shell (A)
and R,, values by resolution shell.
All data 1 1 327.40 1 60.70 1 1.47 1 0.08
Table 4. Summary of X-ray diffraction observation redundancies.
Rsy, 0.03 0.04
Resolution shell (A) % of reflections with given number of observations.
chi2 0.67 0.99
Low Limit 40.00 6.03
Avg. error 147.30 89.80
High Limit 6.03 4.79
Avg. I 4398.50 3000.40
![Page 65: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/65.jpg)
3.3.4. Molecular replacement
Table 5 shows the best four AMORE rotation and translation solutions
deterrnined by using the coordinates of hamster IMPDH II as a search model.
The correlation coefficient and the R-factor were slightly better when the
coordinates of the sub-dornain were removed (data not shown). The next
highest correlation coefficient from the molecular replacement calculations was
24.4 %. The solution with the highest correlation coefficient from the rnolecular
replacement calculation was applied to the coordinates and subsequently refined
against the apo-human IMPDH II data. The initial crystallographic R-factor was
0.46 and the R-free was 0.48.
Solution 1 Euler Rotation Angles 1 Translation Correlation j R-factor l #
, I (4 i (A) 1 1 ( O h )
Coefficient (Oh) 1 I I I I I
Table 5. AMORE rnolecufar replacement solutions with the highest peaks. The top 4 molecular replacement solutions from AMORE output files are listed. Solution #1 was applied to the hamster IMPDH II model.
![Page 66: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/66.jpg)
3.3.5. Model building and refinement
Due to the rigid body refinement protocol built into the AMORE program,
an XPLOR rigid body refinement had no effect on the R-factors of Model A.
Following an initial simulated annealing refinement, the R-factor dropped to 0.38,
however the R-free value minimized at 0.42 and increased to a final value of
0.44. To determine the correctness of the structure without introducing phase
bias, the model was converted to a poly alanine structure and a 2 X IF,I - IF,I
electron density map was calculated. Where electron density was visible
extending beyond the alanine P-carbon atom, the alanine residue was mutated
to the appropriate human IMPDH II amino acid residue. Following the 40 step
positional refinement. both R-factors were observed to decrease. A new electron
density map was calculated. alanine residues were again mutated, and the
model was refined. This was repeated until al1 observable amino acid side chains
were included in the model. Additions and deletions were done and multiple
rounds of refinernent were perfoned to produce a model of human IMPDH II.
Table 6 shows the refinement statistics for the final apo-human IMPDH II model.
![Page 67: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/67.jpg)
Table 6. Final refinement statistics
Resolution range: 8.00 to 3.15 A
Theoretical total number of refi. in resolution range Number of unobserved reflections (no entry or IFoI = 0) Number of reflections rejected (Fo,$sigrna c 2.0) Total number of reflections used Total number of reflection in the working set Total number of reflections in the test set Number of non-hydrogen atoms
Crystaltographic R-factor Cross validated R-factor
Bond RMSD (A) Angle RMSD (Deg) Average 0-factor (overall) (À2) Average 0-factor (backbone) (A) Average 8-factor (sidechains) (À )
Continuous electron density was not observed for residues 11 1 to 232.
326 to 337, 398 to 449, and 495 to 514. Discontinuous electron density was
observed in the region of active site helix (326 to 337), however the resolution
limit prevented unambiguous assignment of amino acid residues. Discontinuous
density was also found in the area where the sub-domain would be expected.
Again. residues were not assigned. Electron density was observed extending
beyond GLY 17, which was the N-terminal residue of the hamster IMPDH II
model, and residues 12 to 16 were added accordingly.
![Page 68: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/68.jpg)
3.4. Human apo-IMPDH II model analysis
3.4.1. Global fold
The global fold of human apo-IMPDH II is consistent with the human and
hamster IMPDH II ternary cornplex models. The larger domain of the protein
consists of an u/p barrel type fold with overall dimensions of approximately 40 X
40 X 50 A3 (Figure 14). The tetramer is then generated by a crystallographic 4-
fold rotation of the u/P barrel about the z-axis (Figure 15). The majority of
tetramer-related contacts form between residues that are part of or close to the
active site and residues from the N- and C-terminus of an adjacent monomer. In
particular, an N-terminal p-strand forms a three-stranded antiparallel P-sheet with
two P-strands from an adjacent subunit (Figure 15). Two face to face tetrameric
rings generate an octameric assembly in the 1422 crystal lattice (Figure 16).
Figure 17 is an image of the human apo-IMPDH II tetramer colored by 6-
factors of the backbone u-carbon atoms. The B-factors are lowest in the regions
that make tetramer contacts. and show significant increases surrounding the
regions that are structurally undefined. especially in the vicinity of the sub-
domaiti.
![Page 69: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/69.jpg)
Figure 14. Two orientations of the human apo-IMPDH II monomer model. a-helices are in red and P-sheets are in yellow. Orientations are related by a 90' rotation about the axis parallel to the horizontal of the page. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate the images.
![Page 70: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/70.jpg)
Figure 15. Two orientations of the human apo-IMPDH II tetramer model. The upper image viewed down the z-axis with y-axis parallet to the horizontal of the page. The lower image is representing a 90' rotation of the upper image about the y-axis. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate the images.
![Page 71: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/71.jpg)
Figure 16. Human apo-IMPDH II octameric structure in the 1422 crystal form. The monomers are colored differently for ease of identification. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.
Figure 17. B-factors of the a-carbon atoms of the tetrameric human apo-IMPDH II model. The residues with the lowest B-factors (< 20 A') are colored blue and the residues with the highest 8- factors (w 40 A2) are colored red. The program Swiss-PDBViewer 3.51 (Guex and Peitsch. 1996) was used to generate this image.
![Page 72: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/72.jpg)
The second dornain, inserted between U-helices 2 and 3, partially seen in
the hamster and human IMPDH II structures, and not seen in the Tritrichomonas
foetus IMPDH crystal structure, was not observed in the human apo-IMPDH II
crystal structure and was presurned to be disordered in the crystal. The only
observable IMPDH subdomain as been in the Streptococcus Pyogenes IMPDH
crystal structure. A large void was observed in the crystal lattice that could
accomrnodate the subdomain.
3.4.2. Active site
The active site residues of IMPDH are mainly at the C-terminal end of the
polypeptide chain. A consetved phosphate binding motif, consisting of a P-
strand. u-helix. D-strand conformation is apparent from residues 359 to 396 as
expected. Ala 338. Cys 339, and Gly 340 are the only residues of the 'so-called'
active site helix (usually extending from Gly 326 to Gly 340) for which electron
density is found in the human apo-IMPDH II crystal structure (Figure 18). This
includes Cys 331, the active site nucleophile that forms a covalent bond with
XMP* (Sintchak et al., 1996). The residues (338 to 340) extended approxirnately
9 A above the dp barre1 main body and made contacts with the backbone atoms
of Ile 37 from an adjacent monorner. The lack of electron density around the a-
carbon of Gly 340 (Figure 18) suggests a flexible spot at this residue.
![Page 73: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/73.jpg)
Ala 33û
Figure 18. Human apo-IMPDH II active site helix electron density map. Electron density map (contoured at o = 1.0) and refined amino acid residues showing the lack of electron density between Met 325 and Ala 338. Also note the lack of electron density around the a-carbon of Gly 340. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.
Lvs 450
Figure 19. Human apo-IMPDH II active site flap electron density map. Electron density rnap (contoured at a = 1.0) and refined arnino acid residues showing the lack of electron density between Pro 397 and Lys 450. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.
![Page 74: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/74.jpg)
The discontinuous electron density found where the helix was expected
may represent some stable portions of the missing amino acid residues.
However. the relatively low resolution of the maps did not allow for unambiguous
identification of this part. The active site flap, consisting of residues 400 to 450
following p-strand 8 of the phosphate-binding motif. are also not observed
(Figure 19). The electron density is not seen beyond Pro 337 and resumes after
Lys 450.
Residues of the active site that are part of the dP barrel do not
significantly shift positions when compared to the ternary cornplex of human
IMPDH II. Figure 20 shows five active site residues that make contacts with
substrate ligands, in this case, the XMP* and MPA from the hamster IMPDH II
structure are shown. Significant changes in the position of Asp 274 are
apparent. As well. the C-terminus density, consisting of residues 495 to 514, is
not apparent (Figure 21). The N-terminus extends away from the dP barrel. This
region, especially Tyr 12. forms contacts between two tetramers at the octarneric
assembly interface (Figure 16).
![Page 75: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/75.jpg)
Figure 20. Overlay of a/p barrel active site residues. Shown here are active site residues that are part of the df3 barrel. Cyan, apo-IMPDH II (human); Green, ternary-IMPDH Il (human); Red. ternary-IMPDH II (hamster). XMP' and MPA models were taken from the ternary hamster IMPDH 11. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.
Figure 21. Human apo-IMPDH II C-terminal electron density map. Electron density map (contoured at o = 1.0) and refined amino acid residues stiowing the lack of electron density extending beyond Thr 494. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used ta generate this image.
![Page 76: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/76.jpg)
Crystals that were re-dissolved in dialysis buffer showed l MPDH activity
(data not shown) and SDS-PAGE analysis demonstrated that there was no
significant evidence of proteolytic digestion (Figure 22).
67000 Da .' , Re-dissolved human apo-IMPDH II crystal
Figure 22. SDS-PAGE analysis of a re-dissolved human apo-IMPDH II crystal. The crystal was removed from the mother liquor and placed in 10% glycerol, 10 mM TRISIiW (pH 8.0), 300 mM KCI. 2 mM EDTA. and 2 mM PME. The sample was incubated overnight and applied to an SDS- PAGE gel. Lane 1. Low molecular weight markers; Lane 2, 20 pl of dissolved crystal.
![Page 77: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/77.jpg)
3.5. Amino acid sequence alignments
3.5.1. Overall sequence
Figure 23 shows the sequence alignments of IMPDH proteins with known
three-dimensional structures. The regions that show the highest amino acid
sequence conservation are in the loop regions that connect the a-helices and P-
strands of the U@ barrel. Regions that show the greatest sequence variability
include the subdomain and active site flap.
3.5.2. Active site
Figure 24 shows the sequence alignments concentrating on the active site
helix. Clearly, there is a very high degree of sequence conservation in this
region. Four of the 20 surveyed residues are conserved glycines; three of which
(Gly 324, Gly 326, and Gly 328) are N-terminal to the active site nucleophile
Cysdl l . As mentioned above, most of the residues between and including Gly
326 and Gly 340 are disordered in the human apo-IMPDH II structure.
Figure 25 shows the sequence alignment with respect to human IMPDH II
residues 390 to 453 that represent the active site flap reg ion. There are highly
conserved glycine residues at 398 and 450. In the human apo-IMPDH II
structure, residues in between these glycines are structurally undefined.
![Page 78: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/78.jpg)
Although these glycines are 52 amino acids apart in the primary structure, they
reside approximately 13 A away from each other in the tertiary structure.
Another interesting feature apparent from the sequence alignment is the various
insertions of amino acids between Met 420 and Lys 438. This region is also
structurally undefined in both human IMPDH II and substratelinhibitor complexed
hamster IMPDH II (Sintchak et al., 1996). It includes the highly conserved
residue Tyr 430. Despite these insertions, al1 IMPOH proteins from various
species show greater than 40% sequence identity throughout the active site flap
region. especially P-strand L and u-helix E. The loop between p-strands M and N
is also highly conserved. GMP reductase is the only non-IMPDH protein that
showed significant sequence sirnilarity to human IMPDH II in this region.
Figure 26 shows the alignment centered around human IMPDH II residues
359 to 416 that represent the phosphate-binding motif. All currently known
IMPDH enzyme sequences were included as well as other non-IMPDH
sequences that aligned well with this stretch of human IMPDH II. With the
exception of GMP reductase, al1 non-IMPDH proteins show no sequence
similarity beyond Glu 399, the N-terminus of the active site flap region. The
consensus sequence as defined by Bork et. al, 1995 is also shown. Five highly
conserved glycine residues were observed to align with human IMPDH II
glycines 365, 366, 382, 387. and 398. In addition, Pro 360, Asp 364, Ile 367, and
Ala 383 appear to be highiy conserved between IMPDHs of different species as
![Page 79: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/79.jpg)
well as other phosphate binding proteins. Wlh the exception of Asp 364. al1 the
amino acids in P-strand 7 are conserved non-polar residues.
Figure 27 shows the sequence alignments of the residues from the
subdomain region of human IMPDH II with other IMPDH-, and non-IMPDH
proteins. There are six regions of conserved amino acids. These include
residues Gly 113 and Pro 123, Gly 141 and Asp 146, Arg 153 and Ile 163, Leu
175 and Val 186, Pro 189 and Leu 151, and Lys 208 and Ile 221.
![Page 80: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/80.jpg)
Figure 23. Sequence alignments of stnicturally known IMPDHs. H. Il.. human type II IMPOH; CH. II, chinese hamster type II IMPOH: S.p. . S. Pyogenes IMPDH; T f . . T foetus JMPDH. Filled-in black represents amino acid identities and filled-in gray represents amino acids wrth similar chernical properties. The top Iine shows the secondary structural elements as defined by the hamster IMPOH structure (Sinchak etA. 1996).
![Page 81: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/81.jpg)
Human II Mouse II L. donoveril Tb. bruce1 C albicans S cerevrsrae Hamster I I Mouse I Human I Fruit fly P. cadnii A thaliane T. foetus 6 bergdoderi
Figure 24 Mulliple sequence alignment of Ihe active sile helix region The top Iine shows the secondary structural elements as defined by the hamster IMPDH structure (Sintchak et al , 1996) Filled-in black repersenls amino acid identities and f~lled-in gray represents amino acids wilh sirnilar chernical properties aslericks denoles the adive sile nucleo~hile Cvs 31 llhumanl
342 34 2 338 3 36 344 347 342 342 342 36 1 274 332 329 240
The
![Page 82: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/82.jpg)
![Page 83: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/83.jpg)
Human II* Hamster 11" Mouse II Human l Mouse l Ffuil Fly S cerevisrae P cannrr C albicans A fhahana T b brucer L donovan1 M leprsa M tubarculos~s H pykrr M jannaschu A calcoace!icus E cok H mf/usnzae P furiosus B subtrl~s S pyogenes El burgdorferi ' T foetus' H pylori (GR) Human(GR) A lumbr~cordes (GR) E col! (GR) Spinach(G0)' A fulgidus (2ND) S lycopersicum (GO) M cryslallrnrum (GO) A vindans (LO) P pullda (MD) E cob (ThiC) M l a lrophicum (GS) H nfulenzea (1.D) S cerevisiae (Cyb2)' E col1 (TrpC)' Consensus
Figure 26 Multiple sequence alignrnent ot lhe phosphate-binding region Pfoleins olher than LMPDH are identified by brachels GR. GMP teductase. GO. glycolale oxidase, 2ND, 2-nitropropane dehydrogenase, 10, lactate oxidase, MD, mandelale dehydrogenase. GS. glutamale synthase. LD. lactate dehydrogenase. Cyb2. cyîochfome b,. TrpC. indoleglycerolphosphate synthase The top Iine shows the secondary structural elements as defined by human and hamster IMPDH II structure (Sinchak e l al. 1996) Filled-in black fepresents amino and idenlities and fiiled-in gray represents amino acids with similar chemical prowflies The bottom Iine shows Ihe consensus (Boik et al, 1995) capitals. amino acids conserved in almost al1 of the sequences. h. mainly non-polar, p. macnly polar Asterisks represenl proleins wdh known lhree dimensional structures and are described in Figure 27
![Page 84: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/84.jpg)
![Page 85: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/85.jpg)
4. Discussion
4.1. Molecular Biology
4.1.1. Cloning of human [MPDH II cDNA
A human peripheral blood leukocyte ÀgtlO cDNA library from a HL-60 cell
line was chosen as the source of hurnan type II IMPDH cDNA because of the
high level of human IMPDH II mRNA present in the cells, as judged by Northern
blot analysis (Konno et al.. 1991). This study described a large increase in the
2.3 kb human IMPDH Il mRNA of leukemic cells relative to normal human
lymphocytes. Consistent with this is the significant amplification of human IMPDH
II cDNA directly from the lambda phage stock following 30 cycles of PCR (see
2.1).
PCR primer sites were chosen to be complementary to flanking regions of
human IMPDH II cDNA. 8ecause the cDNA library was constructed by
recombination of cDNA fragments and lambda DNA at an EcoRl restriction
enzyme site and human IMPDH II cDNA sequence has a EcoRl restriction
enzyme recognition site at position 294, it was unclear whether the 5' end of the
coding sequence was present. Therefore, the upstream primer was designed to
be complementary to the sequence at the EcoRl cloning site of ÂgtlO. The
downstream primer was designed to be complernentary to the sequence
![Page 86: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/86.jpg)
immediately 3' to the human IMPDH II stop codon. The amplification of a 1,600
bp fragment (Figure 3) appeared to indicate that the entire coding sequence was
present (1,542 bp). The high stringency sample (containing 5 mM MgCI2) did not
show DNA amplification and the low stringency sample (containing 15 mM
MgC12) produced a small fragment in addition to the main 1600 bp fragment
indicating some non-specific binding of the PCR primers. The sample containing
10 mM MgCl2 produced a single DNA fragment. Repetition of this experiment
invariably led to the amplification of pg quantities of the 1600 bp fragment.
The fragments produced following digestion with the restriction enzymes
Pst1 and EcoRl were consistent with the expected fragments for the human
IMPDH II gene. These results prompted the attempt to recombine the PCR
generated fragment to the standard cloning vector pTZ19R. Due to the low
efficiency of ligating DNA fragments with blunt-ends, a blue-white screening
protocol was used to identify positive transformants containing recombinant DNA.
Plasmids were isolated from white colonies and visualized on an agarose gel
(Figure 4). Samples that migrated differently from pTZ1 SR were subjected to
digestion with EcoRI. The EcoRl digestion results were used to identify possible
pTZ19WPCR insert recombinants and the orientation of the inserts. Figure 5
shows that samples 3, 4. 8, and 9 appeared to be pTZ19Rlhuman IMPDH II
recombinants. DNA sequencing of these samples confirmed the identity and
orientation of the PCR product inserts of al1 four samples to be human IMPDH II
cDNA.
![Page 87: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/87.jpg)
The sequence surrounding the recombination sites of sample #8 is
detailed in Figure 6. Interestingly, the 5' end of the insert begins 3 bp 5' to the
human IMPDH II start codon. The primer sequence or any other of the predicted
upstream DNA sequences of human IMPDH cDNA are absent. As well, 2 bp are
missing from the 3' end of the of the downstream primer sequence. These types
of alterations are present in al1 four recombinant samples. Bases are also
missing from the vector sequence. Most likely, the long incubation time of the
ligation reaction (16 hours) and contaminating exonuclease activity caused some
degradation of both the vector and insert.
Sample #8 had a coding DNA sequence that was identical to the
previously published sequence for human IMPDH II cDNA (Natsumeda. Y., et al..
1990). Three of the four recombinant clones had point mutations in their DNA
sequences that would result in predicted amino acid sequence changes. These
mutations are the result of the replicatative infidelity of Taq polymerase.
Originally. due to expected mutations in the PCR products when using Taq
polymerase, the amplified fragments were going to be used as templates to
generate random primed probes for screening the lambda library by
hybridization. However, when one clone was determined to be error-free, this
approach was abandoned. For reproducibility without mutations. higher fidelity
polymerase should be used.
![Page 88: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/88.jpg)
4.1.2. Sub-cloning of human IMPDH II cDNA
Konno et al, 1991 reported the expression of human IMPDH II by sub-
cloning the human IMPDH II cDNA into a pUC based expression plasmid as a
fusion protein with 11 additional residues at the N-terminus. This procedure,
however. produced only pg quantities of protein, far below the production level
required for the screening of conditions suitable for the growth of protein crystals.
An expression protocol was designed such that the first amino acid residue
expressed was the hurnan IMPDH II native Met start residue. pSE420
(Invitrogen) is a prokaryotic expression plasmid designed to express mammalian
genes in prokaryotic cells. An Ncol restriction enzyme recognition sequence
(CCATGG) is available so that the start codon of a gene can be placed
immediately downstream of the genetic elernents required for the over-
expression of a protein (Scheme 2).
Analysis of the human IMPDH II cDNA sequence revealed three Ncol
recognition sequences present in the gene, including one at the start codon. The
Ncol partial restriction enzyme digest protocol (Section 2.2) was implemented to
isolate a cDNA fragment that had no 5' sequence beyond the start codon. This
fragment was then ligated to the pSE420 plasmid and the resulting recombinant
plasmids were screened by Pstl and EcoRl restriction enzyme digests. Al1
samples screened showed recombination in the correct orientation for expression
(Figure 5).
![Page 89: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/89.jpg)
4.1.3. Expression of human IMPDH II cDNA
Screening for expression was initially done on a small scale for analysis
as described in section 3.2. Figure 7 demonstrates that three of the samples
picked showed over-expression of a protein of approximately 55 kDa. The lanes
where both induced and uniduced samples were loaded showed expression of
this protein indicating a lack of complete repression. This, however, did not have
any detrimental effects on protein expression or cell growth. as IMPDH is not
toxic to bacterial cell growth. The observation of significant levels of IMPDH
activity relative to the controls indicated that human IMPDH II was over-
expressed as expected.
4.2. Biochemistry
4.2.1. Purification of human IMPDH II
The method used to purify human IMPDH II was based on the
method used by Carr et al, 1994. This method employed a heparin cation
exchange column whereby the soluble cell extract protein was loaded directly.
Figures 8, 9, 10 and Table 2 show that this highly reproducible technique was
very effective in eliminating the majority of contarninating proteins. The final step
involved a substrate-based ( 1 MP) affinity chromatograp hy column. The
combination of these two columns proved to be an effective and efficient method
![Page 90: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/90.jpg)
to purify human IMPDH II. Due to the significant reduction in specific activity
upon storage, this protocol, from cell lysis to purified protein, was completed in a
single day, yielding 25-30 mg of purified human IMPDH II per liter of E. coli
growth media, clearly sufFicient for the crystallization studies.
4.2.2. Enzyme kinetics
Table 7 shows kinetic constants for human apo-IMPDH II derived in this
study and by others. The Km values for both substrates were consistently in the
low micromolar range however the Lt values showed some variation. Perhaps
the decrease in activity observed when the protein was stored at 4OC may be
refiected in the reported values. All of the human IMPDH II proteins listed in the
table below are recombinantly produced. As there are no reports of human
IMPDH II isolated and characterized from human tissue, it is not known whether
tissue source enzyme would have similar kinetic constants. Recombinant hurnan
IMPDH 1 has been shown to have similar Km and kat values as human IMPDH II
(Konno, Y.. et al., 1991; Carr, S., et al.. 1993; Hagar, P.. et al., 1995).
![Page 91: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/91.jpg)
REFERENCE
Table 7. K, and L, values for human type II IMPDHs.
This study
Wang and Hedstrorn
Fleming et al.
Carr et al.
4.3. Protein crystallography
KI,I IMp (PM)
4.3.1. Preliminary crystallization screens.
Kt, NAD (PM)
6.4
4.0
7.2
9.3
The Hampton Research crystallization screens were used to screen for
conditions that lead to the growth of human IMPDH II crystals suitable for X-ray
analysis. Several conditions produced microcrystals in a short period of time (15-
360 minutes). The largest of the microcrystals grew in spaces within the
precipitated protein in the drops. Srnaller variations in the parameters had little
or no effect on the protein solubility or the growth of these crystals. The best
microcrystals ap peared in the PEGlLiCl crystal screen. These crystals were
brick-shaped (Figure 12) and had straight, clean edges and grew as single
entities. However, despite exhaustive parameter searches, no conditions were
found that produced large single crystals.
These crystallization experiments indicated that human lMPDH II had a
strong tendency to aggregate. Both high and low concentrations of precipitants
32
36
37
32
0.91
O. 39
0.76
1.3
![Page 92: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/92.jpg)
(PEGs, salts, and organics) produced extensive amorphous aggregation.
Intermediate ranges of precipitants (3-12% PEGs, 0.5-1.5M salts, and 1-3%
organics) tended to moderately increase the protein's solubility. These
conditions tended to grow most of the microcrystals. Very few conditions
produced crystalline aggregates and in those that did, the crystals were no longer
than 30 microns along the longest edge.
4.3.2. Crystallization of human apo-IMPDH II
Va rious water-misable organic solvents were added to the d ialysis buffer
in order to improve the solubility of the enzyme prior to crystallization
experiments. 10% glycerol added to the dialysis buffer allowed the protein to be
concentrated as high to as 50 mglml without any aggregation. Despite screening
for crystallization at higher protein concentrations, no change in crystal size was
observed. Crystal size was finally increased with the addition of 1-methyl 2-
pyrollidinone at concentrations betweer. 1% and 7% (wlv). Most likely, due to its
amphiphilic character. this compound improved the solubility of human IMPDH II
enough to reduce the number of nucleation events within the crystal drop so
single large crystals could grow. However, al1 crystals grown under these
conditions were twinned. The addition of 10 - 40 mM P-mercaptoethanol (PME)
effectively eliminated the twinning. As there are 12 cysteine residues in the
human IMPDH II amino acid sequence and no reported disulfide bonds in the
hamster IMPDH II structure, the twinning was probably due to disulfide bond
![Page 93: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/93.jpg)
formation of free cysteine(s) on the surface of the molecules. The addition of
PME prevented this to allow single crystals to grow. Following these conditions,
small changes in temperature and well-and drop-volume were screened to
maximize the size of the crystals. Eventually, excellent, large single crystals
were grown reproducibly (Figure 1 3).
4.3.3. X-ray diffraction data collection and processing .
All data were collected from one large single human IMPDH II crystal
(0.8mm X 0.4mm X 0.4mm). frozen in a liquid nitrogen stream. The crystal
belonged to the tetragonal space group 1422. Complexed human and hamster
IMPDH II crystals. as well as lMPDH crystals from Borrelia bergdorfe', were also
tetragonal. however their space groups were both reported as 14 (Sintchak et al..
1996. Colby et al.. 1999. MacMillan et al., 1998. unpublished data). IMPDH
crystals from Tritrichomonas foetus were of the cubic space group P432. In al1
cases, a 4-fold crystallographic rotation of an IMPDH monomer around the
crystallographic c-axis created the IMPDH tetramer.
The tables of redundancies (Table 3) indicates that the data set was
almost complete to 2.8 A. However, the table of reflection intensities and Rsy,
values clearly (Table 4) shows that below 3.1 5 A the intensities of the reflections
dropped significantly, and consequently, the Rsym values increased dramatically.
As a result. no useful signal can be observed beyond this resolution and no data
![Page 94: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/94.jpg)
were used below this value. Possibly. the disorder of the subdomain and other
parts of human apo-IMPDH II caused this. Another example of such behavior
would be mercuric ion reductase (Schiering et al. 1991). but in accordance, the
maximum resolution obtained with the human ternary-IMPDH II crystals was 2.9
A. Nevertheless, the data up to this level were good and the overall R,, value
was low (6.0%).
4.3.4. Molecular replacement
The molecular replacement program AMORE was used to produce an
initial model of apo-human IMPDH II from the coordinates of the hamster IMPDH
II as a search model. Calculations were done both with the coordinates of the
sub-domain present and removed from search model. This was done because
the IMPDH sub-domain from Borrelia bergdofen and Tntnchornonas foetus were
disordered in the crystal, indicating that this part of the molecule may be
disordered in other IMPDH structures. If this were the case, false coordinates
may have significantly reduced the correlation factor between the data and the
search model. The results of the calculations (Table 5) showed that the
correlation factor, when the sub-domain coordinates were removed from the
search model, was higher, although the difference was small. These correlation
factors were greater than 15 - 20% above the next highest peak solution and the
R-factors were around 40%. indicating a correct solution. The translationlrotation
solution found without the coordinates of the sub-domain was applied to the
![Page 95: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/95.jpg)
search model to generate the first model of apo-human IMPDH II. Molecular
replacement calculations using the coordinates from the B. bergdorfen, and T.
foetus IMPDH structures (generously provided by Dr. G. Petsko and Dr. F.
Whitby, respectively) were atternpted prior to receiving the hamster IMPDH
coordinates. Although some potential rotation solutions were identified.
translation solutions were not found.
4.3.5. Model building and refinement
A rigid body refinernent followed by a simulated annealing refinement of
the AMORE solution mode1 (Model A) resulted in a low &,si-factor and high
Rh,-factor. The electron density maps that were calculated from a poly-alanine
model of Model A clearly showed areas of electron density extending from the P-
carbon atoms that matched expected amino acids. This was indicative of model
correctness that was supported by decreasing residuals throughout the model
building process. A stage was reached however. when the electron density did
not improve further and the residuals began to diverge following refinement.
Regions of the poly-alanine model that had little or no electron density were
deleted from the model. Residues that were removed included the active site
helix and flap residues as well as residues from the C-terminus. As the
refinement model did not include subdomain and N-terminal residues, some
amino acids were added to the model where electron density clearly indicated
their presence. Following several rounds of refinement, the lowest achievable
![Page 96: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/96.jpg)
values of the RCqst- and Rfree-factors were 23.0% and 28.9%. respectively (Table
6). These values were similar to those of the human ternary-IMPDH II structure
(the Rcqst- and Rr,,-factors were 24.9% and 27.0%, respectively; Colby et al.,
1999). The resolution was too low to include water molecules in the model. The
RMSD values for bond lengths and angles were within acceptable ranges. An
overall B-factor of 37.9 A2 was high for a protein structure that was deterrnined
from data that was collected from a liquid N2 frozen crystal. This suggests a high
amount of structural variability throughout the human apo-IMPDH Il structure or
displacement from their lattice points.
4.5. Human apo-IMPDH II model analysis
4.5.1. Global Fold
The structural studies on IMPDH have determined that this protein is a
cyclically symrnetric C4 tetramer (Figure 15) composed of four identical
monomers. Each rnonorner is a single polypeptide chain that can be divided into
two distinct structural domains, a large domain and a small or flanking domain.
The overall fold of the large dornain is an cJP barrel (Figure 14). This fold is
characterized by an eight-stranded parallel P-barre1 surrounded by eight u-
helices. Presently, approximately 10% of al1 enzymes with known tertiary
structures contain at least one d p barrel domain and are typically found in
metabolic enzymes (Farber & Petsko, 1990; Branden, 1991 ; Farber, 1993). In
![Page 97: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/97.jpg)
particular, clusters of u/P barrel motifs are found in enzymes that are involved in
purine biosynthesis as well as tryptophan, histidine, and thiamine biosynthesis -
enzymes whose substrates are heterocyclic compounds. Many of these
enzymes have in common a phosphate binding motif at the C-terminal region of
the polypeptide (as described in section 4.5.2.) suggesting that these enzymes,
des pite low ove rail sequence identity, have evolved via a divergent pathway from
a common ancestor (Bork et al., 1996).
To date, five IMPDH crystal structures have been solved. Table 8 lists
some details of these crystal structures.
Organism Human type II Chinese hamster tv~e II
Table 8. List of pu blished IMPDH crystal structures. (6-Cl-IMP, analogues 6-chloropurine riboside 5'-monophosphate; SAD, and selenazole-&carboxamide adenine dinucleotide)
-- - -
c or relia bergdofen Tntnchomonas foetus Stre~tococcus Pvoaenes
Figure 28 (A-E) shows the overlays of the monomer backbone structure of
apo-human type II with ternary-human type II, ternary-hamster type II IMPDH,
Streptococcus pyogenes I MPDH, T. foetus IMPDH , and B. bergdorfen I M PDH ,
respectively and Figure 23 shows amino acid sequence alignment of these
proteins. Overall, the u/P barrel core of the molecule is maintained in al1 of these
IMPDH structures. There is some displacement of a-helicies of the u/P barrel
Ligand 6-CI-IMP and SAD XMP and MPA s a Apo. XMP IMP
Reference Colby et al., 1999
PD6 # 1630
McMillan et a1.,2000 Whitby et al., 1997 Zhana et al.. 1999
Sintchak et al.. 1996 1 NIA 1 EEP 1AK5 lZFJ
![Page 98: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/98.jpg)
between the mammalian enzymes and the microbial enyzmes, however the
active site region of the barrel is structurally maintained. The main differences
are the missing amino acids from the active site (discussion to follow), sub-
domain position and completion (discussion to follow), and some loops and
helices around the outer perimeter of the barrel.
The N-terminal region of the human apo- and ternary-IMPDH II are very
similar, however the microbial IMPDH N-termini extend in a different direction.
Crystal packing forces may influence the conformation of this region, as this
peptide is observed at the interface of two tetramers in al1 of these IMPDH
structures.
Figure 28. Superposition of various IMPDH structures. Figures A through E show the overlays of the backbone structure of human apo-IMPDH type II (Hllaj (dark blue) with: A, human ternary-IMPDH type II (Hllt). overall RMSD=0.46 A. B. hamster ternary-IMPDH type II (Chllt). overall RMSDr0.54 A. C. Streptococcus pyogenes IMPDH (Sp). overall RMSD=1.1 A. O. Tfoetus IMPDH (Tf). overall RMSD=1.1 A. E. B. bergdorferi IMPDH (Bb). overall RMSD=0.99 A. The N- and C- terminais are labeled as well as the sub-domain (SD), and the active site helices and flaps. The location of the IMPDH active site is indicated by a yellow dot. Images are colored by RMSD values between U-carbon atom coordinates. The blue color represents RMSD values < 1 .O A and the red color represents RMSD values > 4.0 A (missing amino acids). Intermediate colors represent intermediate RMSD values. The program Swiss-PDB Viewer 3.51 (Guex and Peitsch, 1996) was used to generate the images and to calculate RMSD values.
![Page 99: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/99.jpg)
~ e l i x (Hllt)
(Hlla, Hllt)
![Page 100: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/100.jpg)
SD
Flap (Chll
![Page 101: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/101.jpg)
tielix (Sp) Y
![Page 102: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/102.jpg)
Flap (1
![Page 103: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/103.jpg)
/ Flap (Bb)
Helix (Bb) &
![Page 104: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/104.jpg)
As rnentioned above, the protein is a cyclically symmetric C4 tetramer
composed of four identical monomers, as seen clearly in Figure 15. This
appears in al1 reported IMPDH structures. In fact, al1 structures (except T. foetus
IMPDH), f o n tetragonal crystals whereby the C4 symmetry is about the c-axis.
T. foetus IMPDH crystals were cubic but still had the C4 symmetry about one of
the equivalent crystal axes. The side view of the tetramer (Figure 15) shows that
the tetramer forms a bowl-like structure. The active site region is at the
monomer-monomer interface. Colby et al. 1999 reported that the binding of the
adenosine end of SAD (analagous to NAD) takes place between the a3 helix-p3
strand junction of one monomer and the PC-PD strand junction of the adjacent
monomer. This region showed the lowest B-factor values of the human apo-
IMPDH II structure (Figure 17). The stability of this portion of the protein
suggests that the monomer-monomer interface may be of fundamental
importance in the stability of the entire tetramer and for NAD binding.
The low B-factor values at the monomer-monomer interface as well as the
high B-factor values surrounding the sub-domain attachment site are also
apparent in the human ternary-IMPDH II structure (Colby et al., 1999). Although,
the overall 6-factor values for the ternary complex are lower than those of the
apo form of the enzyme. This may reflect higher overall polypeptide disorder in
the absence of ligands.
![Page 105: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/105.jpg)
Evidence for the existence of a functional tetramer in solution has corne
from equilibrium sedirnentation analysis on the T. foetus and human IMPDHs
(Whitby et al.. 1997 and Carr et al., 1994, resp.). Interestingly, the data from the
former study can be fitted best to a tetramer-octamer association model with a
dissociation constant of 1.4 +/- 0.5 FM. The space group of human apo-IMPDH
II and Streptococcus pyogenes IMPDH is 1422, in which two tetramers form an
octameric assembly (Figure 16). In the human ternary-IMPDH II and T. foetus
IMPDH structures. there is a large 75 A X 100 A 'hole" located in between two
other tetramers along the z-axis. Colby et al.. 1999 had speculated that this is
sufficient to accommodate another tetramer. These data suggest that the
formation of an IMPDH octarner is common among IMPDHs. As well. the large
unoccupied cavities observed in these crystals and the relatively high B-factor
values attest to the amount of structural variation in the IMPDH structure.
![Page 106: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/106.jpg)
The second domain, named the sub-domain, is an approximately 120
amino acid long piece of polypeptide chain inserted between the second u-helix
and the third p-strand of the clip barre1 (Figure 28). The function of the sub-
dornain is not known and the removal of this domain has no effect on the
catalytic activity of the enzyme (Sintchak et al., 1996). As well. the sub-domain is
not found in the amino acid sequence of B. bergdorfen IMPDH. This domain is
structurally completely undefined in the human type II apo-IMPDH (Figure 29).
and the T.foetus IMPDH crystal structure (Whitby et al., 1997). Only half of the
amino acids are structurally defined in the human and hamster IMPDH II ternary
complex structures (Colby et al.. 1999 and Sintchak et al.. 1996). The only
IMPDH structure with a fully defined sub-domain is the one from Streptococcus
pyogenes. The sub-domain polypeptide has been shown to project outward from
the corners of the tetramer-square. However, the global position of the domain is
different in the human and hamster IMPDH II ternary complex- and
Streptococcos pyogenes- structures due to a hinge region at the N- and C-
terminal portions of the subdornain (Glu l 11 and Tyr 233. resp.) (Colby et al..
1999. Sintchak et al.. 1996. and Zhang et al., 1999).
![Page 107: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/107.jpg)
Figure 29. Human IMPOH II electron density rnap in the area of the subdomain. Electron density map (contoured at a = 1 .O) and refined amino acids showing the lack of electron density between Glu 11 1 and Tyr 233. The program Swiss-PD6 Viewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.
Figure 18 shows the amino acid sequence alignment of the human IMPDH
II sequence with other proteins. Most hits came from other IMPDHs however
there were also hits from other proteins. The sequence conservation of this
domain from a wide range of organisms would point to a potentially important
function, although its function with respect to IMPDH is entirely unknown.
Interestingly, the IMPDH sub-domain amino acid sequences show similarity to
the CBS domain (Corpet et al., 1998, Kruger and Cox, 1994). The CBS
designation arises from the original identification of this folding motif in the
enzyme cystathionine beta-synthase (CBS) (Baternan, 1997). It has been
reported that the CBS domain is responsible for the binding of S-
adenosylmethionine, an allosteric regulator of cystathionine b-synthase (Taoka,
![Page 108: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/108.jpg)
S. et al., 1999). Mutations in the CBS protein cause elevated levels of
methionine and homosysteine and lead to the human disease hornocystinuria, a
rare, in herited rnetabolic disease (Abbott et al.. 1987).
There are two CBS motifs found in the subdomain of IMPDH proteins from
al1 three kingdoms of life. These two motifs are related by approximate twofold
symmetry (u-carbon RMSD = 2.7 A, Zhang et al.. 1999). Each CBS motif has a
characteristic sheet/helix/sheet/sheet/helix topology. Other proteins containing 2
CBS domains are bacterial ABC transporters (2 proteins), hurnan voltage-gated
chloride channel proteins (6 proteins), and a variety of hypothetical proteins from
the archaebacteria Methanococcus jannaschii (1 5 proteins) (Bateman. 1 997).
The IMPDH structure from Streptococcus pyogenes is the first reported complete
structure of a CBS dimer domain. This structure in cornparison to the other
IMPDH sub-dornain structures shows a different global position relative to the u/p
barrel. These positions may be due to crystal packing forces. although its overall
movement May have an effect on enzymatic activity as this domain is situated
next to the active site. Perhaps the sub-domain binds allosteric affector
molecules andlor other proteins that are involved in the regulation of IMPDH
activity. In fact, a recent publication identified a protein the interacts directly with
IMPDH. A protein kinase called PKBlAkt was found to interact with human
IMPDH II via its pleckstrin homology (PH) domain (Ingley. E. and Hemmings.
B.A.. 2000). This domain is found in a variety of molecules involved in cellular
regulation including the GTPase regulators ras-GTP and SOS (Haslam, et al..
![Page 109: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/109.jpg)
1993, lngley and Hemmings, 1994). This association was found to enhance
lMPDH activity and that most of the IMPDH structure was required for
association to be seen. The authors suggest that the PH domain associates with
the sub-domain and the entire IMPDH molecule is required for proper folding of
the sub-domain. In the same way. other molecules may interact with the sub-
domain to affect IMPDH function. As this domain appears to be a separate and
independent molecule attached to IMPDH, this sub-domain peptide could be
expressed separately and its structure and function be studied to try to determine
the role that it plays in IMPDH biology.
4.5.3. Active Site
The IMPDH active site, located at the C-terminal end of the polypeptide.
has been shown to contain both structurally conserved and highly variable parts.
The variability was found with the active site helix a-D (between Met 326 and Ala
337) (Figure 24) and the active site Rap, including p-strands J. K. L. M. and N, as
well as helix u-E (between Pro 397 and Lys 450) (Figure 25). The helix. that
contains Cys 331, was found to be disordered in apo-IMPDH II (Figure 18) but
not in the human- and hamster- ternary-IMPDH II. Colby et al. (1999) reported
that the human ternary-IMPDH II active site helix conformation was different from
the hamster ternary-IMPDH II helix, despite nearly identical amino acid
sequences. IMP waç covalently bound to Cys 331 in both cases and the former
had a more extended helix (Figure 28). The same helix in the Streptococcus
![Page 110: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/110.jpg)
pyogenes IMPDH structure also had more helical character than the human
ternary-IMPDH II structure (Zhang et al., 1999) but here, only IMP was bound
(i.e., no other ligands) and non-covalently. The helix is also visible in the B.
bergorferi IMPDH structure where a S04 molecuie occupies the phosphate
binding site (McMillan, F.M.. et al.. 2000). Here, the helix is identified as "loop 6".
The authors suggest that this helix acts like a "hinged lid", trapping the substrate
with a concerted motion, similar to other alb barre1 enzymes previously reported
by Joseph et al., 1990. The apo-IMPDH structure reported here would indicate
that this was not the case for the human IMPDH, however, the discontinuous
electron density observed in this region rnay attest for some structural stability of
this helix in the absence of ligands. Perhaps the "hinged lid" is too flexible in
human IMPDH for stable electron density to be viewed. All of these data
combined indicated that IMP binding is essential for the stable formation of the
active site helix in human IMPDH II.
Amino acid sequence alignments for this region (Figure 24) show that
there are highly conserved glycine residues located at both ends of the helix.
The lack of electron density around the U-carbon atom of Gly 340 (Figure 18)
implies flexibility. As well, 3 highly conserved glycine residues are located at the
N-terminal end of the helix in the region were the electron density is absent. This
suggested that these residues play the role of "weak spotsn whereby flexibility is
required for IMP binding.
![Page 111: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/111.jpg)
The same type of motif was observed for the active site fiap that forms a
two-stranded p-sheet over the active site. The electron density was absent in
this region in the human apo-IMPDH II structure (Figure 19), but present in
ternary corn plexes of hamster-, Streptococcus pyogenes-, and T. foetus -
IMPDHs (Figure 28). However, most of the fiap is undefined in the human
ternary-IMPDH II structure despite the presence of SAD. Colby et al. (1999)
reported that side chain density was observed here, but unambiguous residue
assignment could not be made at the resolution obtained. Some residues of the
flap that made contacts with the adenosine portion of the dinucleotide were
assigned. It appears that in the absence of dinucleotide ligands, the flap is
disordered.
Sequence alignments of the flap (Figure 25) show areas with high amino
acid sequence conservation as well as peptide insertions (between residues 420
and 440). Again, two highly conserved glycine residues (Gly 398 and Gly 451)
are located at the N- and C-terminal parts of the flap suggesting these residues
are a "weak spot" that provides flexibility important for ligand binding. The
structure of the flap region in this case does not appear to be rigid like loop 6 of
8. bergdorfen IMPDH.
Figure 20 shows the overlay of five conserved residues that make
important substrate-inhibitor contacts and are part of the u/P barre1 domain. For
the most part, these residues are rigid when compared to the helix and flap
![Page 112: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/112.jpg)
regions. The fold of the u@ barrel in the active site showed very little structural
variation (Figure 28) between the apo- and complexed-forms of IMPDH, as well
as the IMPDHs among different species. There is also no evidence of any global
conformational change on ligand binding in the monomers or the tetramer. In a
way, the cc/P barrel provides a solid base for ligand association and the helix and
fiap act like a flexible cover to further intensify the interaction for catalysis to
proceed.
The C-terminal end (Ser 495 to Phe 514) was absent in the hurnan apo-
IMPDH II structure (Figure 21). In contrast, the residues of the C-terminal tail in
the hamster ternary-IMPDH II have been assigned (Figure 28). It appears to
point away from the monomer structure into solvent. However, when the tetramer
was generated, the C-terminal tail provided a third P-strand to add to the fiap P-
sheet of an adjacent monomer. It is assumed that this interaction stabilizes the
association between the ligand and the flap. This tail is not observed in the
human ternary-IMPDH II structure (Figure 28) but is seen in the Streptococcus
pyogenes IMPDH structure with the same conformation as adopted by the tail
from the hamster IMPDH II structure. This suggests that this conformation is
necessary for ligand binding. Once again, the non-liganded, apo-form of the
protein is disordered and the conformation is ordered upon substrate binding.
As mentioned above, there is a sheet/helix/sheet motif at the C-terminal
end that is common to many dB barrel proteins. In human IMPDH II, this motif
![Page 113: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/113.jpg)
includes P-strands 7 and 8 and inserted between the P-strands is a-helix 7. It is
responsible for binding of the phosphate of the IMP molecule. Figure 26 shows
the results of the amino acid sequence alignment of human IMPDH II phosphate-
binding motif with other proteins. There are many conserved residues among
IMPDHs as well as other proteins that bind ligands with phosphate groups.
Figure 30 shows a structural overlay of the a-carbon backbone atoms of this
motif from IMPDH- and non-IMPDH proteins and associated RMSD values. The
conserved residues, as seen in Figure 26, are highlighted. Also shown is IMP
with its phosphate interacting with this region.
/ 1 T. foetus IMPDH 1 0.76 11 1,
Human ternary-IMPDH II
Hamster ternary-IMPDH 11
S. pyogenes lMPDH
[I Yeast cytochmrne b2 1 1.12 11
0a3'
Spinach qlycolate oxidase
Figure 30. Superposition of the phosphate-binding region. Black, human apo-IMPDH II; blue, human ternary-IMPDH II; green, hamster temary4MPDH II; yellow, T.foetus IMPDH; red, S. pyogenes IMPDH; purple, spinach glycolate oxidase; orange, yeast cytochrome b2. Also shown is the IMP moiety from the human temary-IMPDH Il structure (cyan). Highlighted are the conserved amino acid residues. lnset is a table with the RMSD values for Ca-atoms of other proteins with this motif calculated against the human apo-IMPDH II structure. The program Swiss-PDB Viewer 3.51 (Guex and Peitsch, 1996) was used to generate the image and to calculate RMSD values.
1 . 0.48
0.78
1
1
1
![Page 114: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/114.jpg)
Bork et al.. (1996) have defined a consensus sequence for this motif
(Figure 26) and argued that this common structure, despite low overall sequence
identity, reflects the fact that u i P barrel proteins that bind phosphate groups have
evolved from a common ancestor. The conserved hydrophobic amino acids are
situated on the inner-part of U-helix 7 and associate with other hydrophobic
amino acids that are on the inner-parts of the 2 P-strands. Highly conserved Asp
364 makes contacts with the hydroxyl groups of the IMP ribose while backbone
amides and carbonyls make contacts with the phosphate moiety (Colby et al..
1999). It is evident that there are no major structural changes in this motif
following ligand binding, consistent with the view that cr/P barrel residues that are
part of the active site are fairly rigid.
It is clear that, upon substrate binding. there are conformational changes
caused by the ordering to the IMPDH structure. As no major changes were
observed between apo- and ternary-IMPDH II of the uiP barrel core. the majority
of these changes can be attributed to the active site helix and flap, as well as the
C-terminal tail. The sub-domain may also be involved due to its shifting position
among different IMPDHs. There is, however, no clear proof that the latter is the
case.
There is considerable functional evidence for conformational changes in
IMPDH upon ligand binding as well. Nimmesgern et al., (1996) have reported
both conformational changes and stabilization associated with ligand binding to
![Page 115: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/115.jpg)
hamster IMPDH II. They used a variety of techniques including in vitro
proteolytic susceptibility, hydrophobic fluorescent dye binding, far-UV circular
dichromism spectra and urea-induced denaturation. Their evidence indicated
that there was no NAD binding independent of IMP and XMP binding and that
IMP and XMP stabilized a closed conformation that has a higher affinity for NAD.
This is consistent with product inhibition studies of IMPDH enzymes from a
variety of sources showing that IMP is first to bind and XMP is the last to be
released (Holmes. et a1.J 974; Carr, et al., 1993; Verharn, et al., 1987; Anderson
and Sartorelli, 1968; Xiang, et al., 1996). Although. enzyme kinetic studies using
NAD analogues, isotope effects, hydride exchange, and pre-steady state kinetics
indicated that substrate association is random (Wang and Hedstrom, 1997).
Evidence from Nimmesgern et al., (1996) also suggested that the protein
remained closed throughout the catalytic process and reverted to the open form
with XMP release. In the absence of ligands. the protein adopts the open
conformation that is less stable then the closed form. It was also found that MPA
had little affinity for the open form of IMPDH II and that binding of MPA followed
IMP or XMP binding. stabilizing the protein even more. They concluded that
localized conformational changes occurred during the reaction of IMPDH and
upon MPA binding. This view is consistent with the study presented here.
Another important study of the events that take place when ligands bind to
IMPDH utilized high-precision titration microcalorimetry (Bruuese and Connelly,
![Page 116: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/116.jpg)
1997). The authors monitored stepwise changes in the enthalpy, entropy. free
energy, and the heat capacity of IMP binding to the hamster IMPDH II tetramer.
This study has revealed allosteric properties of IMPDH II upon IMP and MPA
binding and it presents a therrnodynamic argument that identifies a temperature
dependent change in the heat capacity of binding as a marker of a
conformational equilibrium of distinct structural forms of apo-IMPDH.
The discovery of evidence that indicated allosteric be havior of IMPDH is
new. Bruzzese and Connelly (1 997) introduce data (intrinsic binding constants
and associated enthalpies) that show the first three IMP molecules bind with
equal affinity, but the fourth molecule had significantly weaker binding. With
respect to IMP, this is an example of negative homotropic cooperativity in
IMPDH. The data, however, are inconsistent with the standard models for
allosteric proteins. The two standard models to describe this behavior are the
Monod-Wyman-Changeux (MWC) pre-existing confornational equilibrium model
(Monod et al., 1965) and the Koshland-Nemethy-Fermi (KNF) induced fit model
(Koshland et al., 1966). The MWC model is based on the equilibria between two
macromolecular forms R and T. whereby each form binds a ligand non-
cooperatively but with different affÏnity. The model explicitly states that the two
forms of the protein exist prior to the binding of the ligand. The distinguishing
feature of this model is the temperaturedependence of the heat capacity upon
ligand binding. The temperature-dependence of the heat capacity upon IMP
binding indicated that there appears to be a pre-existing conformational
![Page 117: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/117.jpg)
equilibrium prior to binding. However
homotropic cooperativity, which does
cooperativity seen with IMP binding to
this model can only account for positive
not account for the negative homotropic
MPDH.
The KNF induced fit model (Koshland et al., 1966) states that each
subunit of a multisubunit protein exists in two structural forms based on its
ligation states. Depending on the degree of occupancy of the protein. the
interactions among the binding sites are a consequence of interactions arnong
the subunits that change. The data presented by Bruzzese and Connelly.
however, have ruled out the KNF model. They found that the binding curve
around the median ligand was asymmetric, which is inconsistent with the KNF
mode1 (Wyman and Gill. 1989). As well. the large temperature-dependence of
the heat capacity upon IMP binding indicated that the KNF model is insufficient.
As a consequence, Bruuese and Connelly suggest a nested allosteric
model (Robert et al., 1987 and Connelly et al., 1989 a. b). This is a combination
of the MCW and KNF models. That is, for IMPDH, there are two overall
quarternary conformations (R and T). each form behaving according to the KNF-
like tetramers nested with the two overall conformations of R and T. When IMP
binds to IMPDH, there would be localized negative subunit to subunit interactions
as well as a concerted conformational change involving the whole tetramer.
![Page 118: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/118.jpg)
But how does the structural data reflect what has been found by the
functional data? The lack of order observed for the apo-IMPDH II in the active
site region (active site helix and flap, and the C-terminal tail) suggested that more
than one structural form of the free enzyme existed. The temperature-
dependence of the heat capacity upon IMP binding shows that there are at least
two structural forms of apo-IMPDH, which is consistent with what has been found
by the study herein. The susceptibility of the apo-fom to protoelytic enzymes as
described by Nimmesgern et al (1996) is also consistent with apo-IMPDH having
disordered regions. The ordering of stretches of polypeptide chah upon ligand
binding would decrease the ability of the proteases to act on them. Comparing
the apo-form to the liganded-form, however, has not showed structural evidence
for allosteric behavior as described above. The structural overlays did not show
significant changes in the u/p barre1 fold between the two structures. Although
the resolution obtained for the ternary- and apo-enzyme is insufiicient to account
for any subtle structural changes that may be able to explain these results. As
the active site of IMPDH, however, is close to the monomer-monomer interface,
localized structural changes in one monorner may effect the ligand binding on the
adjacent monomer. Given the tetrameric space group containing only one
monomer in the asymmetric unit, global structural changes of the tetramer cannot
be observed. Therefore, in order to test the global allosteric behavior of IMPDH
by structural studies. the protein structures would have to be solved at a lower
level of symmetry where the whole tetramer was part of the asymrnetric unit and
therefore unrestrained by crystallographic symmetry. Nevertheless, it is clear
![Page 119: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/119.jpg)
that significant conformational changes occur when IMPDH associates with
ligands. at least on a localized scale. Amino acid sequence conservation in
regions with a high amount of flexibility argues for these structural changes being
an integral part of IMPDH activity. not only in the human enzyme. but in general.
4.6 Future work on hurnan IMPDH II
IMPDH has been part of the scientific literature for over 25 years. however. it
has only been recently that its fundamental role as a cell growth modulator has
been fully appreciated. It appears now that IMPDH is the key downstream
modulator of p53-dependant growth regulation (Liu et al.. 1998). acting by
controlling the intracellular levels of guanylates. This makes lM PDH a
particularily attractive target for cancer chernotherapy. As p53 mutation is the
single most common observation in oncogenesis (DeVita et al, 1997; Soussi et
al., 2000; and Calin et al.. 1999). inhibition of IMPDH should effectively stop cell
growth in the absence of p53 function. lnhibiting an enzyme that is highly
expressed in response to cell proliferation would also serve to increase the
therapeutic effectiveness, that is, only targeting the protein responsible for cell
growth.
The most interesting finding recently has been the association of IMPDH with
the pleckstrin homology domain of PKBIAM, a protein kinase involved in signal
transduction (Ingley and Hemmings, 2000). They found that IMPDH is
![Page 120: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/120.jpg)
phosphorylated by PKBlAkt in vitro which leads to the suggestion that PKBlAkt
regulates IMPDH in vivo via phosphorylation. Or. in more general terms, purine
rnetabofism rnay be regulated in part or in whole by phosphorylation. As the
progression of cell from the G1 phase to the S phase is promoted by PKBIAkt
pathway activation (Muise-Helmericks et al., 1998), PKBlAkt rnay activate
IMPDH which in turn prepare the cell to transition to the S phase by increase
GTP pools that are a requirement for signal transduction G-proteins.
The association between this signal transduction protein and IMPDH and its
effect of enhanced enzymatic activity suggests that the flexible nature of IMPOH
rnay be a conserved feature. That is, association with other proteins rnay confer
structural stability to the enzyme, thereby decreasing molecular disorder and
enhancing activity. Possible even providing stability to the highly flexible regions
of the active site helix and fiap. As this enzyme, and its flexible characteristics. is
highly conserved throughout nature, Rexibility appears to be a necessary feature.
Future investigation into the associations between IMPDH and other cellular
molecules rnay show a more pronounced role for IMPDH fiexibility. For example.
a crystal structure of IMPDH complexed with a PH domain containing protein
such as PKBlAkt rnay show enhanced structural stability relative to the free form.
Another consequence of this study is information that can be used for the
design of new inhibitors. The multiple, local conformational changes observed
upon substrate binding rnay be problematic when trying to design ligands that are
![Page 121: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/121.jpg)
substrate mimics. As the u/p barrel core appears to remain conformationally
stable, this study would suggest that ligands should be designed to bind to
regions of the active site that are part of the barrel or other parts of the barrel that
my impead substrate association. As well, finding stable barrel regions that show
sequence heterogeneity with respect to the type 1 isoform may help in the design
of isozyme selective inhibitors.
4.7 Summary
A method was developed to clone human IMPDH II cDNA by PCR from a
cDNA ;.-phage library generated from a cell line that expressed high amounts of
RNA. Following recombination with a cloning plasmid, a simple partial restriction
enzyme digest was done to sub-clone the human IMPDH II coding region into a
bacterial expression plasmid with high efficiency. Milligram quantities of protein
were expressed and purified by a two-step, affinity chromatography protocol with
a high degree of reproducibility. This provided enough protein for the screening
and determination of the conditions to reproducibly grow large, single human
IMPDH II crystals suitable for x-ray diffraction analysis. Synchotron X-ray
radiation was used to obtain a diffraction data set with a maximum usable
resolution of 3.15 A. A hamster IMPDH II atomic model was used as a molecular
replacement search model and a solution was found and applied to obtain an
initial model of human apo-IMPDH II. Multiple cycles of model building and
refinement were employed to solve the human apo-IMPDH II structure.
![Page 122: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/122.jpg)
Analysis of the human apo-IMPDH II model revealed many unique
structural properties. The main core of the enzyme follows an dB barrel fold with
highly flexible regions surrounding the active site. These regions are called the
active site helix and the active site flap. They become ordered in the presence of
ligands such as IMP, XMP, and MPA, while the u/P barrel core rernains rigid
throughout. Functional evidence describing multiple conformational forms of
apo-IMPDH II is consistent with the structural data, although evidence for
allosteric behavior is not. The high degree of amino acid sequence conservation
among species from al1 three kingdoms of life indicated that the flexible character
of the enzyme is a necessary element of IMPDH function. This flexible character
may extend to the sub-domain, as its presence and sequence conservation.
signifies an important role in IMPDH biology, although its exact function is
unknown. The phosphate-binding domain was found to be highly conserved
between IMPDHs and several other proteins that also bind phosphate-containing
molecules. The IMPDH II monomers were found to be related by C4 rotational
symmetry to generate the functional tetramer, and in the crystal, the tetramers
formed on octameric complex.
![Page 123: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/123.jpg)
5. References
Abbott, M. H.; Fo!stein, S. E.; Abbey, H.; Pyeritz, R. E. (1987). Psychiatric manifestations of homocystinuria due to cystathionine beta-synthase deficiency: prevalence, natural history, and relationship to neurologie impairment and vitamin B(6)-responsiveness. Am. J. Med. Genet. 26, 959-969.
Adams. P.D., Pannu, N.S.. Read, R.J.. Brunger, A.J. (1997). Cross-validated maximum likelihood enhances crystallographic refinement. Proc. Natl. Acad. Sci USA 94, 501 8-5023.
Allison. A C . Hovi. T.. Watts, R.W.E.. Webster, A.D.B. (1975). lmmunological observations on patients with the Lesch-Nyhan syndrome, and on the role of de novo purine synthesis in lymphocyte transformation. Lancet 2, 1 179-1 183.
Allison, A.C , Hovi. T.. Watts, R.W.E., Webster, A.D.B. (1 977). The role of de novo purine synthesis in lymphocyte transformation. Ciba Found. Symp. Purine Pyrimidine Metab. 48. 207-223.
Allison, A.C. and Eugai. E.M. (1 993). Immunosuppressive and other effects of mycophenolic acid and an ester prodrug. mycophenolate mofetil. Immunol. Rev. 136, 5-28.
Allison, AC.. Kowalski. W.J.. Muller, C.D.. Eugai. €.M. (1 993). Mechanisms of action of rnycophenolic acid. Ann. N Y Acad. Sci 696, 63-87.
Altschul, S.F.. Madden T.L., Schaffer A.A., Zhang J.. Zhang Z., Miller W., and Liprnan D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograrns. Nucleic Acids Res. 25. 3389-3402.
Anderson, A.C., and Sartorelli. A. (1968). lnosinic acid dehydrogenase of sarcoma 180 cells. J. Biol. Chem. 243, 4762-4768.
Bateman, A. (1997) The structure of a domain common to archaebacteria and the homocystinuria disease protein. Trends Biochem. Sci. 22, 1 2-1 3.
Bishop, J.M. (1987). The molecular genetics of cancer. Science 235. 305.
Bork. P.. Gellerich, J., Groth, H., Hooft, R., and Martin, F. (1995) Divergent evolution of a Plcl - barre1 subclass: Detection of numerous phosphate-binding sites by motif search. Protein Science 4, 268-274.
Brunger, A.J., Kuriyan. J., Karplus, M. (1 987). Crystallographic refinement by rnolecular dynamics. Science 235. 458-460.
![Page 124: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/124.jpg)
Brunger. A. J., Krukowski, A., Erickson. J. (1 990). Slow-cooling protocols for crystallographic refinement by simulated annealing . Acta. Cvst. A46, 585-593.
Brunger. A.J. (1 992). The free R value: a novel statistic quantity for assessing the accuracy of crystal structures. Nature 355, 472-474.
Brunger, A.J., Adams, P.D., Rice, LM. (1997). New applications of simulated annealing in X-ray crystallography and solution NMR. Structure 5, 325-336.
Bruuese, F.J., & Connelly. P.R. (1997) Allosteric properties of inosine monophosphate dehydrogenase revealed through the thermodynamics of binding of inosine 5'-monophosphate and mycophenolic acid. Temperature dependent heat capacity of binding as a signature of ligand-couplcd conformational equilibria. Biochemistry 36, 10428-1 0438.
Burling. F.T. and Goldstein. B.M. (1 989). Prog. Abstr: Am. Crystallogr. Assoc. 17, 49.
Calin G.. Ivan, M.. Stefanescu D. (1999) The difference between p53 mutation frequency in haematological and non- haematological malignancies: possible explanations. Med. Hypotheses 53, 326-328.
Cantor, C.. and Schirnmel. P.R. (1980). "The conformation of biological macromolecules." Freeman, San Fransisco, CA.
Carney. D.N.. Ahluwalia. G.S., Jayaram, H.N., Cooney, D.A.. Johns, D.G. (1985). Relationships between the cytotoxicity of tiazofurin and its metabolism by cultured hurnan lung cancer cells. J. Clin. Invest. 75. 175-182.
Carr, S.F., Papp, E., Wu, J.C., Natsumeda, Y. (1993). Characterization of human type l and type II IMP dehydrogenase. J. Biol. Chem. 268.27286-27290.
Chant. J. and Stowers, L. (1995). GTPase cascades choreographing cellular behavior: movement, morphogenesis, and more. Ce11 81. 1-4.
Cleland. W.W. (1979) Statistical analysis of enzyme kinetic data. Methods Enzymol. Vol. 63, 103-1 37.
Cohen, M.B., and Sadee, W. (1983). Contributions of the depletions of guanine and adenine nucleotides to the toxicity of purine starvation in the mouse T lymphorna cell line. Cancer Res. 43, 1587-1 591.
Cohen, M.B.. Maybaum, J., Sadee, W. (1983). Guanine nucleotide depletion and toxicity in mouse T lymphoma (s-49) cells. J. Biol. Chem. 256, 871 3-8717.
![Page 125: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/125.jpg)
Colby, T.D., Vanderveen, K., Strickler, M.D., Markham, G.D., and Goldstein, B.M. (1999) Crystal structure of human type II inosine monophosphate dehydrogenase: Implications for ligand and drug design. Proc. Natl. Acad. Sci. USA 96, 3531 -3536.
Collart, F.R., Chubb, C.B., Mirkin, B.L., Huberman, E. (1 996). lncresed inosine- 5'-monophosphate dehydrogenase gene expression in solid tumor tissue and tumor ceIl Iines. Cancer Res. 52, 5826-5828.
Collart, F.R., Osipiuk, J., Trent, J., Olsen, G.J., Huberman, E. (1996). Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiousus. Gene 174, 209-21 6.
Collins. S. J., Gallo, R.C., Gallagher, R.E. (1 977) Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature, 270(5635), 347-349.
Connelly, P.R., Johnson, C.R., Robert, CH., Bak, H.J., and Gill. S.J. (1989a) Binding of oxygen and carbon monoxide to the hemocyanin from the spiny lobster. J. Mol. Biol., 207(4), 829-832.
Connelly, P.R., Gill, S.J., Mi1le.r KI., Zhou, G., and van Holde, K.E. (1 989b) ldentical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin. Biochemistry, 28(4), 1835-1 843.
Corpet, F.. Gouzy, J. and Kahn. D. (1998) The ProDom database of protein domain families. Nucleic Acid Res. 26, 323-326.
Dayton, J.S., Turka, L.A., Thompson, C.B., Mitchell. B.S. (1 992). Cornparison of the effects of mizoribine with those of azathioprine, 6-mercaptopurine, and mycophenolic acid on T lymphocyte proliferation and purine ribonucleotide pools. Mol. Phannacol. 41, 671-676.
Dayton, J.S., Lindsten, T., Thompson, C.B., Mitchell, B.S. (1994). Effects of human lymphocyte activation on inosine monophosphate dehydrogenase expression. J. Immunol. 152, 984-991.
Devita, V.T. Jr., Hellman. S., Rosenberg, S.A. (1997) Cancer: Principles & Practice of Oncology, 5'h ~ d .
Dixon, G.J., Dulmadge, E.A., Brockman, R.W., Shaddix. S.C (1 970). Feedback inhibition of purine biosynthesis in adenocarcinorna 755 and sarcoma 180 cells in culture. J.Natl. Cancer Inst. 45, 681 -685.
![Page 126: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/126.jpg)
Doggett, N.A., Callen, D.F., Chen, Z.L., Moore, S., Tesmer, J.G., Duesing, L.A., and Stallings, R.L. (1993). Identification and regional localization of a human IMP dehydrogenase-like locus (IMPDHL 1) at 16p 13.13. Genomics 18, 687-689.
Dowehower, L.A., and Bradley, A. (1993). The tumor suppressor p53. Biochim. Biophys. Acta 1155, 181-205.
Earle, M. and Glazer, R. (1983). Activity and metabolism of 2-P-D- ribofuranosylthiazole-4-carboxamide in human lymphoid tumor cells in culture. Cancer Res. 43, 1 33-1 37.
Eugui, E.M., Almquist, S., Muller, C.D., Ailison, A.C. (1991). Lymphocyte- selective cytostatic and immunosuppressive effects of mycophenolic acid in vitro: role of deoxyguanosine nucleotide depletion. Scand. lmmunol. 33. 161 -1 73.
Fleming, M.A., Chambers. S.P., Connelly, P.R., Nimmesgern. E., Fox, T., Bruuese, F.J., Hoe, S.T., Fulghum, J.R., Livingston, D.J., Stuver. C.M.. Sintchak, M.D.. Wilson, K.P., Thomson, JA. (1996). Inhibition of IMPDH by mycophenolic acid: dissection of fonvard and reverse pathways using capillary electrophoresis. Biochemistry 35, 6990-6997.
Glesne, D.A.. Collart, F.R., Huberman, E. (1991). Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides. Mol. and Cell Bio. 11, 541 7-5425.
Glesne. D.A., Collart, F.R., Varkony, T., Drabkin, H., Huberman, E. (1993) Chromosomal location and structure of the human type II dehydrgenase gene (IMPDH2). Genomics 16, 274-277.
Goldstein, B.M., Takusagawa, F., Berman, H.M., Srivastava,P.C., Robins, R.K. (1983). J. Am. Chem. Soc. 105, 7416-7422.
Goldstein. B.M.. Mao, D.T., Marquez, V.E. (1988). Ara-tiazofurin: conservation of structural feôtures in an unusual thiazole nucleoside. J. Med. Chem. 31. 1026-1 031.
Goldstein, B.M., Bell, J.E., Marquez, V.E. (1990). Dehydrogenase binding by tiazofurin anabolites. J. Med. Chem. 33, 1 123-1 127.
Gosio, B. (1 896). Riv. lgiene Sanita Pubbl. Ann. 7, 825.
Gottlieb, T.M., and Oren, M. (1996) p53 in growth control and neoplasia. Biochim. Biophys. Acta 1287, 77-1 02.
![Page 127: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/127.jpg)
Gu. J.J.. Kaiser-Rogers, K., Rao, K., Mitchell. B.S. (1994). Assignment of the hurnan type I IMP dehydrogenase gene (IMPDH1) to chromosome 7q31.3-q32). Genomics 24. 1 79-1 8 1 .
Gu, J.J., Spychala, J., Mitchell, B.S. (1 997). Regulation of the human inosine 5'- monophosphate dehyrogenase type I gene. J. Biol. Chem. 272,4458-4466.
Guex, N and Peitsch, M.C. (1996) Swiss-PdbViewer: A Fast and Easy-to-use PDB Viewer for Macintosh and PC. Protein Data Bank Quaterly Newsletter 77, 7.
Hagar, P.W., Collart, ER., Huberman, E.. Mitchell, B.S. (1995). Recombinant hurnan inosine monophosphate dehydrogenase type I and type II proteins: purification and characterization of inhibitor binding. Biochem. Pharmacol. 49, 1323-1 329.
Haslam, R.J.. Koide. H.B. and Hemmings. B.A. (1993). Pleckstrin homology domains. Nafure 363, 309-310.
Hedstrom, L., and Wang, W. (1997). Kinetic mechanism of human inosine 5'- monophosphate dehyrogenase type II: random addition of substrates and ordered release of products. Biochemistry 36, 8479-8483.
Henderson. J.F. and Mercer, N.J (1966). Feedback inhibition of purine biosynthesis de novo in rnouse tissues in vivo. Nature 212. 507-508.
Hershfield, M.S. and Seegmiller, J.E (1976). Regulation of de novo purine biosynthesis in human lymphoblasts. Coordinate control of proximal (rate- determining) steps and the inosinic acid branch point. J. Biol. Chem. 251, 7348- 7354.
Hoffee, P.A.. and Jones, M.E., (eds.), 1978. Purine and pyrimidine nucleotide metabolism. Volume 51. Methods of Enzymology. Acedemic Press.
Hollstein, M.. sidransky, D., Vogelstein, B., Harris, C.C. (1991). p53 mutations in human cancers. Science 253.49-53.
Holmes, E., Pehlke, D., Kelley, W. (1974). IMP dehydrogenase: kinetics and reg ulatory properties. Biochim. Biophys. Acta 364, 209-2 1 7.
Huete-Perez, J.A., wu, J.C., Whitby, F.G.. Wang, C.C. (1995). Identification of the IMP binding site in the IMP dehydrogenase from Tritrichmonas foetus. Biochemistry 34, 13889-1 3894.
Hunter, T. (1995). Protein Kinases and phosphotases: the yin and yang of protein phosphorylation and signaling. Cell80, 225-236.
![Page 128: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/128.jpg)
Hurley, J.B.. Simon, M.I., Teplow, D.B.. Robinshaw, J.D., Gilrnan, A.G. (1984). Homologies between signal transducing G-proteins and ras gene products. Science 226, 860.
Ingley, E. and Hemmings, B.A. (2000). PKAIAkt interacts with inosine 5'- monophosphate dehydrogenase through its pleckstrin homology domain. FEBS Letters 478, 253-259.
Ingley, E. and Hemmings, B.A. (1994). Pleckstrin homology (PH) domains in signal transduction. J. Cell. Biochem. 56, 436-443.
Jackson, R.C., Morris, H.P., Weber, G. (1 977). Partial purification, properties, and regulation of inosine 5'-monophosphate dehyrogenase in normal and malignant rat tissues. Biochem. J. 166, 1-10.
Jackson, R.C., and Weber. G. (1975). IMP dehydrogenase: an enzyme linked with proliferation and maglignancy. Nature 256, 331-333.
Jacobson. S.J.. Page, T., Diala, E.S., Nyhan, W.L., Robins, R.K., Mangum, J.H. (1987). Synergistic activity of purine metabolism inhibitors in cultured human tumor cells. Cancer Lett. 35, 97-1 04.
Jones, T.A., Zou, J.Y., Cowan, S.W. and Kjeldgaard, M. (1991) lmproved methods for the building of protein models in electron-density maps and the location of errors in these models. Acta Ciyst. A47, 11 0-1 19.
Kiguchi, K., Collart, F.R., Henning-Chubb, C., Huberman, E. (1990). Cell differentiation and altered IMP dehydrogenase expression induced in human T- lymphoblastoid leukemia cells by mycophenolic acid and tiazofurin. Exp Ce11 Res. 187, 47-53.
Kiguchi, K.. Collart, F.R., Henning-Chubb, C., Huberman, E. (1990). Induction of cell differentiation in melanoma cells by inhibitors of IMP dehydrogenase: altered patterns of IMP dehydrogenase expression and activity. Cell Growth and Differ. 1, 259-270.
Kleywegt, G.J.. Brunger. A.J. (1 996). Checking your imagination: applications of the free R value. Structure 4, 897-904.
Kleywegt, G.J. and Jones, T.A. (1 994). Halloween ... Masks and Bones. ln From the First Map to Final Model. (Bailey, S.. Hubbard, R. and Waller, D., eds.), SERC Daresbury Laboratory, Warrington, U.K., 59-66.
![Page 129: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/129.jpg)
Knight, R.D., Mangum, J., Lucas, D.L.. Cooney, D.A., Khan, E.C., Wright, D.G. (1 987). Inosine monophosphate dehydrogenase and myeloid cell maturation. BIood 69, 634.
Kristensen, T., Voss, H., Schwager, C., Stegemann, J., Sproat, B., Ansorge, W (1988). T7 DNA polymerase in automated dideoxy sequencing. Nucleic Acids Res. 16, 3487-3496.
Konno, Y., Natsumeda, Y.. Nagai, M., Yarnaji, Y., Ohno, S., Suzuki, K., Weber, G. (1991). Expression of human IMP dehydrogenase type I and II in Escheria coli and distribution in human normal lymphocytes and leukemic cell lines. J. Biol. Chem. 266, 506-509.
Koshland, D.E. Jr, Nemethy, G., and Filmer, D. (1966). Comparison of experimental binding data and theoretical rnodels in proteins containing subunits. Biochernistry. 5(1), 365-385.
Kruger, W.D. and Cox, D.R. (1994) A yeast system for expression of human cystathionine beta-synthase: structural and functional conservation of the human and yeast genes. Proc. Natl. Acad. Sci USA 91, 661 4-661 8.
Lee, H.-J., Pawlak, K., Nguyen. B.T., Robins, R.K., Sadee, W. (1985). Biochemical differences among four inosinate deydrogenase inhibitors, mycophenolic acid, ribavirin, tiazofurin, and selenazpfurin. studied in mouse lymphoma cell culture. Cancer Res. 45. 551 2-5520.
Lehninger, A. L. (1 975). Biochemistw, 2nd ed., New York: Worth Publishers.
Levine, A.J. and Momand, J. (1990). Tumor suppresspr genes: the p53 and retinoblastorna sensitivity genes and gene products. Biochim. Biophys. Acta 1032, 1 19-1 36.
Li, H., Hallows. W.H., Punzi, J.S.. Marquez. V.E., Carrell, H L , Pankiewicz, K.W., Watanabe, K.A.,Goldstein, B.M. (1994). Crystallographic studies of two alcohol dehydrogenase-bound analogues of thiazole-4carboxamide adenine dinucleotide (TAO), the active anabolite of the antitumor agent tiazofurin. Biochernistry 33, 23-32.
Lucas, D.L., Webster, H.K., Wright. D.G. (1983). Purine metabolism in rnyeloid precursor cells during maturation. J. Clin. Invest. 72, 1889.
Link, J.O., and Straub, K. (1 996). Trapping of an IMP dehydrogenase-substrate covalent intermediate by mycophenolic acid. J. Am. Chem. Soc. 118. 2091- 2092.
![Page 130: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/130.jpg)
Liu, Y ., Bohn, S.A., Sherley, J.L. (1 998) lnosine 5'-monophosphate dehydrogenase is a rate-detenining factor of p53-dependent growth regulation. Mol. Biol. Cell 9, 1 5-28.
Lui, Y.. Faderan, M.A., Liepnieks. J.J., Natsumeda, Y., Olah. E.. Jayaram, H.N.. Weber, G. (1984). Modulation of IMP dehydrogenaçe activity and guanylate metabolism by tiazofurin (2-p-D-ribofuranosylthiazole-4carboxamine). J. Biol. Chem. 259, 5078-5082.
McMillan, F.M.. Cahoon. M., White, A., Hedstrom, L., Petsko, G.A., Ringe. O. (2000) Crystal structure at 2.4 A resolution of Borelia Burgdorfen inosine 5'- monophosphate dehydrogenase: evidence of a substrate-induced hinged-lid motion by loop 6. Biochernist~ 39, 4533-4542.
Muise-Helmericks, R.C., Grimes, H.L., Bellacosa. A., Malstrom. S.E.. Tsichlis. P.N ., Rosen. N. (1 998). Cyclin D expression is controlled post-transcriptionally via a phosphatidylinositol 3-kinase1Akt-dependent pathway. J. Biol. Chem. 273. 29864-29872.
Nagai, M., Natsumeda. Y., Konno, R.. Hoffman, S., Irino, Weber, G. (1991). Selective-upregulation of type II inosine 5'-monophosphate dehydrogenase messenger RNA expression in human leukemias. Cancer Res. 51, 3886-3890.
Nagai, M., Natsumeda. Y., Weber, G. (1992). Proliferation-linked regulation of type II IMP dehydrogenase gene in human and normal lymphocytes and HL-60 leukemic cells. Cancer Res. 52, 258-261.
Natsumeda. Y. and Carr, S.F. (1993). Human type I and II IMP dehydrogenase as drug targets. Ann. N Y Acad. Sci 696, 88-93.
Natsumeda, Y., Ohno, S., Kawasaki, H., Konno, Y.. Weber. G., Suzuki, K. (1990). Two distict cDNAs for human IMP dehydrogenase. J. Biol. Chem. 265. 5292-5295.
Navaza, J. (1 994). AMoRe: an Automated package for molecular replacement. Acta Crystallography A50, 1 57-1 63.
Nimmesgern, E.. Fox,T., Fleming. M.A.. Thomson, J.A. (1996) Conformational changes and sta bilization of inosine 5'-monop hosphate de hyd rogenase associated with ligand binding and inhibition by mycophenolic acid. J. Biol. Chem. 271, 19421 -1 9427.
Olah, E., Natsumeda. Y., Ikegami. T., Kote, Z.. Horanyi. M., Szelenyi, J., Paulik, E., Kremmer. T.. Hollan, SR.. Sugar, J., Weber. G. (1988). Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K562 leukemia cells. Proc. Natl. Acad. Sci USA 85. 6533-6537.
![Page 131: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/131.jpg)
Olah, E. (1 989). Pattern of oncogene expression in hepatoma cells. In Keppler. D., Bannasch, P., Weber, G. (eds.), Liver Ce11 Carcinoma. MTP Press Ltd. Lancaster, U. K., 423-436.
Olah, E., Kote, 2.. Natsumeda, Y., Yamaji, Y., Jarai, G., Lapis, E., Financsek, I., Weber, G. (1 990). Down-regulation of c-myc and c-Ha-ras gene expression by tiazofurin in rat hepatoma cells. Cancer Biochem. Biophys. 11, 107-1 17.
Otwinowski, Z. (1 993) Oscillation data reduction program. In Proceedings of the CCP4 Study Weekend (Sawyer, L., Isaacs, N. and Bailey, S., eds.), SERC Daresbury Laboratory, Warrington, U.K., 56-62.
Pall, M.L. (1985). GTP: A central regulator of cellular anabolism. Curr. Top. Cell. Regul. 25, 1-20.
Pannu, N.S. and Read, R.J. (1996). lmproved structure refinement through maximum likelihood. Acta. Cwst. A52, 659-668.
Proffitt, R.T., Pathak, V.K., Villacorte, DG., Presant, C.A. (1 983). Sensitive radiochernical assay for inosine 5'-monophosphate dehydrogenase and determination of activity in murine tumor tissue extracts. Cancer Res. 43, 1620- 1623.
Read, A.T. (1986). lmproved fourier coefficients for maps using phases from partial structures with errors. Acta. Cg&. A42, 140-149.
Rice, LM. and Brumger. A.J. ('1994). Torsion angle dynarnics: reduced variable conformational sampling enhances crystallographic structure refinement. Proteins: Stucture, function, and genetics. 19, 277-290.
Robins. R., Srivastava, P.C., Narayanan, V.I., Plowman, J., Paull, K.D. (1982). 2-b-ribofuranosylthiazole-4-carboxamide, a novel potential antitumor agent for lung tumors and metastases. J. Med. Chem. 25, 1 07-1 08.
Robert, C.H., Decker, H., Richey, B., Gill, S.J., and Wyman, J. (1987) Nesting: hierarchies of allosteric interactions. Proc. Nat. Acad. Sci U S A. 84(7), 189% 1895.
Sambrook. J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning - a laboratory manual (2" edition), Cold Spring Harbor Laboratory Press, USA.
Schiering, N., Kabsch, W., Moore, M.J.. Distefano, M.D., Walsh, C.T., Pai, E.F. (1991). Structure of the detoxification catalyst mercuric ion reductase from Bacillus SP. strain RC607. Nature 352, 168-72.
![Page 132: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/132.jpg)
Shaw, L.M., Sollinger, H.W., Halloran, P., Morris, R.E., Yatscoff, R.W., Ransom, J., Tsina, I., Keown, P., Holt, D.W., Lieberman, R., Jaklitsch, A., Potter, J. (1995). Mycophenolate mofetil: A report of the consensus panel. Theraeut. Drug Monitor. 17, 690-699.
Senda, M. and Natsumeda, Y. (1994). Tissue-differential expression of two distict genes for human imp dehydrogenase. Life Sci. 54, 191 7-1 926.
Sherley. J.L. (1991). Guanine nucleotide biosynthesis is regulated by cellular p53 concentrations. J. Biol. Chem. 266, 2481 5-24282.
Sherley, J.L., Stadler, PB., johnson, D.R. (1995). The p53 anti-oncogene induces guanine nucleotide-dependent stem cell division kinetics. Roc. Natl. Acad .Sei USA 92, 136-140.
Sherley. J.L. (1996). The p53 tumor suppressor gene as a regulator of somatic stem cell renewal division. Cope 12, 9-10.
Sidi, Y., Panet, C.. Wasserman, L., Cyjon, A., Novogrodsky, A., Nordenberg, J. (1988). Growth inhibition and induction of phenotypic alterations in MCF-7 breast cancer cells by an IMP dehydrogenase inhibitor. Br. J. Cancer. 58, 61.
Sintchak, M.D.. Fleming, M.A., Futer, O.. Raybuck, S.A., Chambers. S.P., Caron, P.R., Murcko. M.A., Wilson, K.P. (1996). Structure and mechanism of inosine monophosphate dehydrogenase in complex with the immunosuppressent mycophenolic acid. Ce// 85, 921 -930.
Sokiloski, J.A., Blair, O.C.. Sartorelli, A.C. (1986). Alterations in glycoproteinsynthesis and guanosine triphosphate levels associated with the differentiation of HL-60 leukemia cells produced by inhibition of inosine 5'- monophosphate dehydrogenase. Cancer Res. 46,231 4-231 9.
Sollinger, H.W. (1995). Mycophenolate rnofetil for the prevention of acute rejection in primary cadaveric renal allog raft recipients (US Renal Transplant Mycophenolate Mofetil Study Group). Transplantation 60. 225-232.
Soussi, T., Dehouche, K., Beroud, C. (2000) p53 website and analysis of p53 gene mutations in human cancer: forging a link between epiderniology and carcinogenesis. Hum. Mutat 15, 105-1 13.
Stryer, L. (1 988). Biosynthesis of nucleotides. In Biochemistry, 3rd. edii, W.H. Freeman, N.Y., N. Y., 602-626.
Szekeres, T., Cho-chung, Y.S.. Weber, G. (1 992). Action of tiazofurin and 8-CI- CAMP in human colon and pancreatic cancer cells. Cancer Biochem. Biophys. 1 3, 67-74.
![Page 133: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/133.jpg)
Tricot, G.J., Jayaram, H.N., Nichols, C.R., Pennington, K., Lapis, E., Jayaram. H.N., Weber. G., Hoffman, R. (1987). Hematological and biochemical action of tiazofurin in a case of refractory acute myeloid leukemia. Cancer Res. 47, 4988- 4991.
Tricot, G.J.. Jayaram, H.N.. Lapis, E., Natsumeda, Y., Yamada, Y.. Nichols. CR., Kneebone. P., Heerema, N., Weber, G.. Hoffman, R. (1989). Biochemically directed therapy of leukemia with tiazofurin, a selective blocker of inosine 5'-monophosphate dehydrogenase activity. Cancer Res.. 49, 3696- 3701.
Tricot, G.J., Jayaram. H.N.. Weber. G., Hoffman, R. (1 990). Tiazofurin: biological effects and clinical uses. Int. J. Ce11 Cloning 8, 161 -1 70.
Turka. L.A.. Dayton, J., Sinclair. G., Thompson, C.B., Mitchell, B.S. (1991). Guanine ribonucleotide depletion inhibits T cell activation: Mechanism of action of the immunosupressive drug mizobine. J. Clin. Invest. 87, 940-948.
Verham, R., Meek., T.D.. Hedstrom, L.. Wang, C.C. (1978). Purification. characterization, and kinetic anlysis of inosine 5'-monophosphate dehydrogenase of Tritrichomonas foetus. Mol. Biochem. Parasitol. 23, 2727- 2735.
Verham. R., Meek.. T.D.. Hedstrom, L.. Wang, C.C. (1 987). Purification. characterization, and kinetic analysis of inosine 5'-monophosphate dehydrogenase of Tritrichornonas foetus. Mol. Biochem. Parasitol. 24, 1-1 2.
Vitale. M., Zamai, L., Falcieri. E.. Zauli, G., Gobbi, P., Santi, S.. Cinti. C., Weber. G. (1997). IMP dehydrogenase inhibitor, tiazofurin, induces apoptosis in K562 human erthrolcukemia cells. Cytometry 30, 61 -66.
Wang, W. and Hedstrom. L. (1997). Kinetic mechanism of human inosine 5'- monophosphate dehydrogenase type II: random addition of substrates and ordered release of products. Biochemistry 36. 8479-83.
Weber, G. (1977) Enzymology of cancer cells. New England J. Med. 296, 486- 493.
Weber, G. (1983). Biochemical strategy of cancer cells and the design of chemotherapy. Cancer Res. 43, 3466-3492.
Weber. G., Nagai, M., Natsumeda, Y.. Eble, J.N.. Jayaram, H.N.. Paulik. E. (1991). Tiazofurin down-regulates expression of c-Ki-ras in a leukemic patient. Cancer Commun, 3,6 1-66.
![Page 134: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/134.jpg)
Weber, G., Nakamura, H.. Natsumeda, Y.. Szekeres, T., Nagai. M. (1992). Reg ulation of GTP biosynthesis. Advan. Enzyme Regul. 32, 57-69.
Weber, G., Hata, Y., Noemi, P. (1 994). Role of differentiation induction in action of purine antirnetabolites. Phamacy World & Science l6(2): 77-83. Review.
Whitby, F.G., Luecke. H.. Kuhn, P., Somoza, J.R., Huete-Perez,J.A., Phillips, J.D., Hill, C.P.. Fletterick. R.J., Wang, C.C. (1997) Crystal structure of Tritrichomonas foetus inosine-5'-monophosphate dehydrogenase and the enzyme-product com plex. Biochemistv 36, 1 0666-1 0674.
Wu. J .C. (1 994). Perspect. Dmg Discovery Res. 2, 1 84-204.
Wyman, J., and Gill, S.J. (1 990) Binding and linkage, University Science Books, Mill Valley, CA.
Xiang. B., Taylor, J.C., Markham, G.D. (1996). Monovalent cation activation and kinetic mechanism of inosine 5'-monophosphate dehydrogenase. J. Biol. Chem. 271, 1435-1440.
Yalowitz, J.A. and Jayaram, H. N. (2000). Molecular targets of guanine nucleotides in differentiatian, proliferation. and apoptosis. Anticaner Res. 20, 2329-2338.
Yamada. Y., Natsumeda, Y., Weber, G. (1988). Action of the active metabolites of tiazofurin and ribavirin on purified I MP dehydrogenase. Biochemistv 27, 21 93-21 96.
Zhang, R.. Evans. G., Rotella. F.J., Westbrook, E.M.. Beno, D., Huberman. E., Joachimiak, A., Collart. F.R. (1999) Characteristics and crystal structure of bacterial inosine-5'- monophosphate dehydrogenase. Biochemistry 38, 4691- 4700.
Zimmermann, A., Spychala, J., Mitchell, B.S. (1995). Characterization of the human inosine-5'-monophosphate dehydrogenase type II gene. J. Biol. Chem. 270, 6808-6814.
Zimmermann, A., Gu, J.J.. Spychala, J.. Mitchell, B.S. (1996). lnosine monophosphate dehydrogenase expression: transcriptional regulation of the type 1 and type II genes. Adv. Enz. Reg. 36, 75-84.
Zimmermann. A., Wright, K.L., Ing, J.P.Y., Mitchell, B.S. (1 997). Regulation of inosine-5'-monophosphate dehydrogenase type II gene expression in human T cells. J. Biol. Chem. 272, 2291 3-22923.
![Page 135: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/135.jpg)
6. Appendix
6.1. Cloning and protein expression of human IMPDH I cDNA
The cDNA for the human IMPDH I coding region was amplified by PCR
from a human spleen ÀgtlO cDNA libraiy (Collart and Huberman, 1988) by
methods as described in section 2.1 .l. Primer A was 5'-
CCGTTCAGAACTATCTTCAGTGG-3' and primer B was 3'-
GTGGACACCTCAGTTATGGAGG-3'. The primers (A and 8) were
complimentary to the 5'- and 3'-ends of the hurnan IMPDH I coding region.
Figure A l shows the PCR product as visualized on a 1% TAE-agarose gel
stained with 5 pglml ethidium bromide. A product with the predicted size (1700
base pairs) was evident. ?CR products were ligated to the pTZ19R plasrnid as
described in section 2.2.1. Positive recombinants were sequenced and al1 were
found to contain a 13-bp insertion mutation. This was removed by in vitro
deletion mutagenesis using the sculptorTM in vitro mutagenesis system from
Amersharn Life Science. It was not known why the gene contained an insertion
mutation. There has been, however, a reported case of human IMPDH I-like
pseudo-gene. Doggett et al., 1993 identified an IMPDH-like locus on
chromosome 16. The locus is most similar to IMPDH 1, but is sufficiently
diverged from both IMPDH I and II, implying a new gene called IMPDHLI. Within
the gene there is an intron and frame shift mutations which suggest an
unprocessed pseudo-gene.
![Page 136: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/136.jpg)
Figure A i . PCR amplification of human IMPOH I cDNA. Visualized on a 1% TEA-agarose gel, stained with 5 mg/ml ethiduim bromide. Lane 1: h Hind III markers (500 ng), lane 2: PCR product sample (20 ~d), lane 3: h BstE II rnarkers (500 ng) (bp, base pairs).
Figure A 2 Expression analysis of pET2la-human IMPOH I recombinants. 12% SDS-PAGE gel with 20 pl samples from th? expression of pET2la-hurnan IMPDH I recombinants in E. coli EL21 (DE3). Lane 1 : Molecular weight markers (1 2 pg), lane 2: pSE420-HIMPDH II induced, lane 3 - 8: induced positive transformants (pET2la-HIMPDH I inBL21 (DE3) cells) samples #l-6, lane 9: induced pET2la in BL21 (DE3) cells only, lane 10: Molecular weight rnarkers (12 pg).
![Page 137: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/137.jpg)
The insertion in IMPDH I as reported here, though, was amplified by PCR from a
cDNA library which in turn originated from transcribed mRNA.
The pTZ19R-HIMPDH l (wild-type) plasrnid was then digested with the
restriction enzymes Bfa I and Hind III and the resulting fragment was ligated into
a pET2la plasmid digested with Nde I and Hind III. The ligation mixture was
transfomed in to E. coli BL2 1 (DE3). Transforrned bacte ria were tested for
expression of IMPDH I as in section 2.1.3. The results are shown in Figure A2.
Most samples showed evidence of IMPDH I expression.
Samples showing expression were selected and grown in large quantities
as described in section 2.2.1. The cells were lysed and tested for IMPDH activity.
The soluble cell lysate was applied to a heparin-650M column. Fractions that
contained human IMPDH 1 were applied to an SOS-PAGE gel as shown in Figure
A4. None of the fractions from the heparin-650M column showed IMPDH
activity. As well, the soluble part of the cell extract did not show IMPDH activity.
The insoluble part of the cell lysate was dissolved in an 8.OM urea solution and
both fractions were applied to a SDS-PAGE gel (figure A3). A protein that CO-
migrated with the expressed human IMPDH I was observed in the insoluble part
of the cell lysate but not in the soluble part of the cell lysate. These results
indicated that the expressed human IMPDH I was insoluble in the aqueous
media that was used (despite containing 10% urea) and appeared to be in the
inclusion bodies of the bacterial cell.
![Page 138: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/138.jpg)
Figure A3. Analysis of pET2la-HIMPDH I - BL21 (DE3) cell iysis. 12% SOS-PAGE gel. Lane 1: Molecular weight markers (1 2 ug). lane 2: induced pET2l a-HIMPDH I inBL2l (DE3) cells (50 big). lane 3: soluble cell extract (20 pg). lane 4: insoluble cell extract (5 ug). lane 5: insoluble cell extract (50 ~ g )
Figure A4. Analysis of heparin45OM column fractions. 12% SDSPAGE gel. Lane 1: induced pET2la-HIMPDH 1 inBL2l (DE3) cells (50 pg). lane 2: soluble cell extract (50 pg). lane 3-1 1 : fractions 52, 54, 56. 60, 62. 64, 66, 68, resp.. lane 12: Molecular weight markers (12 pg).
![Page 139: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/139.jpg)
As work on the hurnan IMPDH II was successful, this line of enquiry was
terminated.
6.2. Crystallization of the IMPlMPA complexed IMPDH II.
Human IMPDH II was complexed with IMP and MPA as described with the
hamster IMPDH II (Fleming et al., 1996). Crystals were grown in the same
conditions as with apo-IMPDH II. Crystals were mounted at room temperature
and under cryo-conditions as described for human apo-IMPDH II. Hexagonally
shaped crystals were grown (Figure A5). Upon exposure to x-ray radiation, the
large crystals (0.2 mm X 0.3 mm X 0.3 mm) showed no appreciable diffraction at
room temperature or under cryo-conditions. Michael Sintchak from Vertex
Pharmaceuticals Inc. reported (personal communication) that there was a
hexagonal shaped crystal form of human IMPDH II that showed very little
diffraction and had a unit cell with dimensions greater than 300 A and a
câ~culated 48 IMPDH tetramers in the unit cell. The type of crystal grown here
may correspond to this type of crystal form.
![Page 140: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/140.jpg)
Figure A5. Crystats of human IMPDH II complexed with MPA and IMP. Photograph of human IMPDH II crystals with MPA and IMP ( 2 0 0 ~ X 200p X 1 0 0 ~ ) grown by hanging drop vapor diffusion with a well solution containing 0.1 M MES, pH 5.8, 10% PEG 4000, 1.0 M LiCI, 40 mM PME. 2% MPyD. 4 pl of protein (dissolved in 10 mM TRISICI, pH 8.0, 0.3 M KCI, 10% glycerol, 1 mM EDTA. 2 mM PME at 20 mglml) was mixed with 2 pl of well solution and incubated at 23'C for 4 to 6 weeks.
6.3. Expression. purification. and crystallization of E. coli IMPDH.
Recombinant E. coli IMPDH was cloned by Michael Wittmer (M.D. thesis.
1987 University of Heidelberg) from the Max Plank Institute for Medical Research
in Heidelberg, Germany. lt was supplied as a LBlAgar via1 stabbed with Ecoli
MRE5059 cells containing a pBR322 plasmid with the E.coli IMPDH gene
(guaB). Cells were grown in 2XYT overnight to obtain a seed stock culture.
Cells were added to fresh media at 10% vlv and grown for 3.5 hours at 37OC.
The cells were collected by centrifugation and resuspended in a buffer containing
20 mM TRlSlHCl (pH 8.0). 3 mM EDTA, 10% glycerol plus 1 mM PMSF. 1 uglml
pepstatin, 1 uglml leupeptin, 0.1 mglml lysozyme, and 0.1 mg/ml DNase. The
![Page 141: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/141.jpg)
cells were lysed and cleared by centrifugation. Solid ammonium sulfate was
added to the soluble cell extract to 38% saturation at O°C. The suspension was
stirred on ice for 30 minutes and the precipitate was collected by centrifugation.
The precipitate was dissolved in a buffer containing 20 mM sodium phosphate
buffer (pH 6.8) with 2 mM DTT and the solution was applied to a
diethylaminoethyl (DEA€)-sepharose column (100 ml) equilibrated with the
same buffer solution. The column was washed with pure buffer and then with
buffer containing 150 mM NaCI. The proteins were eluted with an NaCl gradient
from 150 mM to 350 mM. Fractions containing IMPDH actvity were pooled.
concentrated by ammonium sulfate precipitation and dissolved in a buffer
containing 10 mM TRlSlHCl (pH 8.0). 3 rnM EDTA. 10 mM KCI. 2 mM DTT. and
20% glycerol. The solution was applied to an adenosine 5'-monophosphate
(AMP)-agarose column (30ml) equilibrated with the same buffer. The column
was washed and the protein was eluted with buffer containing 20 rnM AMP.
Fractions with IMPDH activity were pooled, concentrated by ammonium sulfate
precipitation and dialyzed against a solution containing the above buffer and
stored at -70°C in aliquots. Samples frorn the purification were analyzed by
SDS-PAGE gel as viewed in Figure A6.
Aliquots were thawed on ice and dialyzed against 10 mM TRISJHCI (pH
8.0). 10 rnM KCI. and 2 mM DTT at 4OC. The concentration of enzyme was
adjusted to 8.0 mglml. 2 pl of protein solution was added to 2 pl of a reservior
solution containing 100 mM citratelHC1 (pH 5.6-6.0). 10-1 2% t-amyl-alcohol, 10%
![Page 142: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/142.jpg)
PEG 1000 (wlv) and 4 mM D m . The drop was incubated above 1.0 ml of
resewoir solution for 3 to 4 weeks. Crystals were mounted at 4OC. Crystals were
exposed to an X-ray beam on beamline BL6A at the Photon Factory Synchrotron
in Tsukuta. Japan.
Figure A7 shows a picture of hexagonally shaped E. coli apo-IMPDH
crystal. A large crystal (0.25 mm X 0.30 mm X 0.35 mm) was mounted and
exposed to x-rays. The reflections observed were weak and they extended to a
maximum resolution of approximately 7 A. This crystal form may also be related
to the type grown for human IMPDH II complexed with IMP and MPA.
![Page 143: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing](https://reader031.vdocuments.net/reader031/viewer/2022022606/5b8183067f8b9ae47b8c7960/html5/thumbnails/143.jpg)
-9 + E. coli IMPDH 43000 Da
Figure A6. Analysis of the purification of E coli IMPDH. 12% SDS-PAGE gel. Lane 1: Molecutar weight markers (30 ug), lane 2: soluble cell extract (40 pg), lane 3: redissolved ammonium sulfate pellet (20 ug), lane 4: pooled fractions following the DEAE-sepharose column (12 ug), lane 5: pooled fractions following the AM?-agarose column (10 pg).
Figure A7. An E. coli IMPDH crystal (300~ X 200p X 200~). The protein was dissolved at 8.0 mglml in 10 mM TRlSlHCl (pH 8.0). 10 mM KCI. and 2 mM DTT at 4OC. 2 pl of protein solution was added to 2 pl of a reservoir solution containing 100 mM citratdHC1 (pH 56-60), 10% t-amyl- alcohol, 10% PEG 1000 (wlv) and 4 rnM DlT. The drop was incubated above 1 .O ml of reservoir solution for 3 to 4 weeks at 23'C.