Transcript
Page 1: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Human Genome Project

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 2: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Human Genome Project Began in

1990

• The Mission of the HGP: The quest to

understand the human genome and the role it

plays in both health and disease.

“The true payoff from the HGP will be the ability to

better diagnose, treat, and prevent disease.” --- Francis Collins, Director of the HGP and the National Human

Genome Research Institute (NHGRI)

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 3: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The genome is our Genetic Blueprint

• Nearly every human cell contains 23 pairs of chromosomes

– 1 - 22 and XY or XX

• XY = Male

• XX = Female

• Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 4: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Genome is

Who We Are on the inside!

• Chromosomes consist of DNA

– molecular strings of A, C, G, & T

– base pairs, A-T, C-G

• Genes

– DNA sequences that encode proteins

– less than 3% of human genome

Information coded

in DNA

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 5: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

Until the early 1970’s, DNA was the most difficult

cellular molecule for biochemists to analyze.

DNA is now the easiest molecule to analyze –

we can now isolate a specific region of the

genome, produce a virtually unlimited

number of copies of it, and determine its

nucleotide sequence overnight.

Molecular Biology Of The Cell. Alberts et al. 491-495

The Human Genome Project

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 6: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Beginning of the Project

• Most the first 10 years of the project were

spent improving the technology to sequence

and analyze DNA.

• Scientists all around the world worked to make

detailed maps of our chromosomes and

sequence model organisms, like worm, fruit fly,

and mouse.

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 7: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

At the height of the Human Genome Project,

sequencing factories were generating DNA

sequences at a rate of 1000 nucleotides per

second 24/7.

Technical breakthroughs that allowed the

Human Genome Project to be completed

have had an enormous impact on all of

biology…..

Molecular Biology Of The Cell. Alberts et al. 491-495

The Human Genome Project

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 8: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Challenges were Overwhelming

• First there was the AssemblyThe DNA sequence is so long that no technology can read it all at once, so it was broken into pieces.

There were millions of clones(small sequence fragments).

The assembly process included finding where the pieces overlapped in order to put the draft together.

3,200,000 piece puzzle

anyone?

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 9: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

Goals:■ identify all the approximate 30,000 genes in human DNA,

■ determine the sequences of the 3 billion chemical base pairs that make up human

DNA,

■ store this information in databases,

■ improve tools for data analysis,

■ transfer related technologies to the private sector, and

■ address the ethical, legal, and social issues (ELSI) that may arise from the project.

Milestones:■ 1990: Project initiated as joint effort of U.S. Department of Energy and the National

Institutes of Health

■ June 2000: Completion of a working draft of the entire human genome (covers >90%

of the genome to a depth of 3-4x redundant sequence)

■ February 2001: Analyses of the working draft are published

■ April 2003: HGP sequencing is completed and Project is declared finished two years

ahead of schedule

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

http://doegenomes.org

http://www.sanger.ac.uk/HGP/overview.shtml

The Human Genome Project

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 10: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

UCSC put the human genome

sequence on the web July 7, 2000

UCSC put the

human genome

sequence on CD in

October 2000, with

varying results

Cyber geeks

Searched

for hidden

Messages,

and

“GATTACA”

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 11: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Completion of the Human

Genome Sequence• June 2000 White House

announcement that the majority of the human genome (80%) had been sequenced (working draft).

• Working draft made available on the web July 2000 at genome.ucsc.edu.

• Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature.

• Completion of 99.99% of the genome as finished sequence on July 2003.

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 12: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human genome

sequence tell us?

By the Numbers

• The human genome contains 3 billion chemical nucleotide bases (A, C, T, and G).

• The average gene consists of 3000 bases, but sizes vary greatly, with the largest

known human gene being dystrophin at 2.5 million bases. Smallest is tRNA gene at

76bp!

• The total number of genes is estimated at around 30,000--much lower than

previous estimates of 80,000 to 140,000.

• Almost all (99.9%) nucleotide bases are exactly the same in all people.

• The functions are unknown for over 50% of discovered genes.

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 13: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human

genome sequence tell us?

How It's Arranged

• The human genome's gene-dense "urban centers" are predominantly composed of

the DNA building blocks G and C.

• In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T.

GC- and AT-rich regions usually can be seen through a microscope as light and dark

bands on chromosomes.

• Genes appear to be concentrated in random areas along the genome, with vast

expanses of noncoding DNA between.

• Stretches of up to 30,000 C and G bases repeating over and over often occur

adjacent to gene-rich areas, forming a barrier between the genes and the "junk

DNA." These CpG islands are believed to help regulate gene activity.

• Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest

(231).

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 14: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The human genome

How It's Arranged

• The human genome's gene-dense "urban

centers" are predominantly composed of

the DNA building blocks G and C.

• In contrast, the gene-poor "deserts" are

rich in the DNA building blocks A and T.

GC- and AT-rich regions usually can be

seen through a microscope as light and

dark bands on chromosomes.

• Genes appear to be concentrated in

random areas along the genome, with vast

expanses of noncoding DNA between.

• Stretches of up to 30,000 C and G bases

repeating over and over often occur

adjacent to gene-rich areas, forming a

barrier between the genes and the "junk

DNA." These CpG islands are believed to

help regulate gene activity.

• Chromosome 1 has the most genes

(2968), and the Y chromosome has the

fewest (231).U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 15: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human

genome sequence tell us?

The Wheat from the Chaff

• Less than 2% of the genome codes for proteins.

• Repeated sequences that do not code for proteins ("junk DNA") make up at least

50% of the human genome.

• Repetitive sequences are thought to have no direct functions, but they shed light

on chromosome structure and dynamics. Over time, these repeats reshape the

genome by rearranging it, creating entirely new genes, and modifying and

reshuffling existing genes.

• The human genome has a much greater portion (50%) of repeat sequences than

the mustard weed (11%), the worm (7%), and the fly (3%).

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 16: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human

genome sequence tell us?

How the Human Compares with Other Organisms• Unlike the human's seemingly random distribution of gene-rich areas, many other

organisms' genomes are more uniform, with genes evenly spaced throughout.

• Humans have on average three times as many kinds of proteins as the fly or worm

because of mRNA transcript "alternative splicing" and chemical modifications to the

proteins. This process can yield different protein products from the same gene.

• Humans share most of the same protein families with worms, flies, and plants; but the

number of gene family members has expanded in humans, especially in proteins

involved in development and immunity.

• Although humans appear to have stopped accumulating repeated DNA over 50 million

years ago, there seems to be no such decline in rodents. This may account for some of

the fundamental differences between hominids and rodents, although gene estimates

are similar in these species. Scientists have proposed many theories to explain

evolutionary contrasts between humans and other organisms, including those of life

span, litter sizes, inbreeding, and genetic drift.

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 17: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human

genome sequence tell us?

Variations and Mutations• Scientists have identified about 3 million locations where single-base DNA differences

(SNPs) occur in humans. This information promises to revolutionize the processes of

finding chromosomal locations for disease-associated sequences and tracing human

history.

• The ratio of germline (sperm or egg cell) mutations is 2:1 in males vs females.

Researchers point to several reasons for the higher mutation rate in the male germline,

including the greater number of cell divisions required for sperm formation than for eggs.

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 18: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human genome

sequence tell us?

Led to the discovery of whole new classes of

proteins and genes, while revealing that many

proteins have been much more highly

conserved in evolution than had been

suspected.

Provided new tools for determining the functions

of proteins and of individual domains within

proteins, revealing a host of unexpected

relationships between them.

Molecular Biology Of The Cell. Alberts et al. 491-495

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 19: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What does the draft human genome

sequence tell us?

By making large amounts of protein

available, it has yielded an efficient way to

mass produce protein hormones and

vaccines

Dissection of regulatory genes has provided

an important tool for unraveling the complex

regulatory networks by which eukaryotic

gene expression is controlled.

Molecular Biology Of The Cell. Alberts et al. 491-495

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 20: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Project is not Done…

• Next there is the Annotation:

The sequence is like a topographical map, the

annotation would include cities, towns,

schools, libraries and coffee shops!

So, where are the genes?

How do genes work?

And, how do scientists use

this information for scientific

understanding and to

benefit us?

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 21: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

What do genes do anyway?

• We only have ~19,000 genes, so that means that

each gene has to do a lot.

• Genes make proteins that make up nearly all we are

(muscles, hair, eyes).

• Almost everything that happens in our bodies

happens because of proteins (walking, digestion,

fighting disease).

Eye Color and Hair Color

are determined by genes

OROR

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 22: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

Of Mice and Men:

It’s all in the genes

Humans and Mice have about the same number of genes. But we are so different from each other, how is this possible?

One human gene can make many different proteins while a mouse gene can only make a few!

Did you say

cheese?

Mmm,

Cheese!

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 23: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

Genes are important

• By selecting different pieces of a gene, your

body can make many kinds of proteins. (This

process is called alternative splicing.)

• If a gene is “expressed” that means it is turned

on and it will make proteins.

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 24: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The UCSC Genome Browser

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 25: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The browser takes you from early

maps of the genome . . .

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 26: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

. . . to a multi-resolution view . . .

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 27: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

. . . at the gene cluster level . . .Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 28: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

. . . the single gene level . . .Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 29: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

. . . the single exon level . . .Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 30: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

. . . and at the single base level

caggcggactcagtggatctggccagctgtgacttgacaag

caggcggactcagtggatctagccagctgtgacttgacaag

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com

Page 31: The Human Genome Project - studiestoday.com...The Human Genome Project Began in 1990 • The Mission of the HGP: The quest to understand the human genome and the role it plays in both

The Continuing Project

• Finding the complete set of genes and annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally and computationally about its function.

• Proteomics is studying the structure and function of groups of proteins. Proteins are really important, but we don’t really understand how they work.

• Comparative Genomics is the process of comparing different genomes in order to better understand what they do and how they work. Like comparing humans, chimpanzees, and mice that are all mammals but all very different.

Downloaded from www.studiestoday.com

Downloaded from www.studiestoday.com


Top Related