Vol. 10, No. 2MOLECULAR AND CELLULAR BIOLOGY, Feb. 1990, p. 653-6610270-7306/90/020653-09$02.00/0Copyright C) 1990, American Society for Microbiology

Transcription Initiation from the Dihydrofolate Reductase PromoterIs Positioned by HIPI Binding at the Initiation Site

ANNA L. MEANS AND PEGGY J. FARNHAM*McArdle Laboratory for Cancer Research, University of Wisconsin, 1400 University Avenue, Madison, Wisconsin 53706

Received 30 August 1989/Accepted 31 October 1989

We have identified a sequence element that specifies the position of transcription initiation for thedihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II toinitiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductasepromoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we haveshown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductaseinitiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it wasplaced on either side of the DNA helix, suggesting that there is no strict spatial requirement between theinitiator and an upstream element. Although neither a single Spl-binding site nor a single initiator element wassufficient for transcriptional activity, the combination of one Spl-binding site and the dihydrofolate reductaseinitiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. Wehave also shown that the simian virus 40 late major initiation site has striking sequence homology to thedihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examinationof the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that isimportant in the transcription of other housekeeping genes. We have thus named the protein that binds to theinitiator element HIP1 (Housekeeping Initiator Protein 1).

Interactions between transcription factors and specificDNA sequences within an RNA polymerase II promoter canbe grouped into two categories, depending upon how theyinfluence transcription. One class of factors, usually bindingat least 50 base pairs (bp) upstream of the initiation site,regulates the efficiency of transcription, presumably byaltering the rate or conformation of polymerase attachment.Examples of this class of factors are Spl (6, 26), Apl (1, 28),and Ap2 (24, 35). Deletion of binding sites for these factorsresults in a gradual reduction in transcriptional activity untilall such sites are removed. The second class of transcriptionfactors specifies the site of initiation. The only previouslycharacterized transcription factor known to influence the siteof initiation is TFIID, a protein that binds to an A+T-richsequence called a TATA box and directs RNA polymerase IIto start transcription approximately 30 bp downstream (5,39). Deletion of the TATA box can result in spuriousinitiations and a low level of transcription (5). However, notevery gene contains a TFIID consensus sequence at thecorrect distance upstream of the transcription initiation site.In particular, many cellular genes that are expressed at lowlevels and encode proteins found in all cell types (so-calledhousekeeping genes) do not have a TFIID consensus se-quence.One example is the dihydrofolate reductase (DHFR) gene.

The DHFR gene is expressed throughout the cell cycle inproliferating cells, but its transcription rate increases seven-fold at the G1-S phase boundary (17). We wish to understandthe mechanism of this regulation and to characterize thefactors required for the transcription of DHFR and otherhousekeeping genes. Toward this goal, we have identifiedDHFR promoter deletions that define the 5' and 3' bound-aries of the region that is absolutely required for DHFRtranscription. We refer to the region defined by these dele-tions, containing nucleotides -65 to +15, as the DHFR

* Corresponding author.

minimal promoter. We have examined the DNA-proteininteractions in this minimal promoter; we found that aprotein binds to the transcription initiation site of the DHFRgene and specifies the site of initiation, and that binding ofthis factor and Spl are sufficient for accurate transcriptioninitiation.

MATERIALS AND METHODSCells and extract. HeLa cells were grown in alpha minimal

essential medium plus 5% supplemented calf serum (Hy-clone) to a density of 2 x 105 to 5 x 105 cells per ml. Nuclearextracts (14) were made from approximately 109 cells eitheron the day of cell harvest or from frozen cells (3).

Construction of plasmids. Plasmids containing sequencesfrom the murine DHFR gene are pST410, pBSprol8,pDFX120, pBSprol9, pDMM285, and pSR320 containingDHFR nucleotides -356 to +61, -50 to +52, -65 to +52,-87 to +52, -270 to +15, and -356 to -30, respectively.pST410 was created by insertion of a SmaI-TaqI fragment(nucleotides -356 to +61) into the SmaI and AccI sites ofpUC9. pBSprol8 and pBSprol9 were created by insertion ofEcoRI-XbaI fragments from pdprol8 (31) and pdprol9 (31)into the EcoRI and XbaI sites of pBSM13+ (StratageneInc.). pDMM285 was created by insertion of a MaeI frag-ment (nucleotides -270 to + 15) into the SmaI site of pUC9.pSR320 was created by insertion of a PvuII-RsaI fragment(which includes DHFR sequences from -356 to -30, as wellas vector DNA) from pSS625 (17) into the SmaI site ofpUC9. pDFX120 was created by insertion of a FokI-XbaIfragment from pBSprol9 into pBSM13-. Note that, unlikeprevious papers in which the translation start codon wasnumbered + 1, numbering is relative to the transcription startsite at +1 (the position of the translation start codon is now+56). pSVS contains the entire simian virus 40 (SV40)genome (19). pGemHindIII-C consists of the HindIIIC frag-ment of SV40 inserted into the HindIII site of pGemZF andwas a gift from the laboratory of J. E. Mertz.

653

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

654 MEANS AND FARNHAM

pSVSN contains the SphI-NaeI fragment from pSVS(nucleotides 200 to 345) cloned into pBSM13- at the SphIand SmaI sites. pST410mp19 contains the EcoRI-HindIIIfragment of pST410 cloned into the corresponding sites ofM13mp19. pSTUmpl9 was derived from pST410mp19 bysite-directed mutagenesis with the Bio-Rad Muta-Gene invitro mutagenesis kit and contains a single-base-pair substi-tution at nucleotide -17 which changes the G of the codingstrand to a C, thereby creating a StuI restriction site.pSTUmpl9 was cut with Stul, and 10- or 14-bp linkers wereinserted. pSTU+lOmpl9 contains one copy of the XhoIlinker 5'-CCCTCGAGGG-3'. pSTU+14mpl9 contains oneXbaI linker 5'-CTAGTCTAGACTAG-3'; pSTU+28mpl9contains two XbaI linkers. pGC was constructed by insertingthe Spl-binding-site oligonucleotide

5'-GATCGGGGCGGGGC-3'3'-CCCCGCCCCGCTAG-5'

into the BamHI site of pUC19. pGCDI was constructed frompGC by inserting the DHFR initiation site oligonucleotide

5'-AATTCATTTCGCGCCAAACTTGACG-3'3 LGTAAAGCGCGGTTTGAACTGCTTAA-5'

into the EcoRI site, digesting with XmaI, removing the 5'overhang with mung bean nuclease, and inserting the 14-bpXbaI linker shown above. Thus, pGCDI contains an Spl-binding site and the DHFR initiation site separated by 37 bpof polylinker sequence (see Fig. 3C).

In vitro transcriptions. Templates for in vitro transcrip-tions were prepared as follows: pST410 (-356 to +61),pBSprol9 (-87 to +52), pBSprol8 (-50 to +52), pDFX120(-65 to +52), pDMM285 (-270 to + 15), pSTUmpl9,pSTU+ lOmpl9, pSTU+ 14mpl9, and pSTU+28mpl9 werecleaved with PvuII; pST410 (-258 to +61) was cleaved withNotI and PvuII; pSR320 (-356 to -30) was cleavedwith HaeII; pSVS was cleaved with SphI and NdeI;pGemHindIII-C was cleaved with HindIlI; pGC and pGCDIwere cleaved with HindIII and NdeI. The promoter-con-taining fragments were all isolated by polyacrylamide gelelectrophoresis followed by electroelution.

In vitro transcription reactions (final volume, 25 ,ul) wereperformed as described previously (18), with modificationsfor primer extension analysis or oligonucleotide competi-tion. For analysis by primer extension, 5 nM DNA wasincubated for 15 min at 24°C with 2.4 ,ug of nuclear extractper ,u in 6 mM MgCl2-24 mM Tris hydrochloride (pH7.4)-12% (vol/vol) glycerol-60 mM KCl-.12 mM EDTA-0.3mM dithiothreitol-0.12 mM phenylmethylsulfonyl fluoride.Nucleoside triphosphates were then added to final concen-trations of 600 ,uM GTP, CTP, and UTP and 200 ,uM ATP.After an additional 15 min at 24°C, the reactions werestopped, and the products were extracted and precipitated(18). The precipitates were suspended in 10 RI containing 100fmol of 32P-end-labeled primer (29), 0.5 M NaCl, 10 mM Tris(pH 7.5), and 5 mM EDTA. This mixture was heated at 85°Cfor 5 min and then incubated at 60°C for 60 min. Then 40 RIcontaining 10 U of avian myeloblastosis virus reverse tran-scriptase (Life Sciences, Inc.), 20 U of RNasin (PromegaBiotech), 10 mM MgCl2, 12.5 mM dithiothreitol, 1.25 mMeach deoxynucleoside triphosphate, and 12.5 mM Tris (pH8.5) was added, and incubation was continued for 45 min at42°C. The reactions were stopped by addition of 50 RI of 1%sodium dodecyl sulfate (wt/vol) and 20 mM NaCl, precip-itated with ethanol, and loaded onto an 8 M urea-8%polyacrylamide gel. The primer used for Fig. 3A anneals to

pUC19 nucleotides 455 to 479, and the primer used for Fig.3B anneals to pUC19 nucleotides 358 to 375.

If oligonucleotide competition was performed, concate-merized oligonucleotides were added 5 min prior to additionof the promoter-bearing fragment. The DHFR initiation siteoligonucleotides used for competition are concatemers of thesequence

5'-AATTCTGCGATTTCGCGCCAAACTTGACG-3'3LGACGCTAAAGCGCGGTTTGAACTGCTTAA-5'.

DNase I protection assays. DHFR coding strands frompBSprol8 and pBSprol9 were phosphorylated at the EcoRIsite with T4 polynucleotide kinase and [-y-32P]ATP. A sub-sequent digestion with SphI yielded 171- and 210-bp frag-ments, respectively. The noncoding strand of pBSprol8 wasphosphorylated similarly at the Sail site. Subsequent diges-tion with EcoRI produced a 195-bp band. The pSVSN codingstrand was phosphorylated at the HindIII site, and subse-quent digestion with NdeI produced a fragment 886 bp inlength. These fragments were isolated by polyacrylamide gelelectrophoresis followed by elution in an Elutrap (Schleicher& Schuell, Inc.). The pSVSN noncoding strand was labeledby isolating the 165-bp HindIII-SacI fragment and filling inthe 5' overhang with the Klenow fragment ofDNA polymer-ase and [a-32P]dATP. All phosphorylating reactions wereperformed as described previously (29).DNase I footprinting reaction mixtures contained 60 ,ug of

nuclear extract, 1 ng of 32P-labeled DNA, 3 ,ug of poly(dI-dC-poly(dI-dC) or poly(dA-dT)-poly(dA-dT), 24 mM Tris(pH 7.4), 12% (vol/vol) glycerol, 60 mM KC1, 1.2 mMEDTA, 0.3 mM dithiothreitol, and 6 mM MgCl2, in a totalvolume of 20 ,ul. The reactions were incubated for 10 min at24°C. DNase I (0.25 to 2 ,ug) was then added, and thesamples were returned to 24°C for another 60 s. The reac-tions were immediately terminated by the addition of 4 jl of0.25 M EDTA-1% sodium dodecyl sulfate (wt/vol), dilutedto 75 RI, phenol extracted, and ethanol precipitated. Elec-trophoresis was carried out on an 8 M urea-6% or 8%polyacrylamide gel.

RESULTS

Delimitation of the DHFR minimal promoter region. Thepromoter region of the DHFR gene does not contain theCCAAT or TATA boxes that are commonly used as RNApolymerase II transcription initiation signals (31). Instead,the region directly upstream of the transcription initiationsite consists of four copies of a 48-bp repeat, each of whichcontains a GC box that binds the transcription factor Spl(15). We have developed an in vitro transcription system forthe DHFR promoter by using HeLa cell nuclear extract (18)and have now used this system to define the minimal regionofgenomic DNA necessary for accurate DHFR transcriptioninitiation (Fig. 1). We had previously shown that a templatewith a 5' end extending to -87 retained transcriptionalactivity (18) but that a 5' deletion to nucleotide -50 inacti-vated the DHFR promoter. A template extending to nucle-otide -65 is also active, as compared with the templateextending to nucleotide -50, which does not support initia-tion from the DHFR start site (Fig. 1). These results corre-spond well to results of deletion studies of the hamsterDHFR gene that found that the 5' limit of the hamsterpromoter was 48 bp 5' of the major transcription start site(10). The DHFR templates used in previous studies extendedseveral hundred base pairs downstream of the transcriptioninitiation site. We have now compared 3' promoter deletions

MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

POSITIONING OF TRANSCRIPTION INITIATION 655

I.:, L,~

(- L,. _z

L:-

c-sL+- + + - .

L- t- la L. CZNaSjW11

ci. cilI6

- 823

- 673552

444

- 369

-311

- 249

BFar opposite strand RNA

.690.-

Near opposite strand RNA-1:Lrl -192* -.

_ _ __I

" -s-----+6a

DHFR start site+

invibt,

_,s

50 _15_-

-30h

FIG. 1. Delimitation of the DHFR minimal promoter. (A) Transcription reactions were performed with DHFR promoter fragments andHeLa nuclear extract. The extent of DHFR sequences on each template is indicated above the lanes. The arrowheads indicate the expectedsize of the runoff transcript initiating at the DHFR major start site. No product of the correct size is seen when the -50/+52 or the -356/-30template was used. The strong signals of 444 and 552 nucleotides seen in the -50/+52 and -270/+15 lanes, respectively, are due to end-to-endtranscription of the template DNA by RNA polymerase. Similarly, the 800-nucleotide band in the -356/-30 lane is due to end-to-endtranscription, whereas the three bands between the 311 and 444 markers are transcripts arising from minor start sites. The sizes of themolecular size markers (in base pairs) are indicated to the right of the figure. (B) Schematic of the DHFR promoter region. All sequences are

numbered relative to + 1 (the major DHFR transcription initiation site). Other start sites corresponding to RNAs transcribed from the oppositestrand are also indicated (16, 41). The deletions that define the DHFR minimal promoter (-65 to + 15) are shown. The small boxes below theline represent Spl consensus binding sites. The four DHFR-proximal Spl consensus sites are in the opposite orientation to the six upstreamsites. The open boxes above the line represent the four 48-bp repeats.

and have found that a template with a 3' boundary of + 15can initiate accurately, but that further 3' deletion to -30inactivates the promoter. Transcription does not initiate thecorrect distance downstream from the DHFR-proximal GCbox on the template containing nucleotides -356 to -30,even though all four 48-bp repeats are retained. Thus, theboundaries of the region defined as the DHFR minimalpromoter extend from nucleotides -65 to +15 and containone binding site for the transcription factor Spl and thetranscription initiation site, but no other consensus se-quences for previously identified factors.

Proteins bind to two sites in the DHFR minimal promoter.We have examined the protein-binding sites in the DHFRminimal promoter region. A DNA probe that was 5' endlabeled at nucleotide -87 was used in DNase I protectionassays with HeLa nuclear extract. Only two regions of thisprobe were protected from DNase I cleavage. One protectedregion spans the GC box, protecting nucleotides -60through -40 in the absence of polyethylene glycol and -60through -33 in the presence of 3% polyethylene glycol (Fig.

2A, lanes 2 to 4). The other protected region spans thetranscription initiation site, protecting nucleotides -11through +9. Addition of volume excluders such as polyeth-ylene glycol or polyvinyl alcohol may increase the detectionof protein-DNA interactions. However, reactions containingup to 3% polyethylene glycol (lane 4) or 4.5% polyvinylalcohol (data not shown) did not reveal any other protein-binding sites within the minimal promoter. The two bindingsites detected correspond to regions required for transcrip-tion in vitro (Fig. 1). Deletion from nucleotides -65 to -50removes half of the GC box and inactivates the promoter.Deletion from +15 to -30 abolishes correctly positionedinitiation, resulting in spurious initiation sites throughout thetemplate.To determine whether binding at the transcription initia-

tion site was dependent upon formation of a functionaltranscription complex, we assayed a transcriptionally inac-tive DHFR promoter construct by using DNase I protection.Because this fragment, containing DHFR sequences fromnucleotides -50 to +52, lacks most of the GC box, binding

A

.1

,* ttA s P I*

* It.D. '~ I.-.

v'. ii.

VOL. 10, 1990

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

656 MEANS AND FARNHAM

B-Es 60z N.E.C,

O.- O

:L g

O UsS

L

ISpiconsensussite

1 2 3 4 5

NONCODINGSTRAND

Ug N.E. <:60 0 o

Om

4w

on

I;_ w

iS

I

4w1 23

CCTTGGTOGGGGCGGGGCCTMGCTGCGCMGTGGTACAGAGCTCAGGGCTGCGATTICGCGcCMACTTGACGGCGGMOCCACCCCCGCCCOGGATTCACGCGUCACCATGTGTCGAGTCCCGACCTAMGCGCCGGTTTGMCTGCC

FIG. 2. DNase I protection of the DHFR promoter region. (A) The coding strand of pBSprol9, containing DHFR sequences from -87 to+52 was 5' end labeled and digested with DNase I in the absence (lane 1) and presence (lanes 2 to 4) of 60 jig of HeLa nuclear extract andin the presence of 0% (lane 2), 1.5% (lane 3), or 3% (lane 4) polyethylene glycol (PEG). Lane 5 shows the position of G nucleotides in thefragment (30). Symbols: Fii, regions protected from DNase I cleavage; A, position of the transcription initiation site (40); M, Sp1consensus site. (B) Both the noncoding (lanes 1 to 3) and the coding (lanes 4 to 6) strands of pBSprol8, containing DHFR sequences -50 to+52 (but lacking the Spl-binding site required for transcription), were digested with DNase I in the presence (lanes 1 and 6) and absence (lanes2 and 5) of 60 pug of HeLa nuclear extract. Lanes 3 and 4 show the positions ofG and A nucleotides in the sequence (30). Symbols: L., regionsprotected from DNase I cleavage: .A position of the transcription initiation site. (C) Sequence of the DHFR minimal promoter. Sequencesprotected from DNase I cleavage on the coding and noncoding strands are indicated by lines above and below the sequence, respectively.The sequence protected by Spl on the noncoding strand was determined by DNase I digestion of a 5'-end-labeled noncoding strand fragmentfrom pBSprol9 (data not shown) and is identical to the protected region described by Dynan et al. (15).

of Spl was not observed. However, protein did bind to theinitiation site (Fig. 2B). Although the initiation site is in thecenter of the protected region on the coding strand (Fig. 2B,lane 6), the noncoding (template) strand is protected mainly5' of the initiation site (Fig. 2B, lane 1). Our results indicatethat protein binding to the DHFR initiation site is indepen-dent of Spl binding and therefore does not require formationof a functional transcription complex.The location of the DHFR initiation site determines the

position of transcription initiation. We have shown that a

deletion of DHFR sequences from nucleotides -30 to +15,including the protected region spanning the initiation site,abolishes correctly initiated transcription (Fig. 1). For manypromoters, the sequence at the initiation site is less impor-tant than the TATA box located 30 nucleotides upstream.The TATA box can direct RNA polymerase II to initiate 30nucleotides downstream even after replacement of the initi-ation site with random sequence. To assess the relative

ACODINGSTRAND

_ 0 60

S

40

4 , 6

.4I_

.gSs

dl, ~

456 _

C

MOL. CELL. BIOL.

I'

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

POSITIONING OF TRANSCRIPTION INITIATION 657

Ao t aV- +

127\

126=3121 loo -_w -W

101-* _

88-S

1 2 3 4 5 61 2 3

c

ACAAA-A-SGA-SZCGCSGCSS-GC. 7S . SSSSSZ2SSZ . AAGC7. SZSAAG: GS A7A2AC~AS-.S_CAG--S _-7 vZ -------;AAZ SARZoo . ..-W _ FR

ACAAAnSSAA:_ ---- --. _g ACz _'A-...s

S*SSZ_-AA.AA~~Z~- - -.-S-A-ACA-:s:azA_.. .S-:4

.......-t...g.g -

FIG. 3. The location of the DHFR initiation site determines the position of transcription initiation. (A) Primer extension analysis of in vitrotranscriptions from templates diagrammed in panel C. Lane 1 contains molecular size markers (in base pairs). Arrowheads correspond to theinitiation sites marked with the identical arrowheads in panel C. (B) Primer extension analysis of in vitro transcriptions from the GC template(lane 3) and the GCDI template (lane 2), both diagrammed in panel C. Arrowheads correspond to the initiation sites marked with the identicalarrowheads in panel C. (C) Partial sequence of the coding strands of the templates used in panels A and B. The wild-type template, frompST410, includes DHFR sequences from -356 to +61. The STU template, from pSTUmp19, is identical to the wild-type promoter, exceptthat the G at -17 has been changed to a C. STU+10, STU+14, and STU+28 (from pSTU+1Omp19, pSTU+14mp19, and pSTU+28mp19,respectively) have linkers of 10, 14, and 28 bp inserted at the StuI site of the STU template. The GC template contains a GC box cloned intopUC19. The GCDI template contains a GC box and the DHFR initiation site cloned into pUC19. Underlined nucleotides indicate the Spl andHIPi consensus sites. Nucleotides that do not correspond to DHFR sequences are in lowercase letters. Arrowheads indicate the sites oftranscription initiation that were determined by the reactions in panels A and B.

contribution of the transcription initiation site and the -30region, we performed the following experiments.To determine whether the binding of protein to the DHFR

initiation site influenced the position of transcription initia-tion, we tested the effect of moving the initiation site fartherfrom the upstream elements. We created a StuI restrictionsite by a single-base-pair substitution at the 5' boundary ofthe protected region spanning the transcription initiationsite. We then inserted oligonucleotides 10, 14, and 28 bp inlength into this StuI site and assayed for in vitro transcrip-tional activity by primer extension of transcription products(Fig. 3A). If a factor binding upstream of the protectedregion specifies the position of transcription initiation bydirecting RNA polymerase to initiate a fixed distance down-stream, analogous to TFIID, the lengths of the RNAs fromthe insertion mutants would be increased by 10, 14, and 28bases. If the protein binding to the initiation site specifies theposition of initiation, then transcription would initiate at thissite in any location and the RNAs would be the same lengthregardless of the insert size. The creation of the StuI site didnot significantly change the level or site of initiation (Fig. 3A,lane 3). Analysis of the different insertion templates indi-cated that transcription initiated within the protein bindingsite, despite its greater distance from upstream elements(Fig. 3A, lanes 4 to 6). However, with the 10-bp insertion,transcription initiated equally often at the normal initiatingnucleotide and 5 bp upstream, at the G of the GCCAelement. This is a minor site of initiation in the DHFRpromoter both in vivo (J. Flatt, unpublished data) and in

vitro (Fig. 3A, lanes 2 and 3). The 14- and 28-bp insertionmutations initiated predominantly at this G and, less fre-quently, at the A of the wild-type promoter. The level oftranscription from every insertion template was lower thanthe level from the wild-type and STU templates, suggestingthat there is an optimal distance between the transcriptioninitiation site and upstream elements for efficient transcrip-tion.

Construction of a synthetic promoter. We have shown thatremoval of either the Spl binding site or the region contain-ing the initiation site abolishes transcriptional activity, dem-onstrating the importance of both elements (Fig. 1). Toexamine the requirement of the sequences between the Spland the transcription initiation sites, we cloned oligonucleo-tides containing these sites into the polylinker region ofpUC19, separated by the same number of nucleotides as inthe DHFR promoter (plasmid GCDI [Fig. 3C]), and assayedthis template for transcription in vitro (Fig. 3B). Althoughinsertion of an Spl-binding site was not sufficient for tran-scriptional activity (Fig. 3B, lane 3), insertion of both theSpl and the DHFR initiation site oligonucleotides resulted ininitiation of transcription within the DHFR initiation siteoligonucleotide (Fig. 3B, lane 2). Thus, one GC box and theDHFR initiation site oligonucleotide are sufficient for accu-rate transcription in vitro.A protein binds to the SV40 late initiation site. Because the

DNA sequence at the initiation site of the SV40 late pro-moter is very similar to the sequence at the DHFR initiationsite (see Fig. 5), we examined this region of the SV40 late

B

8 8101-

88-

61- - a55-541,*

-4

VOL. 10, 1990

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

658 MEANS AND FARNHAM

promoter for protein-DNA interactions. DNase I footprint-ing of SV40 sequences from nucleotides 200 to 345 (themajor initiation site is at nucleotide 325) revealed binding attwo sites, one spanning the initiation site and the othercentered approximately 45 bp upstream of the initiation site(Fig. 4, lanes 3 and 6). Examination of this upstream siterevealed that it also contained a sequence, TTTCCGCC,similar to that at the DHFR initiation site.To determine whether the protein that binds to the DHFR

transcription initiation site is also involved in SV40 latetranscription, we used concatemerized oligonucleotides con-taining the region from nucleotides -16 to +9 spanning theDHFR initiation site as a competitor of SV40 late promoterin vitro transcription reactions (Fig. 4B). A decrease intranscriptional activity from an SV40 late promoter fragmentthat is added to the reaction after the competitorDNA wouldindicate that the protein binding to the DHFR initiation siteoligonucleotide was required for SV40 late transcription. Weexamined the effects of excess DHFR initiation site oligonu-cleotides on transcription from the SV40 early and latepromoters. As discussed above, the SV40 major late initia-tion site, at nucleotide 325, has homology to the DHFRinitiation site. The initiation site at nucleotide 170 is homol-ogous to the 5' half of the DHFR initiation site, having thesequence TTTC. The SV40 early start sites do not havehomology to the DHFR initiation site. ConcatemerizedDHFR initiation initiation site oligonucleotides (200 ng)reduced transcription from both the 170 and 325 start sites ofthe SV40 late promoter and led to novel upstream initiations(Fig. 4B, lane 4). Excess DHFR initiation site oligonucleo-tides increased transcription from the SV40 early start sites(Fig. 4B, lanes 5 to 8). Control reactions were performed inwhich 200 ng of a concatemerized oligonucleotide containinga mutated (nonfunctional) heat shock element was added totranscription reactions before the SV40 late or early pro-moter fragments. No difference in transcriptional activityfrom either template was observed (data not shown), dem-onstrating that the effects on transcription caused by theDHFR initiation site concatemer were not due simply toexcess DNA in the reaction. These results of competitionwith the DHFR initiation site concatemer suggest that theavailability of the protein that binds to the DHFR initiationsite may be important for determining the efficiency oftranscription in the early (versus the late) direction of SV40transcription. Initiation from the late start sites requires thisprotein, whereas initiation from the early start sites occursmore efficiently in its absence.Other non-TATA box genes have sequence homology to

DHFR at their initiation sites. The transcription initiationsites shown in Fig. 5 exhibit homology to the 11-bp sequenceimmediately preceding the DHFR initiation site. None ofthese promoters has a TATA box appropriately positionednear its transcription initiation site. In particular, the majorinitiation site of the SV40 late promoter is strikingly similarto the DHFR sequence. These two genes have the sequenceATTTCNNGCCA. However, transcription initiates at the 3'end of the consensus sequence in the mouse DHFR pro-moter but at the 5' end of the consensus sequence in theSV40 late promoter and in the hamster and human DHFRgenes (Fig. 5). Comparison of the initiation sites listed in Fig.5 suggests that this sequence may be composed of twoelements corresponding to the sequences ATTTC andGCCA, which can be separated by 1 to 19 nucleotides. Foreach of the genes listed in Fig. 5, transcription initiates ateither or both of these elements. Because the protein(s)binding to the DfIFR initiation site protects a sequence

A

.0gXzSRB

0§-XJ3

B

SV40 late starts+170 _+325 -_

CODING NONCODINGSTRAND STRAND

G 0 60 G 0 60- U.

- so*_

_.1MP _

-_

*31

-a-

12

1 2 3 4 5 6

SV40 early starts

4- + 31

4-. 9

1 2 3 4 5 6 7 8 9

FIG. 4. The SV40 late promoter binds protein at its majorinitiation site. (A) The coding (lanes 1 to 3) and noncoding (lanes 4to 6) strands of pSVSN were assayed for DNase I cleavage in thepresence (lanes 3 and 6) and absence (lanes 2 and 5) of 60 jig ofHeLa nuclear extract. Lanes 1 and 4 show the positions of Gnucleotides (30). Symbols: LO], regions protected from DNaseI cleavage; _z position of the transcription initiation site. Nucleo-tides protected from cleavage are indicated on either side. (B)Oligonucleotide competition of transcription from the SV40 earlyand late promoters. Transcription reactions were preincubated withor without excess concatemerized DHFR initiation site oligonucle-otides (DINIT) before addition of the SV40 late promoter pGem-HindIII-C-HindIII fragment (lanes 1 to 4) or the SV40 early pro-moter pSVS-SphI-NdeI fragment (lanes 5 to 8). Arrows indicate theposition of correctly initiated RNA. Lane 9 shows the positions ofDNA molecular size markers.

common to other housekeeping genes, we refer to theprotein(s) as HIP1, for housekeeping initiation protein 1.

DISCUSSION

HIPi binds to the DHFR initiation site. The question ofhow the site of transcription initiation is specified for geneslacking a recognizable TATA box has generated consider-able debate. We have now shown that the sequence at theDHFR initiation site, rather than sequences farther up-

concatemerized DINIT sites (ng, 0

0 20 100 200 0 20 100 200 0

..4_

_ ww

amav

MOL. CELL. BIOL.

I

t-

I0

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

POSITIONING OF TRANSCRIPTION INITIATION 659

v appears that a previously unidentified protein binds to theACAGCTCAGGGCTGCGAITCGCCCAAACTT DHFRDHFR transcription initiation site.GGGCGGGGCGGCCACAA2TICGCGECCAACTT DHFR (human) Te initiation site plays a variety of roles in different

V promoters. Most yeast genes contain one or more TATAGCGCCGGGCGAATGCAAIT=GC~CCf.AACTT DHFR (hamster) boxes that are required for transcription, yet rely uponTCCTCTTTCAGAGGTTAIIICAGGCCATGGTG 5V40 late sequences surrounding the initiation site to position tran-

V scription initiation (9, 21, 38). In contrast, mammalian TATACCGGCAGCGQITTGAGCCATTGC HPRT boxes direct RNA polymerase II to initiate transcription a

T V ~~V VCCATCGCGCACTCCGGCTCGAIICGfCAGGCGGCG Ki-RAS fixed distance downstream. If the region downstream of theV V TATA box, including the initiation site, is deleted and

GCGGTGTTCCGCA=~TCAAGCCTCC PGK replaced with random sequences, RNA polymerase II canVTAAACCCCTCCACA ITCTGCAGCCC Osteonectin still initiate transcription accurately, although the level of

AGAVT VTTCGCGGCGCCGCGGACTCGCAGTG transcription may decrease (11-13).T Recently, the region containing the transcription initiation

CAGATITTCGGTCCCGGAAGTGTg&AAGATGGC SURF-1 site has been demonstrated to position the start of transcrip-

FIG. 5. Housekeeping genes having sequence homologies to the tion of two mammalian genes that do not contain TATADHFR start site. Genes having initiation sites homologous to the boxes. Sale and Baltimore (43) demonstrated that theDHFR initiation site were identified by examining a collection of region around the terminal deoxynucleotidyltransferasemanuscripts concerning non-TATA box promoters and by searching (TdT) initiation site is required for transcription. Deletion orGenBank with the consensus sequence ATTTCN(1-30)GCCA (only mutation of this region eliminates or reduces transcription,the identified consensus sequence homologies that occur at or near respectively. A 17-bp region containing the start site istranscription initiation sites are shown in this figure). These genes sufficient to position low levels of initiation in the absence ofrepresent those having the best homology to the consensus se- other elements and higher levels when combined with up-quence. The sequences underlined are homologous to the DHFR stream elements such as a TATA box or GC box. The TdTinitiation site. Arrowheads indicate the sites of transcription initia- gene is not a housekeeping gene: its expression is limited totion. References for these sequences are as follows: DHFR (8, 34,40); SV40 late promoter (20); HPRT (hypoxanthine phosphoribosyl- precursor B and T lymphocytes (27). The mechanism oftransferase) (33); Ki-RAS (22); PGK (3-phosphoglycerate kinase) intiation for the TdT gene is distinct from the mechanism(42); osteonectin (32); IRF-1 (interferon regulatory factor 1) (36); used by the DHFR gene. The DHFR initiation site cannotSURF-1 (44). function in the absence of an Spl-binding site and bears no

apparent sequence homology to the TdT initiation site. Inaddition, Smale and Baltimore could detect no protein

stream, binds protein and positions RNA polymerase II to binding to the TdT initiation site (43).initiate transcription at that site. Ayer and Dynan (2) showed that substitution of nucleo-

Binding of a protein other than RNA polymerase to the tides around the major late initiation site of SV40 decreasedstart site of transcription is not well documented. Although levels of transcription in vitro and changed the site ofthe transcription factor TFIIB may bind in the vicinity of the initiation. Close examination of their results reveals thatinitiation site (7), it does not appear to bind DNA directly substitution of the ATTTC at the initiation site with random(45), but is positioned by binding to other proteins already sequence caused transcription to initiate 10 bp downstream,bound to the promoter. The herpes simplex virus ICP4 at the GCCA sequence. Through comparison of the pro-protein binds to its own transcription initiation site in a tected sequences and inhibition of transcriptional activitynegative, autoregulatory manner (37). A cellular protein with oligonucleotides derived from the DHFR initiation site,spans from nucleotides -17 to +27 of the human immuno- we believe that the protein responsible for determining thedeficiency virus type 1 promoter. However, unlike the initiation site for the SV40late gene is the same as or similarDHFR promoter, the human immunodeficiency virus type 1 to the one responsible for this activity in the DHFR gene. ATATA element appears to be responsible for positioning second sequence homologous to the HIPl-binding site oc-transcription initiation, since insertion of a DNA fragment curs 45 bp upstream of the SV40 late initiation site and alsodownstream of the TATA element causes an upstream shift binds a protein that may be HIP1. Mutation of this upstreamin the transcription initiation site (25). There are four reasons sequence and of sequences between the two HIP1 sequencesfor our belief that the protein we are detecting is not RNA reduces transcription in vivo and in vitro (2, 4).polymerase. First, binding occurs to a template that lacks a The HIPl-binding site in the DHFR promoter positions theGC box and is transcriptionally inactive. Second, the foot- site of transcription initiation. We find that transcriptionprinting reactions contain a 3,000-fold excess of nonspecific initiates at the HIP1 site when 10, 14, or 28 nucleotides arecompetitor DNA. Proteins that bind DNA in a nonspecific inserted between it and all other upstream sequences. Sincemanner, such as RNA polymerases that bind to ends of templates with inserts of 14 and 28 bp give similar levels offragments, are thus outcompeted and do not bind to the transcription, there does not appear to be a preference forlabeled DNA. Third, the footprint we detected is smaller one side of the helix. Insertion of 10 bp upstream of the HIP1than the RNA polymerase II footprint observed on other site decreases transcription more than insertion of 14 or 28promoters (7, 23). The footprint on the DHFR noncoding, or bp, possibly owing to the high G+C content and palindromictemplate, strand does not extend far 3' of the initiating nature of the insert.nucleotide. RNA polymerase II protects this strand at least To demonstrate more conclusively that the transcription15 bp 3' of the initiation site in the adenovirus type 2 major initiation site of the DHFR promoter is a positioning elementlate promoter. Fourth, addition of an excess of HIPl-binding and not just a preferred initiation sequence for a factorsites increases transcription from the SV40 early promoter in binding elsewhere, oligonucleotides corresponding to an Splvitro. Since this promoter is transcribed by RNA polymerase and a HIP1 site were cloned the appropriate distance apart inII, we cannot be inhibiting RNA polymerase II, because bacterial sequences of the pUC19 plasmid (Fig. 3C). Whentranscription would then decline, not increase. Thus, it just an Spl site was cloned into pUC19, no transcription was

VOL. 10, 1990

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

660 MEANS AND FARNHAM

observed. When both an Spl and a HIP1 consensus site werecloned into pUC19, transcription initiated at the HIP1 site,demonstrating that no DHFR sequences other than the Splsite and the HIP1 site are required for accurate initiation.Within the HIPi sites of different genes, transcription may

initiate primarily from the 5' end or the 3' end of either of thetwo sequence elements that constitute the HIP1 consensussequence (Fig. 5). Transcription initiates primarily from thenucleotide next to the 3' end of the HIPi consensus se-quence in the mouse DHFR promoter. However, when theHIPi site is isolated from surrounding sequences and clonedinto a bacterial vector containing an Spl-binding site, tran-scription initiates primarily from the 5' end of the HIPisequence (at the HIP1 nucleotide that initiates hamsterDHFR, SV40 late, and osteonectin transcription) and sec-ondarily from the 3' end of the sequence. Therefore, thechoice of initiating nucleotides is not inherent in the HIP1sequence, but is influenced by the surrounding sequences.Although mouse and human DHFR genes initiate at differentnucleotides within the HIPi element, the mouse initiationsite is used by the mouse promoter in transcription extractsprepared from human (Fig. 3) and mouse (18) cells. Thisindicates that the difference is not due to differences in HIPibetween human and mouse cells. The DNA sequence imme-diately upstream of the HIPi consensus sequence is slightlydifferent in the human, hamster, and mouse genes. It ispossible that these sequence differences are responsible forthe slightly different start sites. We are currently performingmutagenesis of this region and testing whether the binding ofother transcription factors influences the exact site of initi-ation within the HIPi site.

In summary, our data are consistent with the conclusionthat the same or a similar protein(s) binds to the initiationsites of the DHFR and SV40 late genes, and sequence datasuggest that this protein(s) may bind to other housekeepinggenes. Our results suggest the existence of at least twomechanisms for specifying the site of transcription initiation,one used by many high-expression, tissue-specific promotersand controlled by TFIID, and the other used by severallow-expression, housekeeping promoters and controlled byHIP1. To determine the number and variability of HIPiproteins as well as to assess their specificity and affinity forvarious promoters, we are beginning experiments to purifyand clone the HIPi protein(s).

ACKNOWLEDGMENTS

We thank Jody Flatt for growing the HeLa cells and for allowingus to refer to unpublished results, Stephanie McMahon for technicalassistance in sequencing plasmid clones, Charles Nicolet for thecontrol oligonucleotides, and the laboratory of Janet Mertz forpGemHindIII-C. We are grateful to all the members of the P. J.Farnham and W. M. Sugden laboratories for valuable discussion andto the members of the McArdle Laboratory Tumor Biology Groupfor helpful comments on the manuscript.

This work was supported by Public Health Service grantsCA45240 and CA07175 from the National Institutes of Health.A.L.M. was supported, in part, by training grant CA09135 from theNational Institutes of Health.

LITERATURE CITED1. Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J.

Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin. 1987. Phorbolester-inducible genes contain a common cis element recognizedby a TPA-modulated trans-acting factor. Cell 49:729-739.

2. Ayer, D. E., and W. S. Dynan. 1988. Simian virus 40 major latepromoter: a novel tripartite structure that includes intragenicsequences. Mol. Cell. Biol. 8:2021-2033.

3. Borelli, M. J., M. A. Mackey, and W. C. Dewey. 1987. A methodfor freezing synchronous mitotic and G1 cells. Exp. Cell Res.170:363-368.

4. Brady, J., M. Radonovich, M. Vodkin, V. Natarajan, M.Thoren, G. Das, J. Janik, and N. P. Salzman. 1982. Site-specificbase substitution and deletion mutations that enhance or sup-press transcription of the SV40 major late RNA. Cell 31:625-633.

5. Breathnach, R., and P. Chambon. 1981. Organization andexpression of eucaryotic split genes coding for proteins. Annu.Rev. Biochem. 50:349-383.

6. Briggs, M. R., J. T. Kadonaga, S. P. Bell, and R. Tjian. 1986.Purification and biochemical characterization of the promoter-specific transcription factor, Spl. Science 234:47-52.

7. Buratowski, S., S. Hahn, L. Guarente, and P. A. Sharp. 1989.Five intermediate complexes in transcription initiation by RNApolymerase II. Cell 56:549-561.

8. Chen, M.-J., T. Shimada, A. D. Moulton, A. Cline, R. K.Humphries, J. Maizel, and A. W. Nienhuis. 1984. The functionalhuman dihydrofolate reductase gene. J. Biol. Chem. 259:3933-3943.

9. Chen, W., and K. Struhl. 1985. Yeast mRNA initiation sites aredetermined primarily by specific sequences, not by the distancefrom the TATA element. EMBO J. 4:3273-3280.

10. Ciudad, C. J., G. Urlaub, and L. A. Chasin. 1988. Deletionanalysis of the chinese hamster dihydrofolate reductase genepromoter. J. Biol. Chem. 263:16274-16282.

11. Concino, M. F., R. F. Lee, J. P. Merryweather, and R. Wein-mann. 1984. The adenovirus major late promoter TATA box andinitiation site are both necessary for transcription in vitro.Nucleic Acids Res. 12:7423-7433.

12. Corden, J., B. Wasylyk, A. Buchwalder, P. Sassone-Corsi, C.Kedinger, and P. Chambon. 1980. Promoter sequences of eu-karyotic protein-coding genes. Science 209:1406-1414.

13. Dierks, P., A. van Ooyen, M. D. Cochran, C. Dobkin, J. Reiser,and C. Weissmann. 1983. Three regions upstream from the capsite are required for efficient and accurate transcription of therabbit P-globin gene in mouse 3T6 cells. Cell 32:695-706.

14. Dignam, J. D., R. M. Lebovitz, and R. Roeder. 1983. Accuratetranscription initiation by RNA polymerase II in a solubleextract from isolated mammalian nuclei. Nucleic Acids Res.11:1475-1489.

15. Dynan, W. S., S. Sazer, R. Tjian, and R. T. Schimke. 1986.Transcription factor Spl recognizes a DNA sequence in themouse dihydrofolate reductase promoter. Nature (London) 319:246-248.

16. Farnham, P. J., J. M. Abrams, and R. T. Schimke. 1985.Opposite-strand RNAs from the 5' flanking region of the mousedihydrofolate reductase gene. Proc. Natl. Acad. Sci. 82:3978-3982.

17. Farnham, P. J., and R. T. Schimke. 1985. Transcriptionalregulation of mouse dihydrofolate reductase in the cell cycle. J.Biol. Chem. 260:7675-7680.

18. Farnham, P. J., and R. T. Schimke. 1986. In vitro transcriptionand delimitation of promoter elements of the murine dihydrofo-late reductase gene. Mol. Cell. Biol. 6:2392-2401.

19. Fromm, M., and P. Berg. 1982. Deletion mapping of DNAregions required for SV40 early region promoter function invivo. J. Mol. Appl. Genet. 1:457-481.

20. Ghosh, P. K., V. B. Reddy, J. Swinscoe, P. Lebowitz, and S. M.Weissman. 1978. Heterogeneity and 5'-terminal structures of thelate RNAs of simian virus 40. J. Mol. Biol. 126:813-846.

21. Hahn, S., E. T. Hoar, and L. Guarente. 1985. Each of three"TATA elements" specifies a subset of the transcription initi-ation sites at the CYC-1 promoter of Saccharomyces cerevisiae.Proc. Natl. Acad. Sci. USA 82:8562-8566.

22. Hoffman, E. K., S. P. Trusko, N. A. Freeman, and D. L. George.1987. Structural and functional characterization of the promoterregion of the mouse c-Ki-ras gene. Mol. Cell. Biol. 7:2592-2596.

23. Horikoshi, M., T. Hai, Y.-S. Lin, M. R. Green, and R. G.Roeder. 1988. Transcription factor ATF interacts with theTATA factor to facilitate establishment of a preinitiation com-plex. Cell 54:1033-1042.

MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.

POSITIONING OF TRANSCRIPTION INITIATION 661

24. Imagawa, M., R. Chiu, and M. Karin. 1987. Transcription factorAP-2 mediates induction by two different signal-transductionpathways: protein kinase C and cAMP. Cell 51:251-260.

25. Jones, K. A., P. A. Luciw, and N. Duchange. 1988. Structuralarrangements of transcription control domains within the 5'-untranslated leader regions of the HIV-1 and HIV-2 promoters.Genes Dev. 2:1101-1114.

26. Kadonaga, J. T., A. J. Courey, J. Ladika, and R. Tjian. 1988.Distinct regions of Spl modulate DNA binding and transcrip-tional activation. Science 242:1566-1570.

27. Landau, N. R., T. P. St. John, I. L. Weissman, S. C. Wolf, A. E.Silverstone, and D. Baltimore. 1984. Cloning of terminal trans-ferase cDNA by antibody screening. Proc. Natl. Acad. Sci.USA 81:5836-5840.

28. Lee, W., P. Mitchell, and R. Tjian. 1987. Purified transcriptionfactor AP-1 interacts with TPA-inducible enhancer elements.Cell 49:741-752.

29. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

30. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

31. McGrogan, M., C. C. Simonsen, D. T. Smouse, P. J. Farnham,and R. T. Schimke. 1985. Heterogeneity at the 5' termini ofmouse dihydrofolate reductase mRNAs. J. Biol. Chem. 260:2307-2314.

32. McVey, J. H., S. Nomura, P. Kelly, I. J. Mason, and B. L. M.Hogan. 1988. Characterization of the mouse sparc/osteonectingene. J. Biol. Chem. 263:11111-11116.

33. Melton, D. W., C. McEwan, A. B. McKie, and A. M. Reid. 1986.Expression of the mouse HPRT gene: deletional analysis of thepromoter region of an X-chromosome linked housekeepinggene. Cell 44:319-328.

34. Mitchell, P. J., A. M. Carothers, J. H. Han, J. D. Harding, E.Kas, L. Venolia, and L. A. Chasin. 1986. Multiple transcriptionstart sites, DNase I-hypersensitive sites, and an opposite-strandexon in the 5' region of the CHO dhfr gene. Mol. Cell. Biol.

6:425-440.35. Mitchell, P. J., C. Wang, and R. Tjian. 1987. Positive and

negative regulation of transcription in vitro: enhancer-bindingprotein AP-2 is inhibited by SV40 T antigen. Cell 50:847-861.

36. Miyamoto, M., T. Fujita, Y. Kimura, M. Maruyama, H. Harada,Y. Sudo, T. Miyata, and T. Taniguchi. 1988. Regulated expres-sion of a gene encoding a nuclear factor, IRF-1, that specificallybinds to IFN-P gene regulatory elements. Cell 54:903-913.

37. Muller, M. T. 1987. Binding of the herpes simplex virus imme-diate-early gene product ICP4 to its own transcription start site.J. Virol. 61:858-865.

38. Nagawa, F., and G. R. Fink. 1985. The relationship between the"TATA" sequence and transcription initiation sites at the HIS4gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA82:8557-8561.

39. Nakajima, N., M. Horikoshi, and R. G. Roeder. 1988. Factorsinvolved in specific transcription by mammalian RNA polymer-ase II: purification, genetic specificity, and TATA box-promoterinteractions of TFIID. Mol. Cell. Biol. 8:4028-4040.

40. Sazer, S., and R. T. Schimke. 1986. A re-examination of the 5'termini of mouse dihydrofolate reductase RNA. J. Biol. Chem.261:4685-4690.

41. Schilling, L. J., and P. J. Farnham. 1989. Identification of a newpromoter upstream of the murine dihydrofolate reductase gene.Mol. Cell. Biol. 9:4568-4570.

42. Singer-Sam, J., D. H. Keith, K. Tani, R. L. Simmer, L. Shively,S. Lindsay, A. Toshida, and A. D. Riggs. 1984. Sequence of thepromoter region of the gene for human X-linked 3-phosphoglyc-erate kinase. Gene 32:409-417.

43. Smale, S. T., and D. Baltimore. 1989. The "initiator" as atranscription control element. Cell 57:103-113.

44. Williams, T. J., and M. Fried. 1986. The MES-1 murine en-hancer element is closely associated with the heterogeneous 5'ends of two divergent transcription units. Mol. Cell. Biol.6:4558-4569.

45. Zheng, X.-M., V. Moncollin, J.-M. Egly, and P. Chambon. 1987.A general transcription factor forms a stable complex with RNApolymerase B (II). Cell 50:361-368.

VOL. 10, 1990

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 02

Feb

ruar

y 20

22 b

y 96

.43.

245.

218.