downloaded from //iai.asm.org/content/iai/early/2010/10/04/iai.00267-10.full.pdf · first and...
TRANSCRIPT
![Page 1: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/1.jpg)
Surface expression of MPT64 as a fusion with the PE domain of PE_PGRS33 enhances BCG
protective activity against Mycobacterium tuberculosis in mice.
Michela Sali1, Gabriele Di Sante
2, Alessandro Cascioferro
4, Antonella Zumbo
1, Chiara Nicolò
2,
Valentina Donà4, Stefano Rocca
5, Annabella Procoli
3, Matteo Morandi
1, Francesco Ria
2, Giorgio
Palù4, Giovanni Fadda
1, Riccardo Manganelli
4* and Giovanni Delogu
1*.
1Institute of Microbiology,
2Institute of General Pathology,
3Institute of Gynecology, Catholic
University, L.go A. Gemelli, 8 - 00168 - Rome, Italy.
4 Department of Histology, Microbiology and Medical Biotechnologies, University of Padua, Via A.
Gabelli, 63 – 35121 - Padua, Italy;
5 Institute of General Pathology, Pathological Anatomy and Veterinary Obstetrics-Surgery Clinic,
University of Sassari, Via Vienna – 07100 - Sassari, Italy.
*Corresponding authors: Riccardo Manganelli, email [email protected] ; tel. ++39 049 8272366;
fax ++39 049 8272355. Giovanni Delogu, email [email protected]; tel. ++39 06 30154964; fax ++ 39
06 3051152.
Keywords: Tuberculosis; BCG; Vaccine;
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00267-10 IAI Accepts, published online ahead of print on 4 October 2010
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 2: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/2.jpg)
2
Abstract
To improve the current vaccine against tuberculosis, Bacille Calmette and Guerin (BCG), a rBCG
expressing a Mycobacterium tuberculosis vaccine candidate antigen (MPT64) in strong association
with the mycobacterial cell wall was developed. To deliver the candidate antigen on the surface we
fused the mpt64 gene to the sequence encoding the PE domain of PE_PGRS33 of M. tuberculosis
(HPE-∆MPT64-BCG) which we have previously shown to transport proteins to the bacterial
surface. In a series of protection experiments in the mouse model of tuberculosis we showed that: a)
immunization of mice with HPE-∆MPT64-BCG provides levels of protection significantly higher
than those afforded by the parental BCG strain, as assessed by bacterial colonization in the lung and
spleen, and lung involvement (both at 28 and 70 days post-challenge); b) rBCG strains expressing
MPT64 provides a better protection than the parental BCG strain only when this antigen is surface-
expressed; and c) the HPE-∆MPT64-BCG induced MPT64-specific T cell repertoire when
characterized by BV-BJ spectratyping indicates that protection correlates with the ability to recruit
IFN-γ secreting T cells carrying the BV8.3-BJ1.5 of 172b shared rearrangement. These results
demonstrate that HPE-∆MPT64-BCG is one of the most effective new vaccine so far tested in the
mouse model of TB and underscore the impact of antigen cellular localization on the induction of
the specific immune response induced by rBCG.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 3: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/3.jpg)
3
Introduction
The 2007 WHO report an estimated 13.7 million prevalent cases of tuberculosis (TB) in the world
and 1.77 million deaths (55). The HIV pandemic has contributed to the reemergence of TB in the
last three decades, with 456.000 deaths in HIV-positive patients in 2007. Nevertheless, of the 9.27
million incident TB cases in 2007, “only” 15% were HIV-positive (55), indicating that TB remains
a major health problem also for immune-competent subjects and primarily in poor and developing
countries. In the last few years, the emergence of Mycobacterium tuberculosis strains resistant to
first and second-line drugs has raised further concern among health authorities and the scientific
community, making even more urgent the need for effective control measures (31,32,49).
The development of a new and improved vaccine against TB may provide one of the best tools to
control the disease. The only vaccine currently available is Bacille Calmette and Guerin (BCG),
introduced in 1921, that protects against the most severe forms of TB in children, but whose
efficacy in preventing TB in adults has been challenged by several clinical studies (12). For this
reason, the search for a new vaccine has gained a new momentum in the last fifteen years. Many
technological platforms have been implemented, such as protein-based vaccines with new and
innovative adjuvants (20,50,54); DNA vaccines expressing single and multiple antigens (14,15,50);
live recombinant viral vectors like rMVA (36) or adenovirus-based vectors (53); attenuated M.
tuberculosis strains (19,39) and recombinant BCG (rBCG) expressing M. tuberculosis antigens
Molecular engineering of the current BCG vaccine and over-expressing candidate antigens
presents several advantages. In fact, despite all the problems (2), BCG is still the gold standard
vaccine in animal models and very few vaccines have provided better protection (13). Moreover,
the introduction of a recombinant BCG (rBCG) in human studies is seen as less problematic
compared to other live vaccines for ethical reasons (5,10). Over-expression of dominant antigens
like Ag85 complex (27,28), or re-introduction of selected genes lost during attenuation of BCG,
like those encoded by RD1, are two examples of the strategies so far implemented to develop
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 4: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/4.jpg)
4
rBCG (42). To improve immunogenicity, rBCG has also been manipulated to express the
lysteriolisin of Listeria monocytogenes along with deletion of the ureC gene to facilitate
phagosome maturation and antigen processing following immunization (23,24). A similar
approach has been taken via insertion of the perfringolysin gene along with genes that express
certain antigens from M. tuberculosis (52)
In a recent publication we have shown that the PE domain of the M. tuberculosis protein
PE_PGRS33 localizes to the mycobacterial cell wall and that chimeric proteins constructed using
the PE such as PE-GFP or PE-MPT64, are exposed on the mycobacterial surface provided that the
PE domain is fused at their N-terminus (11). Therefore, the PE domain can be considered as a
functional domain containing the information necessary to transport and expose proteins on the
surface of mycobacteria and is an ideal candidate to develop a surface delivery system for
mycobacteria.
The MPT64 antigen used in these studies, is a secreted, highly immunogenic protein of M.
tuberculosis, whose gene has been lost in most of the BCG strains during attenuation. It has been
demonstrated that DNA vaccines expressing MPT64 can induce a partial level of protection in the
mouse model of TB (14). Hence MPT64 is a candidate antigen for the development of a subunit
vaccine against tuberculosis.
In this study, we show that a live BCG strain expressing a PE-MPT64 chimeric protective antigen
on its surface is more immunogenic and induces better protection against challenge with virulent M.
tuberculosis than the parental strain or rBCG strains expressing the same antigen localized in
different cellular compartments.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 5: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/5.jpg)
5
Materials and Methods
Animals. Pathogen-free C57Bl/6 female mice were obtained by Harlan (Italy). Mice were
immunized at 8-10 weeks of age and were kept under barrier conditions and fed commercial mouse
chow and water at libitum. All animal experiments were performed using protocols approved by the
Catholic University Ethical Committee.
Plasmids used in this study. The plasmids pSTE2 and pAL2 were already used in our previous
paper (11). To construct pAL32 the DNA fragment encoding the PE_∆MPT64 chimera was PCR
amplified using Pfu polymerase (Stratagene) from pSTE2 (11) using the oligonucleotides RP86 (5’-
GCTCTAGAATGTCATTTGTGGTCACGATCC-3’) and RP303 (5’-
ACAGATCTTTAGAGGCTAGCATAATCAGGAA-3’). The upper primer (RP86) was designed to
have an XbaI restriction site before the start codon of the PE1818c coding sequence, while the lower
primer (RP339) ws designed to have a BglII restriction site after the ORF stop codon. This fragment
was introduced immediately downstream of the Rv1818c promoter present in pMV4-36 (Delogu G.
unpublished) after its digestion with NheI and BamHI (Table 1).
Microrganisms. M. tuberculosis Erdman (TMC107) and M. bovis BCG Pasteur (TMC1011) were
obtained from the Trudeau Culture Collection. The recombinant BCG strains expressing the MPT64
antigen in different cellular compartments used in this study are described in Table 1.
Whole cell enzyme-linked immunosorbent assay (ELISA). Cells were grown to an OD600 of about
0.8, harvested by centrifugation at 4600 rpm for 10 minutes at room temperature, washed twice in
TBST buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1mM MgCl2 and 0.05% Tween 80) and
resuspended in 50 mM NaHCO3 pH 9.6 to yield a cell concentration of about 1 x 109 cells ml
-1.
100 µl of the so obtained cell suspension were transferred to each well of a microtitre plate (NUNC-
Immuno MaxiSorp Surface, Nalge Nunc International). After a 24 h incubation at 4°C, the
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 6: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/6.jpg)
6
microplate was centrifuged and the supernatant discarded. Samples were then blocked with 200 µl
of 3% powdered skim milk in TBST for 1.5 h at room temperature. The samples were then washed
once with 200 µl of TBST. The anti-MPT64 primary antibody (mouse) was diluted in 1% powdered
skim milk in TBST, using a 1:6400 dilution, and 100 µl added to each well. After an incubation of 1
h at room temperature, the wells were washed three times with 200 µl of TBST. The secondary anti-
mouse antibody alkaline phosphatase conjugate (Sigma) was diluted 1:5000 in TBST containing
1% powdered skim milk and 100 µl were added to each well. Incubation with the secondary
antibodies was then carried out at room temperature for 1 h. After 4 washing steps with 200 µl of
TBST, 200 µl of a solution of p-nitrophenyl phosphate (Sigma), diluted in Tris-HCl pH 8.0 to a
final concentration of 1 mg/ml, was added to each well and incubated until the development of a
pale yellow colour. The reaction was stopped by the addition of 50 µl of 3M NaOH to each well.
Absorbance at 405 nm was measured with a microplate reader (Magellan, Tecan).
Evaluation of the protective activity of recombinant BCG. Groups of C57Bl/6 mice were injected
subcutaneously with 5×106 CFU rBCG (HPE-∆MPT64-BCG, 33PE-∆MPT64-BCG, H∆MPT64-
BCG, HPE-BCG, 33PE-BCG) and, as a control, mice were vaccinated with 5×106 CFU BCG Pasteur
on day 0. Ten-weeks following the immunization vaccinated and control mice were infected
aerogenically with about 100 CFU of M. tuberculosis Erdman using a Middlebrook chamber (Glas-
Col, Terre Haute, Ind.) as described previously (34). The vaccinated and control mice were
sacrificed 28 and 70 days after challenge and bacterial colonization of lung and spleen tissues
assessed as described earlier (48). Briefly, to assess the bacterial growth in vivo, five mice per group
were sacrificed, and the lungs and spleens were removed aseptically and homogenized separately in
5 ml of 0.04% Tween 80-PBS using a Seward Stomacher 80 blender (Tekmar, Cincinnati, Ohio).
The homogenates were diluted serially in the Tween-PBS solution, and 50-µl aliquots were plated
on Middlebrook 7H11 agar (Difco, Detroit, Mich.). containing 2-thiophenecarboxylic acid
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 7: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/7.jpg)
7
hydrazide (2 µg/ml). The number of CFU in the infected organs was determined after 14 to 21 days
of incubation at 37° in sealed plastic bags.
For the survival studies, 10 animals per group were immunized and ten weeks later aerogenically
infected with ≈ 100 CFU/animal and maintained until they became moribund and had to be
euthanatized.
Histopathologic analysis. The lung left lobes were perfused and fixed with 10% paraformaldehyde
in PBS and then embedded in paraffin for sectioning. The tissue sections were stained with
hematoxylin and eosin (H&E) reagent or with Ziehl-Neelsen acid-fast stain and were evaluated by
light microscopy. For each lung left lobe at least three section were obtained and for each section
the total surface area and the area with lesions was measured and the average calculated for each
section and for each group (five lung left lobes per group). Measurements were carried out using
the microscope Nikon Eclipse 80i, the camera control unit Nikon DS-L2 and the dedicated software
3422.1001.1798.080117.
T cell receptor repertoire analysis. Repertoire analysis was performed using a modification of a
described protocol (45). 107 spleen derived cells/well were cultured in the presence or absence of 20
µg/ml of recombinant MPT64 for three days in RPMI-1640 medium (Sigma- Aldrich, St Louis,
MO, USA) supplemented with 2 mM L-glutamine, 50 µM 2-ME, 50 µg/ml gentamicin (Sigma-
Aldrich, St Louis, MO, USA), and 10% Foetal Calf Serum (Gibco BRL Life Technologies, Basel,
Switzerland) (complete medium). Total RNA was isolated from cell suspensions using RNeasy
Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instruction. cDNA was
synthesized using an oligo-dT primer (dT15) (Gibco BRL Life Technologies, Basel, Switzerland).
For complete “Immunoscope” analysis (37) cDNA was subjected to PCR amplification using a
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 8: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/8.jpg)
8
common Constant (C) β primer (CACTGATGTTCTGTGTGACA) in combination with the
variable β(BV) primers previously described (47), following the nomenclature of Arden and coll.
(3). Using 2 µl of this product as a template, run-off reactions were performed with a single internal
fluorescent primer for each BJ tested (described previously (47)). These products were then
denatured in formamide and analyzed on an Applied Biosystem 3130 Prism using Gene-mapper
v4.0 software (Applied Biosystem, Foster City, CA, USA). Results are also reported as R.S.I
(relative stimulation index = normalized peak area obtained from cells stimulated with Ag /
normalized peak area of non stimulated cells). According to our experience in other model antigens
(37,47) T cells carrying a TCR rearrangement can be considered expanded in a peptide-driven
manner when RSI is ≥2.
Staining and enrichment of IFN-γ–secreting T cell. MPT64-specific T cells secreting IFN-γ were
stained and enriched from spleen of C57Bl/6 mice (infected as described above) using MACS
secretion kit (Milteny Biotec, Bergisch Gladbach, Germany), according to the manufacturer’s
instruction, following the protocols for enrichment of low frequency secreting cells. Briefly, 1 to
3x107 cells obtained from spleens were stimulated in the absence (background) or in the presence of
20 µg/ml recombinant MPT64, in 6 well plate at a concentration of 5x106 cells/ml. Sixteen hours
later, cells were harvested and submitted to the staining procedure for the cytokine. Samples were
also stained with FITC-labelled anti-CD4 (SouthernBiotech, Birmingham, AL, USA) or CD8
(Invitrogen, Camarillo, CA, USA) antibodies. In order to evaluate correctly the number of MPT64-
specific cells, we examined by FACS 5x105 cells in each background and positive sample. The
number of antigen-specific, cytokine secreting cells is obtained by subtracting the cells staining
positively in the background sample from the number of the same cells in the Ag-stimulated
sample.
Total, negatively selected and positively selected cells were collected and prepared for mRNA
isolation. In order to prevent uncontrolled loss of mRNA due to scarcity of cells, 106 α
-β
- BW cells
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 9: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/9.jpg)
9
were added to the positively selected cells before proceeding with mRNA isolation for the TCR
repertoire analysis.
Intracellular cytokine staining. The following monoclonal antibodies were used for intracellular
staining: FITC-labeled anti-CD4 (SouthernBiotech, Birmingham, AL, USA); FITC-labeled anti-
CD8a (Invitrogen, Camarillo, CA, USA); PE-labeled anti-IFN-γ (clone XMG1.2, BD Pharmingen,
San Diego, CA, USA); PERCP-CY5.5-labeled anti-IL-2 (clone JES6-5H4, BD Pharmingen); APC-
CY7- labeled anti-TNF-a (clone MP6-XT22, BD Pharmingen). The intracellular staining procedure
was performed using the Cytofix/Cytoperm kit with GolgiPlug Kit (BD Pharmingen) according to
manufacturer’s instructions. Briefly, 1x107 cells obtained from spleen of mice infected with BCG
recombinant strains as described above, were stimulated in the absence (background) or in the
presence of 20 µg/ml recombinant MPT64, in 24 well plate at a concentration of 107 cells/ml.
BrefeldinA was added for the last 8 hrs of culture. Samples (5x105 cells in each background and
positive sample) were analyzed on a BD FACScan flow cytometer. The number of antigen-specific
T cells secreting a given cytokine for each mouse was obtained by subtracting the normalized
number of T cells secreting the cytokine in the control sample (i.e. cultured in the absence of
antigen) from the normalized number of T cells secreting the same cytokine in the sample cultured
in the presence of MPT64.
Statistical analysis. Prism 4.0 software (GraphPad Prism version 5.00 for Windows, GraphPad
Software, San Diego, California, USA) was used for statistical analyses of protective activity data.
The data were analyzed using one-way ANOVA and the Tukey’s Multiple Comparison Test was
used for selected pairwise comparisons. Log-rank (Mantel–Cox) tests were performed to compare
the survival curve. Unpaired T test was used for analysis of the data reported in Figure 4 and Figure
7B, and Square Chi test was used for the analysis of the data reported in Table 2. P values of less
than 0,05 were considered significant.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 10: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/10.jpg)
10
Results
In a previous work, we showed that when MPT64 deprived of its signal sequence (∆MPT64) is
expressed in mycobacteria it localizes into the cytoplasm, but when fused at the C-terminus with the
PE domain derived from PE_PGRS33 (PE_∆MPT64), it is surface exposed as determined by
trypsin sensitivity assays, cell fractionation studies and immunogold electron microscopy (11). To
confirm this finding, the cellular localization of these two recombinant proteins in BCG was further
investigated by enzyme-linked immunosorbent assay (ELISA) on whole cells using an anti-MPT64
mouse antiserum. As shown in Figure 1, the PE_∆MPT64 expressing strain (HPE-∆MPT64-BCG)
gave a 3-fold higher signal than that given from the ∆MPT64 expressing strain (H∆MPT64-BCG)
when the expression of these proteins was similar (data not shown). Detection of the ∆MPT64-HA
expressing strain was comparable to that obtained using the wild type parental strain. Taken
together, these data clearly support our previous finding that the PE domain targets the MPT64
protein to the surface of M. bovis BCG.
HPE-∆∆∆∆MPT64-BCG elicits enhanced anti-tuberculous activity. To assess the impact of antigen
cellular localization and load on the immunogenicity of the rBCGs, the different recombinant BCG
strains expressing the model antigen MPT64 in the cytoplasm or at the surface (Table 1) were used
to immunize C57Bl/6 mice, following standard protocols. Ten weeks after a single immunization,
mice were aerogenically infected with a low-dose (≈ 200 CFUs) of M. tuberculosis Erdman. Four
weeks later, mice were sacrificed and lung and spleen tissue removed to determine bacterial loads.
As shown in Figure 2, BCG-immunized mice had a significantly lower mycobacterial load in the
lung (- 0.96 Log CFU/lung) compared to naïve mice. Interestingly, mice immunized with HPE-
∆MPT64-BCG had significantly less bacteria in the lung compared to BCG immunized mice (- 1.69
Log CFU/lung compared to naïve mice and – 0.73 Log CFU/lung compared to the BCG group). A
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 11: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/11.jpg)
11
reduction was also observed in the spleen tissue (Figure 2B) although this reduction was not
statistically significant.
Over-expression of the chimeric antigen is necessary for this enhanced activity, since mice
immunized with 33PE-∆MPT64-BCG, expressing PE_∆MPT64 under the control of the
PE_PGRS33 promoter (5-10 weaker than the hsp60 promoter as previously described (11,17))
showed bacterial loads in the lung and spleen tissues similar to the parental strain. Moreover, mice
immunized with rBCG expressing the PE domain of PE_PGRS33 (HPE-BCG (16) and 33PE-BCG)
had bacterial counts similar to BCG strain, indicating that the over-expression of the PE domain
alone does not contribute to the superior activity of HPE-∆MPT64-BCG.
Mice immunized with BCG over-expressing the MPT64 antigen in the cytoplasm did show lower
bacterial counts in the host tissues compared to naïve mice (p<0,05) but this reduction was not
statistically significant compared to the BCG parental strain (p>0,05). The activity of each of these
rBCG strains was tested in at least another experiments and similar results were obtained. The
attempts to express the MPT64 antigen in the plasmatic membrane or in the secreted form under the
control of the hsp promoter were not successful. In fact, these recombinant strains did not grow
properly in liquid and solid media, probably because over-expression of the antigen in these cellular
compartments was toxic. Conversely, expression of these two chimeras was obtained under the
control of the PE_PGRS33 promoter and mice immunized with these two BCG recombinant strains
had bacterial counts similar to the BCG parental strain (data not shown).
Taken together these results suggest that: a) HPE-∆MPT64-BCG induces an enhanced level of
protective activity against M. tuberculosis infection compared to BCG; b) that this enhanced
activity is dependent upon the MPT64 antigen; and c) that over-expression of the antigen and
localization in the mycobacterial cell wall are both required to provide the enhanced activity.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 12: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/12.jpg)
12
Since only a few recombinant BCG vaccines have been able so far to induce enhanced anti-
tuberculous activity compared to the parental BCG strain (6), the HPE-∆MPT64-BCG was
evaluated in other three independent protection experiment. Mice vaccinated with HPE-∆MPT64-
BCG had consistent and statistically significant (at least p<0,05) lower bacterial counts compared to
the BCG group at day 28 post-infection, and reduction in the lung tissue ranged from 0.38 to 0.75,
while the reduction over naïve mice reached 2.16 Log CFU/lung. A similar pattern was also
observed in the spleen, with mice immunized with HPE-∆MPT64-BCG showing consistently lower
bacterial counts compared to BCG counterparts, although in this case differences were not always
statistically significant. The results of four independent experiments clearly indicate that the HPE-
∆MPT64-BCG induces level of anti-mycobacterial activity superior to those induced by BCG.
Enhanced protection of HPE-∆∆∆∆MPT64-BCG is maintained during the chronic steps of
infection. In the mouse model for TB used in these studies, reduction in terms of bacterial loads
afforded by BCG vaccination is maximal at day 28 post-infection, while at later time points (for
instance day 70) the difference in terms of Log CFU/organ between naïve and BCG-immunized
mice can be less evident (15). To assess the activity of HPE-∆MPT64-BCG in the chronic steps of
infection, immunized and control mice aerogenically infected with M. tuberculosis Erdman (≈200
CFU/animal) were sacrificed 70 days post-infection and bacterial loads assessed as previously
indicated. As shown in Figure 3, mice immunized with HPE-∆MPT64-BCG showed 2.16 Log CFU
reduction in the lung over naïve mice, and 1.08 reduction compared with BCG immunized mice.
Lower bacterial counts were also observed in the spleen, with HPE-∆MPT64-BCG mice showing
0.54 Log CFU less than BCG immunized mice. These results indicate that the superior activity of
HPE-∆MPT64-BCG over BCG is maintained even at 70 days post-infection.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 13: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/13.jpg)
13
Immunization with HPE-∆∆∆∆MPT64-BCG reduces lung involvement compared with BCG
vaccination in M. tuberculosis infected mice. An effective vaccine against M. tuberculosis
infection should induce a specific immune response that would not only control bacterial
colonization but would also result in limited lung involvemente. The lung left lobe was isolated
from immunized and control mice challenged with virulent M. tuberculosis at days 28 and 70 post-
infection, perfused with formalin and subjected to histopathology. For each lung (five lung per
group of immunized mice), at least three sections were subjected to a quantitative microscopic
analysis to objectively assess the extent of the tissue damage. As shown in figure 4, the median
granuloma surface area, the average surface of tissue with lesions, the number of granulomas per
lung left lobe and the ratio between the area with lesions over the total lung surface were
determined. All parameters indicated that the size of granulomas at day 28 post-infection was
significantly reduced in mice immunized with BCG and HPE-∆MPT64-BCG compared with naïve
mice. Indeed, while lung isolated at day 28 from non-immunized mice showed diffused
granulomatous lesions containing many acid fast bacilli, histopathology in BCG and HPE-∆MPT64-
BCG immunized groups was similar, with small lesions containing very few mycobacteria (data not
shown).
Interestingly, at day 70 post-infection, the extent of the lesions appeared smaller in HPE-∆MPT64-
BCG-immunized mice compared not only to naïve mice but also to the BCG immunized group. As
shown in figure 4, mice immunized with HPE-∆MPT64-BCG showed a reduction of the granuloma
size compared with naïve mice but also compared to the BCG immunized group (figure 4A). The
extent of lung involvement was significantly lower in HPE-∆MPT64-BCG compared to BCG as
demonstrated by measuring the total surface area with lesions (figure 4 B, p<0,001) and the percent
of tissue with lesions over the total area (figure 4D, p<0,001) and this despite the fact that a similar
number of granulomas per lung left lobe was found in the two BCG-immunized group (figure 4C).
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 14: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/14.jpg)
14
Representative slides showing the extent of lung involvement and the type of cellular infiltrate are
shown in figure 4E and confirm that the majority of lung was healthy in mice receiving HPE-
∆MPT64-BCG and indicate that the presence of acid-fast bacilli in these lesions was more frequent
in the BCG group compared to the HPE-∆MPT64-BCG. Overall, the results obtained indicate that
the activity of HPE-∆MPT64-BCG is superior to that of the BCG parental strain at day 70 post-
infection, in terms of bacterial loads and extension of lung involvement.
To further assess the anti-tuberculous activity of the rBCG under study, groups of 10 mice were
immunized with HPE-∆MPT64-BCG and BCG, or left non immunized and then infected with a
low-dose of M. tuberculosis Erdman. A statistically significant protection as measured by the
extension of the median survival time was observed between the two BCG-vaccinated groups and
naïve mice, but no statistically significant difference among the two BCG-vaccinated groups were
measured (Figure 5).
Cytokine production and persistence of MPT64-specific CD4+ and CD8+ T cells following
infection with MPT64-expressing live BCG strains. To identify potential immunological
correlates of protection, we examined the presence of CD4+ and CD8+ T cells secreting IFN-γ
following vaccination in response to stimulation with MPT64. Groups of 6 to 10 mice were injected
s.c. with live BCG strains. Mice were sacrificed at day 15 post-infection, cells were isolated from
the spleen and cultured in vitro in the absence or presence of 10 µg/ml of recombinant MPT64.
Sixteen hours later cells were stained with the MACS® IFN-γ secretion assay and FITC labelled
anti-CD4 or anti-CD8 monoclonal antibodies and cells secreting IFN-γ in antigen dependent
manner were counted by FACS. Results are reported in Figure 6 (left column). The average +2SD
value obtained in mice vaccinated with the control strain 33PE-BCG (expressing the PE domain
alone) was used to establish the threshold level for a specific response to MPT64. At day 15 post-
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 15: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/15.jpg)
15
vaccination, all mice infected with HPE-∆MPT64-BCG showed a robust (although variable among
individual absolute values) response to MPT64 in both CD4+ (average 8,55x103 cells /10
6 CD4
+
cells) and CD8+ cells (average 4,26 x103 cells /10
6 CD8
+ cells). At this time point, MPT64-specific
CD4+ cells were more numerous than CD8+ cells. At the same time, 2 out of 3 mice infected with
33PE-∆MPT64-BCG, that expresses the antigen chimera PE_MPT64 under the control of a weaker
promoter, showed levels of response comparable to that obtained with HPE-∆MPT64-BCG at day
15 (average 6,7 x103 cells /10
6 CD4
+ cells, and 12,38 x10
3 cells /10
6 CD8
+ cells respectively).
Consistently positive although slightly lower values were obtained in mice infected with strain
H∆MPT64-BCG, in which MPT64 localized in the cytoplasm (average 1,98 x103 cells /10
6 CD4
+
cells and 3,31x103 cells /10
6 CD8
+ cells.
In order to test the role of T cells secreting IL-2 or TNF-α or the combination of two or more
cytokines among IFN-γ, IL-2 and TNF-α in our model, intracellular staining for these cytokines
was performed in spleenocytes isolated from immunized mice. Four groups of 5 to 6 mice were
immunized as previously described and two weeks later spleen cells were obtained and cultured in
the presence or absence of MPT64. The staining for intracellular IFN-γ, IL-2 and TNF-α was
performed as described in Materials and Methods. Results for each single cytokines are reported in
Figure 7A. Here, each dot represent the value obtained from the sample cultured in the presence of
MPT64 subtracted of that obtained from the same sample in the absence of antigen (control). The
number of CD4+ cells secreting IFN-γ or IL-2 observed with this technical approach overlapped that
obtained using the MACS® IFN-γ secretion assay for mice vaccinated with HPE-∆MPT64-BCG
and H∆MPT64-BCG. However, the values obtained for 33PE-∆MPT64-BCG and for CD8+ cells
(not shown) were sensibly lower than those obtained with the MACS secretion assay and especially
for CD8+ cells they were not distinguishable from those obtained in mice infected with the control
strain 33PE-BCG. Values obtained using intracellular staining were obtained by cumulating the
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 16: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/16.jpg)
16
secretion of cytokines during the first 16 hours of stimulation; vice versa, the MACS® secretion
assay focuses on cytokines secreted after 16 hours of stimulation with the antigen, for a relatively
short period. The discrepancy between values obtained with the two tests may therefore reflect
differences in the kinetic of IFN-γ secretion between CD4 and CD8 cells and among the various
protocols of vaccination. Finally, the number of TNF-α-secreting CD4+ cells in mice vaccinated
with H∆MPT64-BCG and HPE-∆MPT64-BCG was approximately one tenth of those secreting IFN-
γ and IL-2 in the same groups.
Next, the ability of MPT64-specific CD4+ T cells to secrete multiple cytokines was evaluated (1)
and an example of the assay performed is shown in the upper panel of Figure 7B. We calculated the
composition of the population of CD4+ cytokine secreting T cells in each sample obtained after
stimulation with MPT64, independently from the fact that the number was actually higher than that
obtained in absence of antigen-stimulation. Thus, values obtained from 33PE-BCG immunized mice
provide a view of the background composition of the T cell population. The distribution of the
various population of “MPT64-specific” T cells upon vaccination with the various rBCG strains is
shown in the lower panels of Figure 6B, as pie chart. CD4+ cells secreting TNF-α and IFN-γ were
detected in some samples of the three groups of mice immunized with rBCG strains expressing
MPT64, but not in the control mice (33PE-BCG). However, the large variability among individual
mice was such that in no case this difference was statistically significant. Intriguingly, CD4+ T
cells secreting IFN-γ and IL-2 were found in larger proportion in mice HPE-∆MPT64-BCG
immunized mice than in those immunized with 33PE-BCG (p=0.011). A similar over-representation
of this population was found in the H∆MPT64-BCG group, where it however fell short from being
statistically significant (p=0.08) due to individual variability. As a final observation, the average
total number of CD4+ T cells secreting cytokines in response to MPT64 was similar in the HPE-
∆MPT64-BCG group (2.9x104/10
6 CD4
+ cells) and in the H∆MPT64-BCG (2.7x10
4/10
6 CD4
+
cells), while it was close to zero in the control 33PE-BCG group (-0.1x104/10
6 CD4
+ cells).
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 17: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/17.jpg)
17
Since mice were challenged with M. tuberculosis at week 11 after vaccination, we examined the
presence of CD4+ and CD8+ T cells secreting IFN-γ in response to stimulation with MPT64 also at
day 77 post vaccination. Results are shown in Figure 6 (right column), and indicate that the CD4+
mediated response had strongly declined in all of the groups. Mice vaccinated with 33PE-∆MPT64-
BCG and H∆MPT64-BCG as well as 2 out of 3 mice vaccinated with HPE-∆MPT64-BCG did not
show a number of MPT64-specific CD4+ cells different from that of mice immunized with the
control strain 33PE-BCG. On the contrary, the CD8-mediated response appeared to be better
conserved within the HPE-∆MPT64-BCG group (average 9,67x103 cells /10
6 CD8
+ cells), showing
values still comparable to those obtained at day 15 and higher than H∆MPT64-BCG (average
1,740,5 x103 cells /10
6 CD8
+ cells) and 33PE-∆MPT64-BCG (average 0,55 x10
3 cells /10
6 CD8
+
cells).
Analysis of T cell repertoires involved in response to MPT64 shows that HPE-∆∆∆∆MPT64-BCG
selectively activates T cells carrying a shared BV8.3-BJ1.5 rearrangement. The T cell
repertoire involved in the response to MPT64 was analyzed by means of the BV-BJ spectratyping
(the so-called “immunoscope”). Following the procedure described in (47), we pooled the cDNAs
obtained from MPT64-stimulated spleen cells of three mice 15 days after vaccination with HPE-
∆MPT64-BCG. Pooled cDNAs were then submitted to a complete immunoscope analysis in which
the 288 Vβ-Jβ primer combinations were used to perform the first CDR3 length fragment analysis.
In this analysis each CDR3-β profile can be depicted as a function of the CDR3 length. Each peak
represents a 3 b difference in the product of recombination corresponding to one amino acid
residue. In non-vaccinated mice, most peak patterns display a Gaussian distribution. 56
combinations however displayed the presence of one peak that altered such a Gaussian distribution
(Figure 7A, black areas). We then examined these BV-BJ recombinations on cDNAs obtained from
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 18: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/18.jpg)
18
7 individual mice, comparing the MPT64-stimulated sample with the un-stimulated sample from
each individual mouse. We thus found that 4 rearrangements, each characterized by recombination
of a BV, a BJ and a base length, that expanded in response to MPT64, were used frequently in mice
vaccinated with HPE-∆MPT64-BCG. The four rearrangements were BV3.1-BJ2.2 of 127b, BV5.2-
BJ21.6 of 178b, BV8.3-BJ1.5 of 172b and BV20-BJ2.1 of 118b. Data are reported in Table 2, and
examples are shown in Figure 7B.
We next examined the association of each of the shared rearrangements with T cells secreting IFN-γ
in response to stimulation of spleen cells with recombinant MPT64. In four distinct experiments,
spleen cells obtained from mice vaccinated with HPE-∆MPT64-BCG were stimulated with
recombinant MPT64 and IFN- γ secreting cells were enriched as described previously (37). In two
experiments, cells from three mice were pooled and examined; in the other two experiments cells
from a total of 6 mice were examined individually. Results are reported in Table 3. Rearrangements
BV5.2-BJ21.6 of 178b and BV8.3-BJ1.5 of 172b were consistently associated with IFN-γ secreting
cells, indicating that cells carrying these rearrangements secreted IFN- γ when re-stimulated with
MPT64. Finally, we examined the ability of strains 33PE-∆MPT64-BCG and H∆MPT64-BCG to
activate T cells carrying these shared TCRs. Results are shown in Table 2. T cells carrying
rearrangement BV3.1-BJ2.2 of 127b are recruited in mice vaccinated with all tested strains.
Vaccination with H∆MPT64-BCG and 33PE-∆MPT64-BCG failed to recruit BV8.3-BJ1.5 of 172b.
Also T cells carrying the BV5.2-BJ1.6 of 178b TCR were not recruited following vaccination with
H∆MPT64-BCG. Recruitment of T cells carrying TCR-b chains BV20-BJ1.6 (118b) and BV3.1-
BJ2.2 (127b) was reduced after vaccination with H∆MPT64-BCG and 33PE-∆MPT64-BCG,
respectively, although reduction did not reach statistical significance. Taken together, these data
suggest that protection associates with ability to recruit the IFN-γ secreting T cells carrying the
BV8.3-BJ1.5 of 172b shared rearrangement.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 19: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/19.jpg)
19
Discussion
The superior activity of HPE-∆MPT64-BCG over the parental strain is remarkable when compared
to that of other rBCG vaccines tested in similar experimental settings. Two rBCGs expressing the
ESAT6 antigen, in the secreted form or in the cytosol, were shown to be as safe as the parental
strain, but did not provide enhanced immunogenicity nor anti-tuberculous activity (4), and this
despite the fact that ESAT6 is one of the most promising subunit vaccine candidate antigens
(34,35). Overexpression in BCG of the immunodominant secreted antigen Ag85B (28) has shown
enhanced protection over BCG in the guinea pig model and recently this vaccine was shown to be
more immunogenic and safe in human clinical trials (26). Moreover, a rBCG overexpressing
Ag85C was shown to induce enhanced and enduring protection against TB in a guinea pig model of
TB (30). However, when a rBCG overexpressing Ag85B was tested in the mouse model, no
differences in terms of anti-tuberculous activity were observed (43), suggesting that in mice, which
are more resistant to TB than guinea pigs, the enhanced activity of rBCG Ag85B/C could not be
observed.
In this report, a new recombinant BCG strain expressing the candidate antigen MPT64 on the
bacterial surface was developed using a recently described PE-based mycobacterial surface-delivery
system (11). We confirmed that the PE_∆MPT64 chimera expressed in a live M. bovis BCG strain
(HPE-∆MPT64-BCG) is exposed on the mycobacterial surface. Immunization of mice with this live
recombinant BCG strain induced a level of protection against M. tuberculosis that was significantly
superior to the that induced by the parental BCG as assessed by enumeration of CFUs and
histopathological analysis. Moreover, the enhanced protection conferred by HPE-∆MPT64-BCG
correlates with the induction of IFN-γ expressing CD4 and CD8 cells and the emergence of an
MPT64 specific T cell clone.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 20: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/20.jpg)
20
Superior vaccine efficacy was observed in mice with the rBCG expressing the membrane-
perforating listeriolysin (∆ureC hly+ rBCG strain) and the enhanced activity correlated with
improved cross-priming, which caused enhanced T cell-mediated immunity (23). Another rBCG
strain (AFRO-1) expressing perfringolysin O and overexpressing key immunodominant M.
tuberculosis antigens provided slightly enhanced activity in terms of survival in mice infected with
the clinical M. tuberculosis strain HN878, but did not demonstrate a reduction in mycobacterial
loads in the lungs and spleens compared to the parent BCG strain (52). To our knowledge, the
protective activity induced by HPE-∆MPT64-BCG in the mouse model of TB ranks this new
vaccine among the most effective so far tested in the mouse TB challenge model. It would be of
great interest to perform the protection assays in the guinea pig and non-human primate models of
M. tuberculosis infection.
Lipoarabinomann, arabinogalactan and other sugars; mycolic acids, glycolipids and phenolic lipids,
together with peptidoglycan are the main components of the mycobacterial cell wall. It is well
established that the mycobacterial cell wall is a very immunogenic component with strong
immunostimulatory properties as classically highlighted by the use of the Freund’s adjuvant, that is
made of oleic acid and heat killed M. tuberculosis. The adjuvant properties are linked to the pro-
inflammatory activity of these molecules that induce TNF, IL-6, IL-1, IL-12, and trigger
upregulation of MHC-II and CD1d1 on macrophages (21). To enhance the immune response
specifically induced against the recombinant antigen expressed by BCG, we aimed at expressing a
protein antigen, MPT64, in the context of the mycobacterial cell wall.
Localization of the MPT64 protein on the BCG surface, in tight association with the mycobacterial
cell wall, was achieved using a PE-based delivery system that we recently developed (11), and
resulted in enhanced immunogenicity and protective activity of the recombinant BCG. When the
MPT64 was overexpressed in the cytoplasm, or associated to the inner membrane, or secreted out of
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 21: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/21.jpg)
21
the cell, we could not obtain a similar anti-tuberculous activity. Nevertheless, in line with previous
studies (25), overexpression of the PE_∆MPT64 chimera was necessary, since mice immunized
with 33PE-∆MPT64-BCG did not show enhanced protection over the BCG group. Moreover, since
overexpression of the PE domain only did not provide enhanced activity to BCG, we conclude that
association of MPT64 with the mycobacterial cell wall enhances the antigen specific
immunogenicity and contributes to the superior activity of HPE-∆MPT64-BCG over the other rBCG
expressing MPT64.
Indeed, antigen-specific immune response determined in mice immunized with the different rBCGs
was shown to be dependent upon MPT64 cellular localization. In particular, we show that HPE-
∆MPT64-BCG is able to sustain an MPT64-specific CD8-mediated response over time, much more
effectively than 33PE-∆MPT64-BCG and H∆MPT64-BCG, despite all three strain induce similar
numbers of CD8+ specific cells early after vaccination. On the contrary, the number of IFN-γ
secreting MPT64-specific CD4+ cells declines to similar levels in mice compared with all tested
BCG strains. Thus, the number of CD4+ or CD8+ MPT64-specific cells induced early after
vaccination does not appear to correlate with protection. We also find that the number of CD4+ T
cells secreting IFN-γ and IL2 in response to stimulation with MPT64 is more constantly increased
following immunization with HPE-∆MPT64-BCG than with the other BCG strains. It may be
suggested that IL-2 secretion by these cells plays a role in favouring survival of CD8+ cells while
IFN-γ helps to maintain the secretion of type1 cytokines.
It has been reported that protection from infection with SIV in monkeys correlates with the ability
to recruit one specific T cell repertoire, more than to a global immune response (41). Similarly, we
have shown that T cell repertoires are different in pathogenic and non-pathogenic autoimmune
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 22: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/22.jpg)
22
responses in human disease and experimental models (40,46). We therefore asked if cell
localization (HPE-∆MPT64-BCG versus H∆MPT64-BCG) and amount of antigen produced (HPE-
∆MPT64-BCG versus 33PE-∆MPT64-BCG) impact on T cell repertoire selection, and if differences
in the composition of the MPT64-specific repertoire were correlated with protection. The results
reported in Table 2 clearly draw the attention to the failure of both 33PE-∆MPT64-BCG and
H∆MPT64-BCG to recruit T cells carrying the BV8.3-BJ1.5 of 172b length compared to HPE-
∆MPT64-BCG. The relevance of this observation is further increased by data reported in Table 3,
showing that these cells are consistently associated with antigen driven IFN-γ secretion.
The avidity of a TCR for its ligand is one of the factors that determine the secretory phenotype
acquired by a T cell upon activation. In particular, cells with TCR showing high avidity for an
MHC/peptide complex are biased to differentiate into Th1 cells (8,9,29). The fact that T cells
carrying the BV8.3-BJ1.5 of 172b length rearrangement secrete IFN-γ even upon Th2-promoting
conditions (unpublished results) suggests that they may recognize with high affinity an epitope
derived from MPT64. However, the same cells are not recruited by the PE_∆MPT64, when it is
expressed under the control of a weaker promoter in the 33PE-∆MPT64-BCG strain. A possible
explanation for this result is that the specific T cell epitope induced by these live BCG strains
behave as a “subdominant” epitope. If this is the case, dendritic cells will present it efficiently when
infected by the high-expressing HPE-∆MPT64-BCG strain, but fail to present it at a level sufficient
for T cell priming when infected by the low-expressing 33PE-∆MPT64-BCG strain. More in depth
studies are required to identify and characterize the immunological correlates of protection,
specifically during infection. It would be of interest for instance to monitor the emergence of the
MPT64-specific T cell clones identified in this study in the spleen and lung tissue at different time
points following M. tuberculosis infection in naïve versus BCG and HPE-∆MPT64-BCG
immunized mice and determine how these correlates with the degree of disease.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 23: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/23.jpg)
23
Several studies have shown that cellular localization of the heterologous protein expressed by a
rBCG affects the antigen-specific immune response elicited (for a review see ref. (18)). Previous
attempts to deliver an antigen to the mycobacterial cell wall relied mostly on the use of the 19kDa-
lipoprotein signal sequence (22,51). The 19kDa lipoprotein has immunomodulatory properties, has
been implicated in the downregulation of immune effector mechanisms of the host (38) and it has
been demonstrated that overexpression of 19 kDa antigen in BCG abrogates the protective activity
of BCG due to a polarization of the host immune response towards Th2 (44). Indeed, immunization
of mice with rBCG expressing the outer surface protein A (OspA) of Borrelia burgdorferi as a
membrane-associated lipoprotein resulted in protective antibody response that was 100-1000 fold
higher than the response elicited by immunization with rBCG expressing the same antigen in the
cytoplasm or as a secreted fusion protein (51). Similar results were also observed when proteins of
the porcine reproductive and respiratory syndrome virus (7) or pneumococcal surface protein A (33)
were expressed as 19 Kda-fusion proteins on the mycobacterial surface. In this study,
immunization with HPE-∆MPT64-BCG did not induce specific humoral response against MPT64
but rather elicited a higher and more persistent CD8 T cell response compared to that induced by
the other rBCG expressing MPT64 in other cellular compartments. These results underline the
usefulness of the PE-delivery system for the expression of heterologous antigens in BCG for which
a strong cell mediated immune response is pursued.
Acknowledgment
This work has been supported by an E.U. 6th Framework grant (“Innovac” project; LSH-2005-036871) to
G.D. and R.M and by the italian MIUR (2007BEP8WH) to G.F. We would like to thank Dr. Maria
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 24: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/24.jpg)
24
Emiliana Caristo and the staff at the animal facility at the Catholic University of the Sacred Hearth for the
professional support provided. We also thank Michael J. Brennan for the helpful insights provided during
the experiments and for careful reviewing the manuscript.
Figure legends
Figure 1. Whole cells ELISA on M. bovis BCG wild type or recombinant BCG expressing
PE_∆MPT64 or ∆MPT64HA. The assay was developed using an anti-MPT64 mouse antiserum as
primary antibody
Figure 2: Protective activity induced by a series of rBCG strains expressing the MPT64 antigen in
different cellular compartments or expressing the PE domain only. Immunized and control mice
were infected 10 weeks post-immunization with M. tuberculosis Erdman. 28 days later mice were
sacrificed and lung and spleen bacterial load were determined by CFU counting. A) Lung; B)
Spleen. (* p < 0,05 Naïve vs. vaccinated groups; ** p< 0,05 BCG vs. HPE-∆MPT64-BCG).
Figure 3: Protective activity induced by the HPE-∆MPT64-BCG strain at day 70 post-infection.
Immunized and control mice were infected 10 weeks post-immunization with M. tuberculosis
Erdman. 70 days later mice were sacrificed and lung and spleen bacterial load were determined by
CFU counting. A) Bacterial loads at day 70 in the lung and spleen tissue (* p < 0,05 Naïve vs.
vaccinated groups; ** p< 0,05 BCG vs. HPE-∆MPT64-BCG).
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 25: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/25.jpg)
25
Figure 4: Histopathological analysis carried out on lung tissue of mice immunized with the various
BCG strains and infected with M. tuberculosis. The lung left lobes were removed, fixed and stained
with H&E. Extension of the tissue damage was assessed by determining: A) Median granuloma
surface area; B) Median total tissue surface area with lesions; C) Median number of granulomas per
lung left lobe; D) ratio between the tissue surface area with lesions and the total area (expressed in
%). At least three section per lung, and five lungs per group were analyzed as indicated in materials
and methods. Statistical nalysis was performed using the ttest (* p<0,05 versus naïve group;
**p<0,01 versus BCG group; E) Histopathological analysis performed on lung tissues isolated
from mice obtained 70 days following aerogenic challenge with M. tuberculosis Erdman.
Representative slides are shown for mice immunized with BCG, HPE-∆MPT64-BCG and Naïve.
Magnification is 40X, 200X and 400X from top to bottom.
Figure 5. Survival of vaccinated and control mice following a low-dose aerogenic challenge with
the virulent Mtb Erdman strain. Ten mice per group were used in this experiment. Log-rank
(Mantel – Cox) tests were performed to compare survival curves. Naïve (•) vs. BCG (�) and HPE-
∆MPT64-BCG (�) mice were statistically different (p<0.05).
Figure 6: Induction and persistence of MTP64-specific type 1 CD4+ and CD8+ cells. C57Bl/6 mice
were vaccinated with HPE-∆MPT64-BCG, 33PE-∆MPT64-BCG and H∆MPT64-BCG or with the
control 33PE-BCG strains. Spleen cells were obtained 2 or 11 weeks after vaccination, and the
number of T cells secreting IFN-γ in response to stimulation with MPT64 was assessed as described
in Materials and Methods. Each dot represents an individual mouse. The dashed line represents the
average +2 SD of the value obtained in mice vaccinated with the control strain 33PE-BCG.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 26: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/26.jpg)
26
Fig. 7: Analysis of multifunctional CD4+ T cells specific for MPT64. Four groups of mice were
infected with 33PE-BCG (5 mice), HPE-∆MPT64-BCG (6 mice), 33PE-∆MPT64-BCG (5 mice) and
H∆MPT64-BCG (6 mice). Fifteen days later, spleen cells were obtained and cultured for 16h in the
absence or presence of MPT64. BrefeldinA was added for the last 8 hr of culture. Cells were then
stained for CD4 and for intracellular IFN-γ, IL-2 and TNF-α. A) MPT64-driven secretion of each
tested cytokine. Each dot represents the value of MPT64-specific CD4+ cell (number of cells
secreting the cytokine in the presence of MPT64 minus the number obtained in the sample cultured
in the absence of added antigen) for a single mouse. In the cases in which the value was negative, it
is reported as a 0. B) Evaluation of multifunctional T cells in MPT64-stimulated samples. Upper
panels: exemplificative analysis of one sample; numbers (1-6) refer each population to the color
code of the pie charts, reported in the lower panels. Pie charts: distribution of cytokine secretion of
the CD4+ T cells in MPT64-stimulated samples. Areas report the average proportion of each
functional population in each group of mice described above.
Figure 8: Immunoscope analysis of the response to MPT64. A) C57Bl/6 mice were vaccinated with
HPE-∆MPT64-BCG. Two weeks later spleen cells were obtained and cultured in the presence or
absence of MPT64. mRNA and cDNA were prepared and pooled. A complete immunoscope was
performed as described in Materials and Methods. Black squares indicate those spectra showing an
alteration of the Gaussian distribution of CDR3 length for the BV-BJ rearrangement. B) Examples
of the spectra obtained for the indicated shared rearrangements obtained culturing spleen cells in the
absence or presence of MPT64. Peaks corresponding to the expanded shared rearrangements are
shaded.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 27: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/27.jpg)
27
References
1. Aagaard, C., T. T. Hoang, A. Izzo, R. Billeskov, J. Troudt, K. Arnett, A. Keyser, T.
Elvang, P. Andersen, and J. Dietrich. 2009. Protection and polyfunctional T cells induced
by Ag85B-TB10.4/IC31 against M. tuberculosis is highly dependent on the antigen dose.
PLoS. ONE. 4:e5930.
2. Andersen, P. and T. M. Doherty. 2005. The success and failure of BCG - implications for a
novel tuberculosis vaccine. Nat. Rev. Microbiol. 3:656-662.
3. Arden, B., S. P. Clark, D. Kabelitz, and T. W. Mak. 1995. Mouse T-cell receptor variable
gene segment families. Immunogenetics 42:501-530.
4. Bao, L., W. Chen, H. Zhang, and X. Wang. 2003. Virulence, immunogenicity, and
protective efficacy of two recombinant M. bovis bacillus Calmette-Guerin strains expressing
the antigen ESAT-6 from M. tuberculosis. Infect. Immun. 71:1656-1661.
5. Barker, L. F., M. J. Brennan, P. K. Rosenstein, and J. C. Sadoff. 2009. Tuberculosis
vaccine research: the impact of immunology. Curr. Opin. Immunol. 21:331-338.
6. Bastos, R. G., S. Borsuk, F. K. Seixas, and O. A. Dellagostin. 2009. Recombinant M. bovis
BCG. Vaccine 27:6495-6503.
7. Bastos, R. G., O. A. Dellagostin, R. G. Barletta, A. R. Doster, E. Nelson, and F. A.
Osorio. 2002. Construction and immunogenicity of recombinant M. bovis BCG expressing
GP5 and M protein of porcine reproductive respiratory syndrome virus. Vaccine 21:21-29.
8. Blander, J. M., D. B. Sant'Angelo, K. Bottomly, and C. A. Janeway, Jr. 2000. Alteration
at a single amino acid residue in the T cell receptor alpha chain complementarity determining
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 28: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/28.jpg)
28
region 2 changes the differentiation of naive CD4 T cells in response to antigen from T helper
cell type 1 (Th1) to Th2. J. Exp. Med. 191:2065-2074.
9. Boyton, R. J. and D. M. Altmann. 2002. Is selection for TCR affinity a factor in cytokine
polarization? Trends Immunol. 23:526-529.
10. Brennan, M. J., U. Fruth, J. Milstien, R. Tiernan, N. S. de Andrade, and L. Chocarro.
2007. Development of new tuberculosis vaccines: a global perspective on regulatory issues.
PLoS. Med. 4:e252.
11. Cascioferro, A., G. Delogu, M. Colone, M. Sali, A. Stringaro, G. Arancia, G. Fadda, G.
Palu, and R. Manganelli. 2007. PE is a functional domain responsible for protein
translocation and localization on mycobacterial cell wall. Mol. Microbiol. 66:1536-1547.
12. Colditz, G. A., T. F. Brewer, C. S. Berkey, M. E. Wilson, E. Burdick, H. V. Fineberg, and
F. Mosteller. 1994. Efficacy of BCG vaccine in the prevention of tuberculosis. Meta- analysis
of the published literature . JAMA 271:698-702.
13. Delogu, G. and G. Fadda. 2009. The quest for a new vaccine against tuberculosis. J. Infect.
Dev. Ctries. 3:5-15.
14. Delogu, G., A. Howard, F. M. Collins, and S. L. Morris. 2000. DNA Vaccination against
Tuberculosis: Expression of a Ubiquitin- Conjugated Tuberculosis Protein Enhances
Antimycobacterial Immunity. Infect. Immun. 68:3097-3102.
15. Delogu, G., A. Li, C. Repique, F. Collins, and S. L. Morris. 2002. DNA vaccine
combinations expressing either tissue plasminogen activator signal sequence fusion proteins
or ubiquitin-conjugated antigens induce sustained protective immunity in a mouse model of
pulmonary tuberculosis. Infect. Immun. 70:292-302.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 29: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/29.jpg)
29
16. Delogu, G., C. Pusceddu, A. Bua, G. Fadda, M. J. Brennan, and S. Zanetti. 2004.
Rv1818c-encoded PE_PGRS protein of M. tuberculosis is surface exposed and influences
bacterial cell structure. Mol. Microbiol. 52525252:725-733.
17. Delogu, G., M. Sanguinetti, C. Pusceddu, A. Bua, M. J. Brennan, S. Zanetti, and G.
Fadda. 2006. PE_PGRS proteins are differentially expressed by M. tuberculosis in host
tissues. Microbes. Infect. 8:2061-2067.
18. Dennehy, M. and A. L. Williamson. 2005. Factors influencing the immune response to
foreign antigen expressed in recombinant BCG vaccines. Vaccine 23:1209-1224.
19. Derrick, S. C., T. H. Evering, V. K. Sambandamurthy, K. V. Jalapathy, T. Hsu, B. Chen,
M. Chen, R. G. Russell, A. P. Junqueira-Kipnis, I. M. Orme, S. A. Porcelli, W. R.
Jacobs, Jr., and S. L. Morris. 2007. Characterization of the protective T-cell response
generated in CD4-deficient mice by a live attenuated M. tuberculosis vaccine. Immunology
120:192-206.
20. Dietrich, J., C. Aagaard, R. Leah, A. W. Olsen, A. Stryhn, T. M. Doherty, and P.
Andersen. 2005. Exchanging ESAT6 with TB10.4 in an Ag85B fusion molecule-based
tuberculosis subunit vaccine: efficient protection and ESAT6-based sensitive monitoring of
vaccine efficacy. J. Immunol. 174:6332-6339.
21. Flynn, J. L. and J. Chan. 2005. What's good for the host is good for the bug. Trends
Microbiol. 13:98-102.
22. Grode, L., M. Kursar, J. Fensterle, S. H. Kaufmann, and J. Hess. 2002. Cell-mediated
immunity induced by recombinant M. bovis Bacille Calmette-Guerin strains against an
intracellular bacterial pathogen: importance of antigen secretion or membrane-targeted antigen
display as lipoprotein for vaccine efficacy. J. Immunol. 168:1869-1876.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 30: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/30.jpg)
30
23. Grode, L., P. Seiler, S. Baumann, J. Hess, V. Brinkmann, E. A. Nasser, P. Mann, C.
Goosmann, S. Bandermann, D. Smith, G. J. Bancroft, J. M. Reyrat, S. D. van, B.
Raupach, and S. H. Kaufmann. 2005. Increased vaccine efficacy against tuberculosis of
recombinant M. bovis bacille Calmette-Guerin mutants that secrete listeriolysin. J. Clin. Invest
115:2472-2479.
24. Hess, J., D. Miko, A. Catic, V. Lehmensiek, D. G. Russell, and S. H. Kaufmann. 1998. M.
bovis Bacille Calmette-Guerin strains secreting listeriolysin of Listeria monocytogenes. Proc.
Natl. Acad. Sci. U. S. A 95:5299-5304.
25. Himmelrich, H., R. Lo-Man, N. Winter, P. Guermonprez, C. Sedlik, M. Rojas, D.
Monnaie, M. Gheorghiu, M. Lagranderie, M. Hofnung, B. Gicquel, J. M. Clement, and
C. Leclerc. 2000. Immune responses induced by recombinant BCG strains according to level
of production of a foreign antigen: malE. Vaccine 18:2636-2647.
26. Hoft, D. F., A. Blazevic, G. Abate, W. A. Hanekom, G. Kaplan, J. H. Soler, F. Weichold,
L. Geiter, J. C. Sadoff, and M. A. Horwitz. 2008. A new recombinant bacille Calmette-
Guerin vaccine safely induces significantly enhanced tuberculosis-specific immunity in
human volunteers. J. Infect. Dis. 198:1491-1501.
27. Horwitz, M. A. and G. Harth. 2003. A new vaccine against tuberculosis affords greater
survival after challenge than the current vaccine in the guinea pig model of pulmonary
tuberculosis. Infect. Immun. 71:1672-1679.
28. Horwitz, M. A., G. Harth, B. J. Dillon, and S. Maslesa-Galic'. 2000. Recombinant bacillus
calmette-guerin (BCG) vaccines expressing the M.tuberculosis 30-kDa major secretory
protein induce greater protective immunity against tuberculosis than conventional BCG
vaccines in a highly susceptible animal model. Proc. Natl. Acad. Sci. U. S. A 97:13853-
13858.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 31: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/31.jpg)
31
29. Iezzi, G., E. Scotet, D. Scheidegger, and A. Lanzavecchia. 1999. The interplay between the
duration of TCR and cytokine signaling determines T cell polarization. Eur. J. Immunol.
29:4092-4101.
30. Jain, R., B. Dey, N. Dhar, V. Rao, R. Singh, U. D. Gupta, V. M. Katoch, V. D.
Ramanathan, and A. K. Tyagi. 2008. Enhanced and enduring protection against tuberculosis
by recombinant BCG-Ag85C and its association with modulation of cytokine profile in lung.
PLoS. ONE. 3:e3869.
31. Jeon, C. Y., S. H. Hwang, J. H. Min, D. R. Prevots, L. C. Goldfeder, H. Lee, S. Y. Eum,
D. S. Jeon, H. S. Kang, J. H. Kim, B. J. Kim, D. Y. Kim, S. M. Holland, S. K. Park, S. N.
Cho, C. E. Barry, III, and L. E. Via. 2008. Extensively drug-resistant tuberculosis in South
Korea: risk factors and treatment outcomes among patients at a tertiary referral hospital. Clin.
Infect. Dis. 46:42-49.
32. Koenig, R. 2008. Drug-resistant tuberculosis. In South Africa, XDR TB and HIV prove a
deadly combination. Science 319:894-897.
33. Langermann, S., S. R. Palaszynski, J. E. Burlein, S. Koenig, M. S. Hanson, D. E. Briles,
and C. K. Stover. 1994. Protective humoral response against pneumococcal infection in mice
elicited by recombinant bacille Calmette-Guerin vaccines expressing pneumococcal surface
protein A. J. Exp. Med. 180:2277-2286.
34. Li, Z., A. Howard, C. Kelley, G. Delogu, F. Collins, and S. Morris. 1999. Immunogenicity
of DNA vaccines expressing tuberculosis proteins fused to tissue plasminogen activator signal
sequences. Infect. Immun. 67:4780-4786.
35. Malin, A. S., K. Huygen, J. Content, M. Mackett, L. Brandt, P. Andersen, S. M. Smith,
and H. M. Dockrell. 2000. Vaccinia expression of M. tuberculosis-secreted proteins: tissue
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 32: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/32.jpg)
32
plasminogen activator signal sequence enhances expression and immunogenicity of M.
tuberculosis Ag85. Microbes. Infect. 2:1677-1685.
36. McShane, H., R. Brookes, S. C. Gilbert, and A. V. Hill. 2001. Enhanced immunogenicity of
CD4(+) t-cell responses and protective efficacy of a DNA-modified vaccinia virus Ankara
prime-boost vaccination regimen for murine tuberculosis. Infect. Immun. 69:681-686.
37. Nicolo, C., S. G. Di, M. Orsini, S. Rolla, S. Columba-Cabezas, S. Romano, V, G.
Ricciardi, B. M. Chan, and F. Ria. 2006. M. tuberculosis in the adjuvant modulates the
balance of Th immune response to self-antigen of the CNS without influencing a "core"
repertoire of specific T cells. Int. Immunol. 18:363-374.
38. Pai, R. K., M. Convery, T. A. Hamilton, W. H. Boom, and C. V. Harding. 2003. Inhibition
of IFN-γ-induced class II transactivator expression by a 19-kDa lipoprotein from M.
tuberculosis: a potential mechanism for immune evasion. J. Immunol. 171:175-184.
39. Pavelka, M. S., Jr., B. Chen, C. L. Kelley, F. M. Collins, and J. W. Jacobs, Jr. 2003.
Vaccine efficacy of a lysine auxotroph of M. tuberculosis. Infect. Immun. 71:4190-4192.
40. Penitente, R., C. Nicolo, E. P. Van den, S. G. Di, C. Agrati, F. Aloisi, E. E. Sercarz, and
F. Ria. 2008. Administration of PLP139-151 primes T cells distinct from those spontaneously
responsive in vitro to this antigen. J. Immunol. 180:6611-6622.
41. Price, D. A., T. E. Asher, N. A. Wilson, M. C. Nason, J. M. Brenchley, I. S. Metzler, V.
Venturi, E. Gostick, P. K. Chattopadhyay, M. Roederer, M. P. Davenport, D. I. Watkins,
and D. C. Douek. 2009. Public clonotype usage identifies protective Gag-specific CD8+ T
cell responses in SIV infection. J. Exp. Med. 206:923-936.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 33: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/33.jpg)
33
42. Pym, A. S., P. Brodin, L. Majlessi, R. Brosch, C. Demangel, A. Williams, K. E. Griffiths,
G. Marchal, C. Leclerc, and S. T. Cole. 2003. Recombinant BCG exporting ESAT-6 confers
enhanced protection against tuberculosis. Nat. Med. 9:533-539.
43. Qie, Y. Q., J. L. Wang, W. Liu, H. Shen, J. Z. Chen, B. D. Zhu, Y. Xu, X. L. Zhang, and
H. H. Wang. 2009. More vaccine efficacy studies on the recombinant Bacille Calmette-
Guerin co-expressing Ag85B, Mpt64 and Mtb8.4. Scand. J. Immunol. 69:342-350.
44. Rao, V., N. Dhar, H. Shakila, R. Singh, A. Khera, R. Jain, M. Naseema, C. N.
Paramasivan, P. R. Narayanan, V. D. Ramanathan, and A. K. Tyagi. 2005. Increased
expression of M. tuberculosis 19 kDa lipoprotein obliterates the protective efficacy of BCG by
polarizing host immune responses to the Th2 subtype. Scand. J. Immunol. 61:410-417.
45. Ria, F., A. Gallard, C. R. Gabaglia, J. C. Guery, E. E. Sercarz, and L. Adorini. 2004.
Selection of similar naive T cell repertoires but induction of distinct T cell responses by native
and modified antigen. J. Immunol. 172:3447-3453.
46. Ria, F., R. Penitente, S. M. De Santis, C. Nicolo, S. G. Di, M. Orsini, D. Arzani, A.
Fattorossi, A. Battaglia, and G. F. Ferraccioli. 2008. Collagen-specific T-cell repertoire in
blood and synovial fluid varies with disease activity in early rheumatoid arthritis. Arthritis
Res. Ther. 10:R135.
47. Rolla, S., C. Nicolo, S. Malinarich, M. Orsini, G. Forni, F. Cavallo, and F. Ria. 2006.
Distinct and non-overlapping T cell receptor repertoires expanded by DNA vaccination in
wild-type and HER-2 transgenic BALB/c mice. J. Immunol. 177:7626-7633.
48. Sali, M., S. Clarizio, C. Pusceddu, A. Zumbo, G. Pecorini, S. Rocca, S. Zanetti, G.
Delogu, and G. Fadda. 2008. Evaluation of the anti-tuberculosis activity generated by
different multigene DNA vaccine constructs. Microbes. Infect.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 34: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/34.jpg)
34
49. Singh, J. A., R. Upshur, and N. Padayatchi. 2007. XDR-TB in South Africa: no time for
denial or complacency. PLoS. Med. 4:e50.
50. Skeiky, Y. A., M. R. Alderson, P. J. Ovendale, J. A. Guderian, L. Brandt, D. C. Dillon, A.
Campos-Neto, Y. Lobet, W. Dalemans, I. M. Orme, and S. G. Reed. 2004. Differential
immune responses and protective efficacy induced by components of a tuberculosis
polyprotein vaccine, Mtb72F, delivered as naked DNA or recombinant protein. J. Immunol.
172:7618-7628.
51. Stover, C. K., G. P. Bansal, M. S. Hanson, J. E. Burlein, S. R. Palaszynski, J. F. Young,
S. Koenig, D. B. Young, A. Sadziene, and A. G. Barbour. 1993. Protective immunity
elicited by recombinant bacille Calmette-Guerin (BCG) expressing outer surface protein A
(OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med. 178:197-209.
52. Sun, R., Y. A. Skeiky, A. Izzo, V. Dheenadhayalan, Z. Imam, E. Penn, K. Stagliano, S.
Haddock, S. Mueller, J. Fulkerson, C. Scanga, A. Grover, S. C. Derrick, S. Morris, D. M.
Hone, M. A. Horwitz, S. H. Kaufmann, and J. C. Sadoff. 2009. Novel recombinant BCG
expressing perfringolysin O and the over-expression of key immunodominant antigens; pre-
clinical characterization, safety and protection against challenge with M. tuberculosis. Vaccine
27:4412-4423.
53. Wang, J., L. Thorson, R. W. Stokes, M. Santosuosso, K. Huygen, A. Zganiacz, M. Hitt,
and Z. Xing. 2004. Single mucosal, but not parenteral, immunization with recombinant
adenoviral-based vaccine provides potent protection from pulmonary tuberculosis. J.
Immunol. 173:6357-6365.
54. Weinrich Olsen A., L. A. van Pinxteren, O. L. Meng, R. P. Birk, and P. Andersen. 2001.
Protection of mice with a tuberculosis subunit vaccine based on a fusion protein of antigen
85b and esat-6. Infect. Immun. 69696969:2773-2778.
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 35: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/35.jpg)
35
55. World Health Organization. 2009. Global Tuberculosis Control. Surveillance, Planning,
Financing, In .
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 36: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/36.jpg)
Table 1. BCG recombinant strains used in this work
Acronym Notes Code Plasmid MPT64
localization
Plasmid
reference
HPE-∆MPT64-BCG
rBCG expressing the MPT64, lacking the
signal sequence, fused to the PE domain
of PE_PGRS33 under the control of the
hsp60 promoter.
rBCG1 pSTE2 Cell wall (11)
33PE-∆MPT64-BCG
rBCG expressing the MPT64, lacking the
signal sequence, fused to the PE domain
of PE_PGRS33 under the control of the
PE_PGRS33 (Rv1818c) promoter
rBCG6 pAL32 Cell wall This study
H∆MPT64-BCG
rBCG expressing the MPT64 protein
lacking the signal sequence, under the
control of the hsp60 promoter.
rBCG14 pPA2 Cytoplasm (11)
HPE-BCG
rBCG expressing the PE domain of
PE_PGRS33 under the control of the
hsp60 promoter.
rBCG121 pMV1818cPE
Cell wall (16)
33PE-BCG
rBCG expressing the PE domain of
PE_PGRS33 under the control of the
PE_PGRS33 (Rv1818c) promoter.
rBCG5 pMV7-27 Cell wall This study
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 37: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/37.jpg)
Table 2: MPT-64 specific, shared TCR-beta chain rearrangements are used differently depending on the BCG strain.
*p=0.0004; ** p=0.008; *** p=0.02
Vaccination with HPE-∆MPT64-
BCG
(positive mice
/total mice tested)
33PE-∆MPT64-
BCG
(positive mice
/total mice tested)
H∆MPT64-BCG
(positive mice
/total mice tested)
TCR rearrangement
BV3.1-BJ2.2 (127) 5/10 2/6 1/7
BV5.2-BJ21.6 (178) 7/10 3/6 0/7*
BV8.3-BJ1.5 (172) 6/10 0/6** 1/7***
BV20-BJ2.1 (118) 5/10 1/6 3/7
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 38: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/38.jpg)
Table 3: MPT-64 specific, shared TCR-beta chain rearrangements have distinct cytokine profiles.
+/-: rearrangement found associated with IFN-γ secreting cells in one out of four experiments;
+: rearrangement found associated with IFN-γ secreting cells in all four experiments;
-: rearrangement not found associated with IFN-γ secreting cells in four experiments.
Secretion of IFN-γ
TCR rearrangement
BV3.1-BJ2.2 (127) +/-
BV5.2-BJ21.6 (178) +
BV8.3-BJ1.5 (172) +
BV20-BJ2.1 (118) -
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 39: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/39.jpg)
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
Abs a
t 405 n
m
HPE-∆MPT64-BCG BCGH∆MPT64-BCG
Figure 1
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 40: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/40.jpg)
4
5
6
7
logC
FU
/lung
* * * * * *
**
BC
G
HP
E-∆∆∆∆
MP
T64
-BC
G
33P
E-∆∆∆∆
MP
T64
-BC
G
H∆∆∆∆M
PT64
-BC
G
HP
E-B
CG
33P
E-B
CG
Nai
ve
AFigure 2
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 41: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/41.jpg)
B
BC
G
HP
E-∆∆∆∆
MP
T64
-BC
G
33P
E-∆∆∆∆
MP
T64
-BC
G
H∆∆∆∆M
PT64
-BC
G
HP
E-B
CG
33P
E-B
CG
Nai
ve
3
4
5
6
logC
FU
/sple
en
* * * * * *
Figure 2
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 42: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/42.jpg)
3
4
5
6
7
8Lung
Spleen
logC
FU
/org
an
A
Nai
ve
BCG
HPE-∆
MPT6
4-BCG
Nai
ve
BCG
HPE-∆
MPT6
4-BCG
* * * *
**
Figure 3
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 43: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/43.jpg)
C
A B
**
*
**
D
**
*
**
Figure 4
Naive BCG HPE_∆MPT64
BCG Naive BCG HPE_∆MPT64
BCG
Naive BCG HPE_∆MPT64
BCGNaive BCG HPE_∆MPT64
BCG
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 44: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/44.jpg)
E
Naive BCG HPE_∆∆∆∆MPT64 BCGFigure 4
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 45: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/45.jpg)
Figure 5
0 100 200 300 4000
50
100
150
Days
Perc
en
t su
rviv
al
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 46: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/46.jpg)
Figure 6
102
103
104
105
MP
T64-s
pecif
ic IF
N- γ
γ γ γ
secre
tin
g C
D4+
cells
102
103
104
105
MP
T64-s
pecif
ic IF
N-
γγ γγ
secre
tin
g C
D8+
cells
33P
E-B
CG
HP
E-∆∆∆∆
MP
T64-B
CG
33P
E-∆∆∆∆
MP
T64-B
CG
H∆∆∆∆
MP
T64-B
CG
2 weeks 11 weeks
33P
E-B
CG
HP
E-∆∆∆∆
MP
T64-B
CG
33P
E-∆∆∆∆
MP
T64-B
CG
H∆∆∆∆
MP
T64-B
CG
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 47: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/47.jpg)
Cy
tok
ine
-se
cre
tin
g,
MP
T6
4-s
pe
cifi
c C
D4
+ce
lls
/ 1
06
CD
4+
cell
s
33PE
-BC
G
HPE
-∆∆∆∆M
PT
64
-BC
G
33PE
-∆∆∆∆M
PT
64
-BC
G
H∆∆∆∆
MP
T6
4-B
CG
A B
p=0.011
Ag- MPT64
IFN
-γCD4
TN
F-α
IL-212
3
4
5 6
Figure 7
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 48: Downloaded from //iai.asm.org/content/iai/early/2010/10/04/IAI.00267-10.full.pdf · first and second-line drugs has raised further concern among heal th authorities and the scientific](https://reader034.vdocuments.net/reader034/viewer/2022042208/5eac20850f9906100a66afe8/html5/thumbnails/48.jpg)
1.1 1.2 1.3 1.4 1.5 1.6 2.1 2.2 2.3 2.4 2.5 2.7
1
2
3.1
4
5.1
5.2
5.3
6
7
8.1
8.2
8.3
9
10
11
12
13
14
15
16
17
18
19
20
BV
20
BJ2
.1B
V8
.3 B
J1
.5B
V5
.2 B
J1
.6B
V3
.1 B
J2
.2BV
BJ
Ag- MPT64
A BFigure 8
on May 1, 2020 by guest
http://iai.asm.org/
Dow
nloaded from