downloaded from //iai.asm.org/content/iai/early/2010/10/04/iai.00267-10.full.pdf · first and...

Surface expression of MPT64 as a fusion with the PE domain of PE_PGRS33 enhances BCG

protective activity against Mycobacterium tuberculosis in mice.

Michela Sali1, Gabriele Di Sante

2, Alessandro Cascioferro

4, Antonella Zumbo

1, Chiara Nicolò

2,

Valentina Donà4, Stefano Rocca

5, Annabella Procoli

3, Matteo Morandi

1, Francesco Ria

2, Giorgio

Palù4, Giovanni Fadda

1, Riccardo Manganelli

4* and Giovanni Delogu

1*.

1Institute of Microbiology,

2Institute of General Pathology,

3Institute of Gynecology, Catholic

University, L.go A. Gemelli, 8 - 00168 - Rome, Italy.

4 Department of Histology, Microbiology and Medical Biotechnologies, University of Padua, Via A.

Gabelli, 63 – 35121 - Padua, Italy;

5 Institute of General Pathology, Pathological Anatomy and Veterinary Obstetrics-Surgery Clinic,

University of Sassari, Via Vienna – 07100 - Sassari, Italy.

*Corresponding authors: Riccardo Manganelli, email [email protected] ; tel. ++39 049 8272366;

fax ++39 049 8272355. Giovanni Delogu, email [email protected]; tel. ++39 06 30154964; fax ++ 39

06 3051152.

Keywords: Tuberculosis; BCG; Vaccine;

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00267-10 IAI Accepts, published online ahead of print on 4 October 2010

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

2

Abstract

To improve the current vaccine against tuberculosis, Bacille Calmette and Guerin (BCG), a rBCG

expressing a Mycobacterium tuberculosis vaccine candidate antigen (MPT64) in strong association

with the mycobacterial cell wall was developed. To deliver the candidate antigen on the surface we

fused the mpt64 gene to the sequence encoding the PE domain of PE_PGRS33 of M. tuberculosis

(HPE-∆MPT64-BCG) which we have previously shown to transport proteins to the bacterial

surface. In a series of protection experiments in the mouse model of tuberculosis we showed that: a)

immunization of mice with HPE-∆MPT64-BCG provides levels of protection significantly higher

than those afforded by the parental BCG strain, as assessed by bacterial colonization in the lung and

spleen, and lung involvement (both at 28 and 70 days post-challenge); b) rBCG strains expressing

MPT64 provides a better protection than the parental BCG strain only when this antigen is surface-

expressed; and c) the HPE-∆MPT64-BCG induced MPT64-specific T cell repertoire when

characterized by BV-BJ spectratyping indicates that protection correlates with the ability to recruit

IFN-γ secreting T cells carrying the BV8.3-BJ1.5 of 172b shared rearrangement. These results

demonstrate that HPE-∆MPT64-BCG is one of the most effective new vaccine so far tested in the

mouse model of TB and underscore the impact of antigen cellular localization on the induction of

the specific immune response induced by rBCG.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

3

Introduction

The 2007 WHO report an estimated 13.7 million prevalent cases of tuberculosis (TB) in the world

and 1.77 million deaths (55). The HIV pandemic has contributed to the reemergence of TB in the

last three decades, with 456.000 deaths in HIV-positive patients in 2007. Nevertheless, of the 9.27

million incident TB cases in 2007, “only” 15% were HIV-positive (55), indicating that TB remains

a major health problem also for immune-competent subjects and primarily in poor and developing

countries. In the last few years, the emergence of Mycobacterium tuberculosis strains resistant to

first and second-line drugs has raised further concern among health authorities and the scientific

community, making even more urgent the need for effective control measures (31,32,49).

The development of a new and improved vaccine against TB may provide one of the best tools to

control the disease. The only vaccine currently available is Bacille Calmette and Guerin (BCG),

introduced in 1921, that protects against the most severe forms of TB in children, but whose

efficacy in preventing TB in adults has been challenged by several clinical studies (12). For this

reason, the search for a new vaccine has gained a new momentum in the last fifteen years. Many

technological platforms have been implemented, such as protein-based vaccines with new and

innovative adjuvants (20,50,54); DNA vaccines expressing single and multiple antigens (14,15,50);

live recombinant viral vectors like rMVA (36) or adenovirus-based vectors (53); attenuated M.

tuberculosis strains (19,39) and recombinant BCG (rBCG) expressing M. tuberculosis antigens

Molecular engineering of the current BCG vaccine and over-expressing candidate antigens

presents several advantages. In fact, despite all the problems (2), BCG is still the gold standard

vaccine in animal models and very few vaccines have provided better protection (13). Moreover,

the introduction of a recombinant BCG (rBCG) in human studies is seen as less problematic

compared to other live vaccines for ethical reasons (5,10). Over-expression of dominant antigens

like Ag85 complex (27,28), or re-introduction of selected genes lost during attenuation of BCG,

like those encoded by RD1, are two examples of the strategies so far implemented to develop


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

4

rBCG (42). To improve immunogenicity, rBCG has also been manipulated to express the

lysteriolisin of Listeria monocytogenes along with deletion of the ureC gene to facilitate

phagosome maturation and antigen processing following immunization (23,24). A similar

approach has been taken via insertion of the perfringolysin gene along with genes that express

certain antigens from M. tuberculosis (52)

In a recent publication we have shown that the PE domain of the M. tuberculosis protein

PE_PGRS33 localizes to the mycobacterial cell wall and that chimeric proteins constructed using

the PE such as PE-GFP or PE-MPT64, are exposed on the mycobacterial surface provided that the

PE domain is fused at their N-terminus (11). Therefore, the PE domain can be considered as a

functional domain containing the information necessary to transport and expose proteins on the

surface of mycobacteria and is an ideal candidate to develop a surface delivery system for

mycobacteria.

The MPT64 antigen used in these studies, is a secreted, highly immunogenic protein of M.

tuberculosis, whose gene has been lost in most of the BCG strains during attenuation. It has been

demonstrated that DNA vaccines expressing MPT64 can induce a partial level of protection in the

mouse model of TB (14). Hence MPT64 is a candidate antigen for the development of a subunit

vaccine against tuberculosis.

In this study, we show that a live BCG strain expressing a PE-MPT64 chimeric protective antigen

on its surface is more immunogenic and induces better protection against challenge with virulent M.

tuberculosis than the parental strain or rBCG strains expressing the same antigen localized in

different cellular compartments.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

5

Materials and Methods

Animals. Pathogen-free C57Bl/6 female mice were obtained by Harlan (Italy). Mice were

immunized at 8-10 weeks of age and were kept under barrier conditions and fed commercial mouse

chow and water at libitum. All animal experiments were performed using protocols approved by the

Catholic University Ethical Committee.

Plasmids used in this study. The plasmids pSTE2 and pAL2 were already used in our previous

paper (11). To construct pAL32 the DNA fragment encoding the PE_∆MPT64 chimera was PCR

amplified using Pfu polymerase (Stratagene) from pSTE2 (11) using the oligonucleotides RP86 (5’-

GCTCTAGAATGTCATTTGTGGTCACGATCC-3’) and RP303 (5’-

ACAGATCTTTAGAGGCTAGCATAATCAGGAA-3’). The upper primer (RP86) was designed to

have an XbaI restriction site before the start codon of the PE1818c coding sequence, while the lower

primer (RP339) ws designed to have a BglII restriction site after the ORF stop codon. This fragment

was introduced immediately downstream of the Rv1818c promoter present in pMV4-36 (Delogu G.

unpublished) after its digestion with NheI and BamHI (Table 1).

Microrganisms. M. tuberculosis Erdman (TMC107) and M. bovis BCG Pasteur (TMC1011) were

obtained from the Trudeau Culture Collection. The recombinant BCG strains expressing the MPT64

antigen in different cellular compartments used in this study are described in Table 1.

Whole cell enzyme-linked immunosorbent assay (ELISA). Cells were grown to an OD600 of about

0.8, harvested by centrifugation at 4600 rpm for 10 minutes at room temperature, washed twice in

TBST buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1mM MgCl2 and 0.05% Tween 80) and

resuspended in 50 mM NaHCO3 pH 9.6 to yield a cell concentration of about 1 x 109 cells ml

-1.

100 µl of the so obtained cell suspension were transferred to each well of a microtitre plate (NUNC-

Immuno MaxiSorp Surface, Nalge Nunc International). After a 24 h incubation at 4°C, the


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

6

microplate was centrifuged and the supernatant discarded. Samples were then blocked with 200 µl

of 3% powdered skim milk in TBST for 1.5 h at room temperature. The samples were then washed

once with 200 µl of TBST. The anti-MPT64 primary antibody (mouse) was diluted in 1% powdered

skim milk in TBST, using a 1:6400 dilution, and 100 µl added to each well. After an incubation of 1

h at room temperature, the wells were washed three times with 200 µl of TBST. The secondary anti-

mouse antibody alkaline phosphatase conjugate (Sigma) was diluted 1:5000 in TBST containing

1% powdered skim milk and 100 µl were added to each well. Incubation with the secondary

antibodies was then carried out at room temperature for 1 h. After 4 washing steps with 200 µl of

TBST, 200 µl of a solution of p-nitrophenyl phosphate (Sigma), diluted in Tris-HCl pH 8.0 to a

final concentration of 1 mg/ml, was added to each well and incubated until the development of a

pale yellow colour. The reaction was stopped by the addition of 50 µl of 3M NaOH to each well.

Absorbance at 405 nm was measured with a microplate reader (Magellan, Tecan).

Evaluation of the protective activity of recombinant BCG. Groups of C57Bl/6 mice were injected

subcutaneously with 5×106 CFU rBCG (HPE-∆MPT64-BCG, 33PE-∆MPT64-BCG, H∆MPT64-

BCG, HPE-BCG, 33PE-BCG) and, as a control, mice were vaccinated with 5×106 CFU BCG Pasteur

on day 0. Ten-weeks following the immunization vaccinated and control mice were infected

aerogenically with about 100 CFU of M. tuberculosis Erdman using a Middlebrook chamber (Glas-

Col, Terre Haute, Ind.) as described previously (34). The vaccinated and control mice were

sacrificed 28 and 70 days after challenge and bacterial colonization of lung and spleen tissues

assessed as described earlier (48). Briefly, to assess the bacterial growth in vivo, five mice per group

were sacrificed, and the lungs and spleens were removed aseptically and homogenized separately in

5 ml of 0.04% Tween 80-PBS using a Seward Stomacher 80 blender (Tekmar, Cincinnati, Ohio).

The homogenates were diluted serially in the Tween-PBS solution, and 50-µl aliquots were plated

on Middlebrook 7H11 agar (Difco, Detroit, Mich.). containing 2-thiophenecarboxylic acid


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

7

hydrazide (2 µg/ml). The number of CFU in the infected organs was determined after 14 to 21 days

of incubation at 37° in sealed plastic bags.

For the survival studies, 10 animals per group were immunized and ten weeks later aerogenically

infected with ≈ 100 CFU/animal and maintained until they became moribund and had to be

euthanatized.

Histopathologic analysis. The lung left lobes were perfused and fixed with 10% paraformaldehyde

in PBS and then embedded in paraffin for sectioning. The tissue sections were stained with

hematoxylin and eosin (H&E) reagent or with Ziehl-Neelsen acid-fast stain and were evaluated by

light microscopy. For each lung left lobe at least three section were obtained and for each section

the total surface area and the area with lesions was measured and the average calculated for each

section and for each group (five lung left lobes per group). Measurements were carried out using

the microscope Nikon Eclipse 80i, the camera control unit Nikon DS-L2 and the dedicated software

3422.1001.1798.080117.

T cell receptor repertoire analysis. Repertoire analysis was performed using a modification of a

described protocol (45). 107 spleen derived cells/well were cultured in the presence or absence of 20

µg/ml of recombinant MPT64 for three days in RPMI-1640 medium (Sigma- Aldrich, St Louis,

MO, USA) supplemented with 2 mM L-glutamine, 50 µM 2-ME, 50 µg/ml gentamicin (Sigma-

Aldrich, St Louis, MO, USA), and 10% Foetal Calf Serum (Gibco BRL Life Technologies, Basel,

Switzerland) (complete medium). Total RNA was isolated from cell suspensions using RNeasy

Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instruction. cDNA was

synthesized using an oligo-dT primer (dT15) (Gibco BRL Life Technologies, Basel, Switzerland).

For complete “Immunoscope” analysis (37) cDNA was subjected to PCR amplification using a


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

8

common Constant (C) β primer (CACTGATGTTCTGTGTGACA) in combination with the

variable β(BV) primers previously described (47), following the nomenclature of Arden and coll.

(3). Using 2 µl of this product as a template, run-off reactions were performed with a single internal

fluorescent primer for each BJ tested (described previously (47)). These products were then

denatured in formamide and analyzed on an Applied Biosystem 3130 Prism using Gene-mapper

v4.0 software (Applied Biosystem, Foster City, CA, USA). Results are also reported as R.S.I

(relative stimulation index = normalized peak area obtained from cells stimulated with Ag /

normalized peak area of non stimulated cells). According to our experience in other model antigens

(37,47) T cells carrying a TCR rearrangement can be considered expanded in a peptide-driven

manner when RSI is ≥2.

Staining and enrichment of IFN-γ–secreting T cell. MPT64-specific T cells secreting IFN-γ were

stained and enriched from spleen of C57Bl/6 mice (infected as described above) using MACS

secretion kit (Milteny Biotec, Bergisch Gladbach, Germany), according to the manufacturer’s

instruction, following the protocols for enrichment of low frequency secreting cells. Briefly, 1 to

3x107 cells obtained from spleens were stimulated in the absence (background) or in the presence of

20 µg/ml recombinant MPT64, in 6 well plate at a concentration of 5x106 cells/ml. Sixteen hours

later, cells were harvested and submitted to the staining procedure for the cytokine. Samples were

also stained with FITC-labelled anti-CD4 (SouthernBiotech, Birmingham, AL, USA) or CD8

(Invitrogen, Camarillo, CA, USA) antibodies. In order to evaluate correctly the number of MPT64-

specific cells, we examined by FACS 5x105 cells in each background and positive sample. The

number of antigen-specific, cytokine secreting cells is obtained by subtracting the cells staining

positively in the background sample from the number of the same cells in the Ag-stimulated

sample.

Total, negatively selected and positively selected cells were collected and prepared for mRNA

isolation. In order to prevent uncontrolled loss of mRNA due to scarcity of cells, 106 α

-β

- BW cells


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

9

were added to the positively selected cells before proceeding with mRNA isolation for the TCR

repertoire analysis.

Intracellular cytokine staining. The following monoclonal antibodies were used for intracellular

staining: FITC-labeled anti-CD4 (SouthernBiotech, Birmingham, AL, USA); FITC-labeled anti-

CD8a (Invitrogen, Camarillo, CA, USA); PE-labeled anti-IFN-γ (clone XMG1.2, BD Pharmingen,

San Diego, CA, USA); PERCP-CY5.5-labeled anti-IL-2 (clone JES6-5H4, BD Pharmingen); APC-

CY7- labeled anti-TNF-a (clone MP6-XT22, BD Pharmingen). The intracellular staining procedure

was performed using the Cytofix/Cytoperm kit with GolgiPlug Kit (BD Pharmingen) according to

manufacturer’s instructions. Briefly, 1x107 cells obtained from spleen of mice infected with BCG

recombinant strains as described above, were stimulated in the absence (background) or in the

presence of 20 µg/ml recombinant MPT64, in 24 well plate at a concentration of 107 cells/ml.

BrefeldinA was added for the last 8 hrs of culture. Samples (5x105 cells in each background and

positive sample) were analyzed on a BD FACScan flow cytometer. The number of antigen-specific

T cells secreting a given cytokine for each mouse was obtained by subtracting the normalized

number of T cells secreting the cytokine in the control sample (i.e. cultured in the absence of

antigen) from the normalized number of T cells secreting the same cytokine in the sample cultured

in the presence of MPT64.

Statistical analysis. Prism 4.0 software (GraphPad Prism version 5.00 for Windows, GraphPad

Software, San Diego, California, USA) was used for statistical analyses of protective activity data.

The data were analyzed using one-way ANOVA and the Tukey’s Multiple Comparison Test was

used for selected pairwise comparisons. Log-rank (Mantel–Cox) tests were performed to compare

the survival curve. Unpaired T test was used for analysis of the data reported in Figure 4 and Figure

7B, and Square Chi test was used for the analysis of the data reported in Table 2. P values of less

than 0,05 were considered significant.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

10

Results

In a previous work, we showed that when MPT64 deprived of its signal sequence (∆MPT64) is

expressed in mycobacteria it localizes into the cytoplasm, but when fused at the C-terminus with the

PE domain derived from PE_PGRS33 (PE_∆MPT64), it is surface exposed as determined by

trypsin sensitivity assays, cell fractionation studies and immunogold electron microscopy (11). To

confirm this finding, the cellular localization of these two recombinant proteins in BCG was further

investigated by enzyme-linked immunosorbent assay (ELISA) on whole cells using an anti-MPT64

mouse antiserum. As shown in Figure 1, the PE_∆MPT64 expressing strain (HPE-∆MPT64-BCG)

gave a 3-fold higher signal than that given from the ∆MPT64 expressing strain (H∆MPT64-BCG)

when the expression of these proteins was similar (data not shown). Detection of the ∆MPT64-HA

expressing strain was comparable to that obtained using the wild type parental strain. Taken

together, these data clearly support our previous finding that the PE domain targets the MPT64

protein to the surface of M. bovis BCG.

HPE-∆∆∆∆MPT64-BCG elicits enhanced anti-tuberculous activity. To assess the impact of antigen

cellular localization and load on the immunogenicity of the rBCGs, the different recombinant BCG

strains expressing the model antigen MPT64 in the cytoplasm or at the surface (Table 1) were used

to immunize C57Bl/6 mice, following standard protocols. Ten weeks after a single immunization,

mice were aerogenically infected with a low-dose (≈ 200 CFUs) of M. tuberculosis Erdman. Four

weeks later, mice were sacrificed and lung and spleen tissue removed to determine bacterial loads.

As shown in Figure 2, BCG-immunized mice had a significantly lower mycobacterial load in the

lung (- 0.96 Log CFU/lung) compared to naïve mice. Interestingly, mice immunized with HPE-

∆MPT64-BCG had significantly less bacteria in the lung compared to BCG immunized mice (- 1.69

Log CFU/lung compared to naïve mice and – 0.73 Log CFU/lung compared to the BCG group). A


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

11

reduction was also observed in the spleen tissue (Figure 2B) although this reduction was not

statistically significant.

Over-expression of the chimeric antigen is necessary for this enhanced activity, since mice

immunized with 33PE-∆MPT64-BCG, expressing PE_∆MPT64 under the control of the

PE_PGRS33 promoter (5-10 weaker than the hsp60 promoter as previously described (11,17))

showed bacterial loads in the lung and spleen tissues similar to the parental strain. Moreover, mice

immunized with rBCG expressing the PE domain of PE_PGRS33 (HPE-BCG (16) and 33PE-BCG)

had bacterial counts similar to BCG strain, indicating that the over-expression of the PE domain

alone does not contribute to the superior activity of HPE-∆MPT64-BCG.

Mice immunized with BCG over-expressing the MPT64 antigen in the cytoplasm did show lower

bacterial counts in the host tissues compared to naïve mice (p<0,05) but this reduction was not

statistically significant compared to the BCG parental strain (p>0,05). The activity of each of these

rBCG strains was tested in at least another experiments and similar results were obtained. The

attempts to express the MPT64 antigen in the plasmatic membrane or in the secreted form under the

control of the hsp promoter were not successful. In fact, these recombinant strains did not grow

properly in liquid and solid media, probably because over-expression of the antigen in these cellular

compartments was toxic. Conversely, expression of these two chimeras was obtained under the

control of the PE_PGRS33 promoter and mice immunized with these two BCG recombinant strains

had bacterial counts similar to the BCG parental strain (data not shown).

Taken together these results suggest that: a) HPE-∆MPT64-BCG induces an enhanced level of

protective activity against M. tuberculosis infection compared to BCG; b) that this enhanced

activity is dependent upon the MPT64 antigen; and c) that over-expression of the antigen and

localization in the mycobacterial cell wall are both required to provide the enhanced activity.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

12

Since only a few recombinant BCG vaccines have been able so far to induce enhanced anti-

tuberculous activity compared to the parental BCG strain (6), the HPE-∆MPT64-BCG was

evaluated in other three independent protection experiment. Mice vaccinated with HPE-∆MPT64-

BCG had consistent and statistically significant (at least p<0,05) lower bacterial counts compared to

the BCG group at day 28 post-infection, and reduction in the lung tissue ranged from 0.38 to 0.75,

while the reduction over naïve mice reached 2.16 Log CFU/lung. A similar pattern was also

observed in the spleen, with mice immunized with HPE-∆MPT64-BCG showing consistently lower

bacterial counts compared to BCG counterparts, although in this case differences were not always

statistically significant. The results of four independent experiments clearly indicate that the HPE-

∆MPT64-BCG induces level of anti-mycobacterial activity superior to those induced by BCG.

Enhanced protection of HPE-∆∆∆∆MPT64-BCG is maintained during the chronic steps of

infection. In the mouse model for TB used in these studies, reduction in terms of bacterial loads

afforded by BCG vaccination is maximal at day 28 post-infection, while at later time points (for

instance day 70) the difference in terms of Log CFU/organ between naïve and BCG-immunized

mice can be less evident (15). To assess the activity of HPE-∆MPT64-BCG in the chronic steps of

infection, immunized and control mice aerogenically infected with M. tuberculosis Erdman (≈200

CFU/animal) were sacrificed 70 days post-infection and bacterial loads assessed as previously

indicated. As shown in Figure 3, mice immunized with HPE-∆MPT64-BCG showed 2.16 Log CFU

reduction in the lung over naïve mice, and 1.08 reduction compared with BCG immunized mice.

Lower bacterial counts were also observed in the spleen, with HPE-∆MPT64-BCG mice showing

0.54 Log CFU less than BCG immunized mice. These results indicate that the superior activity of

HPE-∆MPT64-BCG over BCG is maintained even at 70 days post-infection.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

13

Immunization with HPE-∆∆∆∆MPT64-BCG reduces lung involvement compared with BCG

vaccination in M. tuberculosis infected mice. An effective vaccine against M. tuberculosis

infection should induce a specific immune response that would not only control bacterial

colonization but would also result in limited lung involvemente. The lung left lobe was isolated

from immunized and control mice challenged with virulent M. tuberculosis at days 28 and 70 post-

infection, perfused with formalin and subjected to histopathology. For each lung (five lung per

group of immunized mice), at least three sections were subjected to a quantitative microscopic

analysis to objectively assess the extent of the tissue damage. As shown in figure 4, the median

granuloma surface area, the average surface of tissue with lesions, the number of granulomas per

lung left lobe and the ratio between the area with lesions over the total lung surface were

determined. All parameters indicated that the size of granulomas at day 28 post-infection was

significantly reduced in mice immunized with BCG and HPE-∆MPT64-BCG compared with naïve

mice. Indeed, while lung isolated at day 28 from non-immunized mice showed diffused

granulomatous lesions containing many acid fast bacilli, histopathology in BCG and HPE-∆MPT64-

BCG immunized groups was similar, with small lesions containing very few mycobacteria (data not

shown).

Interestingly, at day 70 post-infection, the extent of the lesions appeared smaller in HPE-∆MPT64-

BCG-immunized mice compared not only to naïve mice but also to the BCG immunized group. As

shown in figure 4, mice immunized with HPE-∆MPT64-BCG showed a reduction of the granuloma

size compared with naïve mice but also compared to the BCG immunized group (figure 4A). The

extent of lung involvement was significantly lower in HPE-∆MPT64-BCG compared to BCG as

demonstrated by measuring the total surface area with lesions (figure 4 B, p<0,001) and the percent

of tissue with lesions over the total area (figure 4D, p<0,001) and this despite the fact that a similar

number of granulomas per lung left lobe was found in the two BCG-immunized group (figure 4C).


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

14

Representative slides showing the extent of lung involvement and the type of cellular infiltrate are

shown in figure 4E and confirm that the majority of lung was healthy in mice receiving HPE-

∆MPT64-BCG and indicate that the presence of acid-fast bacilli in these lesions was more frequent

in the BCG group compared to the HPE-∆MPT64-BCG. Overall, the results obtained indicate that

the activity of HPE-∆MPT64-BCG is superior to that of the BCG parental strain at day 70 post-

infection, in terms of bacterial loads and extension of lung involvement.

To further assess the anti-tuberculous activity of the rBCG under study, groups of 10 mice were

immunized with HPE-∆MPT64-BCG and BCG, or left non immunized and then infected with a

low-dose of M. tuberculosis Erdman. A statistically significant protection as measured by the

extension of the median survival time was observed between the two BCG-vaccinated groups and

naïve mice, but no statistically significant difference among the two BCG-vaccinated groups were

measured (Figure 5).

Cytokine production and persistence of MPT64-specific CD4+ and CD8+ T cells following

infection with MPT64-expressing live BCG strains. To identify potential immunological

correlates of protection, we examined the presence of CD4+ and CD8+ T cells secreting IFN-γ

following vaccination in response to stimulation with MPT64. Groups of 6 to 10 mice were injected

s.c. with live BCG strains. Mice were sacrificed at day 15 post-infection, cells were isolated from

the spleen and cultured in vitro in the absence or presence of 10 µg/ml of recombinant MPT64.

Sixteen hours later cells were stained with the MACS® IFN-γ secretion assay and FITC labelled

anti-CD4 or anti-CD8 monoclonal antibodies and cells secreting IFN-γ in antigen dependent

manner were counted by FACS. Results are reported in Figure 6 (left column). The average +2SD

value obtained in mice vaccinated with the control strain 33PE-BCG (expressing the PE domain

alone) was used to establish the threshold level for a specific response to MPT64. At day 15 post-


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

15

vaccination, all mice infected with HPE-∆MPT64-BCG showed a robust (although variable among

individual absolute values) response to MPT64 in both CD4+ (average 8,55x103 cells /10

6 CD4

+

cells) and CD8+ cells (average 4,26 x103 cells /10

6 CD8

+ cells). At this time point, MPT64-specific

CD4+ cells were more numerous than CD8+ cells. At the same time, 2 out of 3 mice infected with

33PE-∆MPT64-BCG, that expresses the antigen chimera PE_MPT64 under the control of a weaker

promoter, showed levels of response comparable to that obtained with HPE-∆MPT64-BCG at day

15 (average 6,7 x103 cells /10

6 CD4

+ cells, and 12,38 x10

3 cells /10

6 CD8

+ cells respectively).

Consistently positive although slightly lower values were obtained in mice infected with strain

H∆MPT64-BCG, in which MPT64 localized in the cytoplasm (average 1,98 x103 cells /10

6 CD4

+

cells and 3,31x103 cells /10

6 CD8

+ cells.

In order to test the role of T cells secreting IL-2 or TNF-α or the combination of two or more

cytokines among IFN-γ, IL-2 and TNF-α in our model, intracellular staining for these cytokines

was performed in spleenocytes isolated from immunized mice. Four groups of 5 to 6 mice were

immunized as previously described and two weeks later spleen cells were obtained and cultured in

the presence or absence of MPT64. The staining for intracellular IFN-γ, IL-2 and TNF-α was

performed as described in Materials and Methods. Results for each single cytokines are reported in

Figure 7A. Here, each dot represent the value obtained from the sample cultured in the presence of

MPT64 subtracted of that obtained from the same sample in the absence of antigen (control). The

number of CD4+ cells secreting IFN-γ or IL-2 observed with this technical approach overlapped that

obtained using the MACS® IFN-γ secretion assay for mice vaccinated with HPE-∆MPT64-BCG

and H∆MPT64-BCG. However, the values obtained for 33PE-∆MPT64-BCG and for CD8+ cells

(not shown) were sensibly lower than those obtained with the MACS secretion assay and especially

for CD8+ cells they were not distinguishable from those obtained in mice infected with the control

strain 33PE-BCG. Values obtained using intracellular staining were obtained by cumulating the


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

16

secretion of cytokines during the first 16 hours of stimulation; vice versa, the MACS® secretion

assay focuses on cytokines secreted after 16 hours of stimulation with the antigen, for a relatively

short period. The discrepancy between values obtained with the two tests may therefore reflect

differences in the kinetic of IFN-γ secretion between CD4 and CD8 cells and among the various

protocols of vaccination. Finally, the number of TNF-α-secreting CD4+ cells in mice vaccinated

with H∆MPT64-BCG and HPE-∆MPT64-BCG was approximately one tenth of those secreting IFN-

γ and IL-2 in the same groups.

Next, the ability of MPT64-specific CD4+ T cells to secrete multiple cytokines was evaluated (1)

and an example of the assay performed is shown in the upper panel of Figure 7B. We calculated the

composition of the population of CD4+ cytokine secreting T cells in each sample obtained after

stimulation with MPT64, independently from the fact that the number was actually higher than that

obtained in absence of antigen-stimulation. Thus, values obtained from 33PE-BCG immunized mice

provide a view of the background composition of the T cell population. The distribution of the

various population of “MPT64-specific” T cells upon vaccination with the various rBCG strains is

shown in the lower panels of Figure 6B, as pie chart. CD4+ cells secreting TNF-α and IFN-γ were

detected in some samples of the three groups of mice immunized with rBCG strains expressing

MPT64, but not in the control mice (33PE-BCG). However, the large variability among individual

mice was such that in no case this difference was statistically significant. Intriguingly, CD4+ T

cells secreting IFN-γ and IL-2 were found in larger proportion in mice HPE-∆MPT64-BCG

immunized mice than in those immunized with 33PE-BCG (p=0.011). A similar over-representation

of this population was found in the H∆MPT64-BCG group, where it however fell short from being

statistically significant (p=0.08) due to individual variability. As a final observation, the average

total number of CD4+ T cells secreting cytokines in response to MPT64 was similar in the HPE-

∆MPT64-BCG group (2.9x104/10

6 CD4

+ cells) and in the H∆MPT64-BCG (2.7x10

4/10

6 CD4

+

cells), while it was close to zero in the control 33PE-BCG group (-0.1x104/10

6 CD4

+ cells).


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

17

Since mice were challenged with M. tuberculosis at week 11 after vaccination, we examined the

presence of CD4+ and CD8+ T cells secreting IFN-γ in response to stimulation with MPT64 also at

day 77 post vaccination. Results are shown in Figure 6 (right column), and indicate that the CD4+

mediated response had strongly declined in all of the groups. Mice vaccinated with 33PE-∆MPT64-

BCG and H∆MPT64-BCG as well as 2 out of 3 mice vaccinated with HPE-∆MPT64-BCG did not

show a number of MPT64-specific CD4+ cells different from that of mice immunized with the

control strain 33PE-BCG. On the contrary, the CD8-mediated response appeared to be better

conserved within the HPE-∆MPT64-BCG group (average 9,67x103 cells /10

6 CD8

+ cells), showing

values still comparable to those obtained at day 15 and higher than H∆MPT64-BCG (average

1,740,5 x103 cells /10

6 CD8

+ cells) and 33PE-∆MPT64-BCG (average 0,55 x10

3 cells /10

6 CD8

+

cells).

Analysis of T cell repertoires involved in response to MPT64 shows that HPE-∆∆∆∆MPT64-BCG

selectively activates T cells carrying a shared BV8.3-BJ1.5 rearrangement. The T cell

repertoire involved in the response to MPT64 was analyzed by means of the BV-BJ spectratyping

(the so-called “immunoscope”). Following the procedure described in (47), we pooled the cDNAs

obtained from MPT64-stimulated spleen cells of three mice 15 days after vaccination with HPE-

∆MPT64-BCG. Pooled cDNAs were then submitted to a complete immunoscope analysis in which

the 288 Vβ-Jβ primer combinations were used to perform the first CDR3 length fragment analysis.

In this analysis each CDR3-β profile can be depicted as a function of the CDR3 length. Each peak

represents a 3 b difference in the product of recombination corresponding to one amino acid

residue. In non-vaccinated mice, most peak patterns display a Gaussian distribution. 56

combinations however displayed the presence of one peak that altered such a Gaussian distribution

(Figure 7A, black areas). We then examined these BV-BJ recombinations on cDNAs obtained from


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

18

7 individual mice, comparing the MPT64-stimulated sample with the un-stimulated sample from

each individual mouse. We thus found that 4 rearrangements, each characterized by recombination

of a BV, a BJ and a base length, that expanded in response to MPT64, were used frequently in mice

vaccinated with HPE-∆MPT64-BCG. The four rearrangements were BV3.1-BJ2.2 of 127b, BV5.2-

BJ21.6 of 178b, BV8.3-BJ1.5 of 172b and BV20-BJ2.1 of 118b. Data are reported in Table 2, and

examples are shown in Figure 7B.

We next examined the association of each of the shared rearrangements with T cells secreting IFN-γ

in response to stimulation of spleen cells with recombinant MPT64. In four distinct experiments,

spleen cells obtained from mice vaccinated with HPE-∆MPT64-BCG were stimulated with

recombinant MPT64 and IFN- γ secreting cells were enriched as described previously (37). In two

experiments, cells from three mice were pooled and examined; in the other two experiments cells

from a total of 6 mice were examined individually. Results are reported in Table 3. Rearrangements

BV5.2-BJ21.6 of 178b and BV8.3-BJ1.5 of 172b were consistently associated with IFN-γ secreting

cells, indicating that cells carrying these rearrangements secreted IFN- γ when re-stimulated with

MPT64. Finally, we examined the ability of strains 33PE-∆MPT64-BCG and H∆MPT64-BCG to

activate T cells carrying these shared TCRs. Results are shown in Table 2. T cells carrying

rearrangement BV3.1-BJ2.2 of 127b are recruited in mice vaccinated with all tested strains.

Vaccination with H∆MPT64-BCG and 33PE-∆MPT64-BCG failed to recruit BV8.3-BJ1.5 of 172b.

Also T cells carrying the BV5.2-BJ1.6 of 178b TCR were not recruited following vaccination with

H∆MPT64-BCG. Recruitment of T cells carrying TCR-b chains BV20-BJ1.6 (118b) and BV3.1-

BJ2.2 (127b) was reduced after vaccination with H∆MPT64-BCG and 33PE-∆MPT64-BCG,

respectively, although reduction did not reach statistical significance. Taken together, these data

suggest that protection associates with ability to recruit the IFN-γ secreting T cells carrying the

BV8.3-BJ1.5 of 172b shared rearrangement.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

19

Discussion

The superior activity of HPE-∆MPT64-BCG over the parental strain is remarkable when compared

to that of other rBCG vaccines tested in similar experimental settings. Two rBCGs expressing the

ESAT6 antigen, in the secreted form or in the cytosol, were shown to be as safe as the parental

strain, but did not provide enhanced immunogenicity nor anti-tuberculous activity (4), and this

despite the fact that ESAT6 is one of the most promising subunit vaccine candidate antigens

(34,35). Overexpression in BCG of the immunodominant secreted antigen Ag85B (28) has shown

enhanced protection over BCG in the guinea pig model and recently this vaccine was shown to be

more immunogenic and safe in human clinical trials (26). Moreover, a rBCG overexpressing

Ag85C was shown to induce enhanced and enduring protection against TB in a guinea pig model of

TB (30). However, when a rBCG overexpressing Ag85B was tested in the mouse model, no

differences in terms of anti-tuberculous activity were observed (43), suggesting that in mice, which

are more resistant to TB than guinea pigs, the enhanced activity of rBCG Ag85B/C could not be

observed.

In this report, a new recombinant BCG strain expressing the candidate antigen MPT64 on the

bacterial surface was developed using a recently described PE-based mycobacterial surface-delivery

system (11). We confirmed that the PE_∆MPT64 chimera expressed in a live M. bovis BCG strain

(HPE-∆MPT64-BCG) is exposed on the mycobacterial surface. Immunization of mice with this live

recombinant BCG strain induced a level of protection against M. tuberculosis that was significantly

superior to the that induced by the parental BCG as assessed by enumeration of CFUs and

histopathological analysis. Moreover, the enhanced protection conferred by HPE-∆MPT64-BCG

correlates with the induction of IFN-γ expressing CD4 and CD8 cells and the emergence of an

MPT64 specific T cell clone.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

20

Superior vaccine efficacy was observed in mice with the rBCG expressing the membrane-

perforating listeriolysin (∆ureC hly+ rBCG strain) and the enhanced activity correlated with

improved cross-priming, which caused enhanced T cell-mediated immunity (23). Another rBCG

strain (AFRO-1) expressing perfringolysin O and overexpressing key immunodominant M.

tuberculosis antigens provided slightly enhanced activity in terms of survival in mice infected with

the clinical M. tuberculosis strain HN878, but did not demonstrate a reduction in mycobacterial

loads in the lungs and spleens compared to the parent BCG strain (52). To our knowledge, the

protective activity induced by HPE-∆MPT64-BCG in the mouse model of TB ranks this new

vaccine among the most effective so far tested in the mouse TB challenge model. It would be of

great interest to perform the protection assays in the guinea pig and non-human primate models of

M. tuberculosis infection.

Lipoarabinomann, arabinogalactan and other sugars; mycolic acids, glycolipids and phenolic lipids,

together with peptidoglycan are the main components of the mycobacterial cell wall. It is well

established that the mycobacterial cell wall is a very immunogenic component with strong

immunostimulatory properties as classically highlighted by the use of the Freund’s adjuvant, that is

made of oleic acid and heat killed M. tuberculosis. The adjuvant properties are linked to the pro-

inflammatory activity of these molecules that induce TNF, IL-6, IL-1, IL-12, and trigger

upregulation of MHC-II and CD1d1 on macrophages (21). To enhance the immune response

specifically induced against the recombinant antigen expressed by BCG, we aimed at expressing a

protein antigen, MPT64, in the context of the mycobacterial cell wall.

Localization of the MPT64 protein on the BCG surface, in tight association with the mycobacterial

cell wall, was achieved using a PE-based delivery system that we recently developed (11), and

resulted in enhanced immunogenicity and protective activity of the recombinant BCG. When the

MPT64 was overexpressed in the cytoplasm, or associated to the inner membrane, or secreted out of


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

21

the cell, we could not obtain a similar anti-tuberculous activity. Nevertheless, in line with previous

studies (25), overexpression of the PE_∆MPT64 chimera was necessary, since mice immunized

with 33PE-∆MPT64-BCG did not show enhanced protection over the BCG group. Moreover, since

overexpression of the PE domain only did not provide enhanced activity to BCG, we conclude that

association of MPT64 with the mycobacterial cell wall enhances the antigen specific

immunogenicity and contributes to the superior activity of HPE-∆MPT64-BCG over the other rBCG

expressing MPT64.

Indeed, antigen-specific immune response determined in mice immunized with the different rBCGs

was shown to be dependent upon MPT64 cellular localization. In particular, we show that HPE-

∆MPT64-BCG is able to sustain an MPT64-specific CD8-mediated response over time, much more

effectively than 33PE-∆MPT64-BCG and H∆MPT64-BCG, despite all three strain induce similar

numbers of CD8+ specific cells early after vaccination. On the contrary, the number of IFN-γ

secreting MPT64-specific CD4+ cells declines to similar levels in mice compared with all tested

BCG strains. Thus, the number of CD4+ or CD8+ MPT64-specific cells induced early after

vaccination does not appear to correlate with protection. We also find that the number of CD4+ T

cells secreting IFN-γ and IL2 in response to stimulation with MPT64 is more constantly increased

following immunization with HPE-∆MPT64-BCG than with the other BCG strains. It may be

suggested that IL-2 secretion by these cells plays a role in favouring survival of CD8+ cells while

IFN-γ helps to maintain the secretion of type1 cytokines.

It has been reported that protection from infection with SIV in monkeys correlates with the ability

to recruit one specific T cell repertoire, more than to a global immune response (41). Similarly, we

have shown that T cell repertoires are different in pathogenic and non-pathogenic autoimmune


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

22

responses in human disease and experimental models (40,46). We therefore asked if cell

localization (HPE-∆MPT64-BCG versus H∆MPT64-BCG) and amount of antigen produced (HPE-

∆MPT64-BCG versus 33PE-∆MPT64-BCG) impact on T cell repertoire selection, and if differences

in the composition of the MPT64-specific repertoire were correlated with protection. The results

reported in Table 2 clearly draw the attention to the failure of both 33PE-∆MPT64-BCG and

H∆MPT64-BCG to recruit T cells carrying the BV8.3-BJ1.5 of 172b length compared to HPE-

∆MPT64-BCG. The relevance of this observation is further increased by data reported in Table 3,

showing that these cells are consistently associated with antigen driven IFN-γ secretion.

The avidity of a TCR for its ligand is one of the factors that determine the secretory phenotype

acquired by a T cell upon activation. In particular, cells with TCR showing high avidity for an

MHC/peptide complex are biased to differentiate into Th1 cells (8,9,29). The fact that T cells

carrying the BV8.3-BJ1.5 of 172b length rearrangement secrete IFN-γ even upon Th2-promoting

conditions (unpublished results) suggests that they may recognize with high affinity an epitope

derived from MPT64. However, the same cells are not recruited by the PE_∆MPT64, when it is

expressed under the control of a weaker promoter in the 33PE-∆MPT64-BCG strain. A possible

explanation for this result is that the specific T cell epitope induced by these live BCG strains

behave as a “subdominant” epitope. If this is the case, dendritic cells will present it efficiently when

infected by the high-expressing HPE-∆MPT64-BCG strain, but fail to present it at a level sufficient

for T cell priming when infected by the low-expressing 33PE-∆MPT64-BCG strain. More in depth

studies are required to identify and characterize the immunological correlates of protection,

specifically during infection. It would be of interest for instance to monitor the emergence of the

MPT64-specific T cell clones identified in this study in the spleen and lung tissue at different time

points following M. tuberculosis infection in naïve versus BCG and HPE-∆MPT64-BCG

immunized mice and determine how these correlates with the degree of disease.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

23

Several studies have shown that cellular localization of the heterologous protein expressed by a

rBCG affects the antigen-specific immune response elicited (for a review see ref. (18)). Previous

attempts to deliver an antigen to the mycobacterial cell wall relied mostly on the use of the 19kDa-

lipoprotein signal sequence (22,51). The 19kDa lipoprotein has immunomodulatory properties, has

been implicated in the downregulation of immune effector mechanisms of the host (38) and it has

been demonstrated that overexpression of 19 kDa antigen in BCG abrogates the protective activity

of BCG due to a polarization of the host immune response towards Th2 (44). Indeed, immunization

of mice with rBCG expressing the outer surface protein A (OspA) of Borrelia burgdorferi as a

membrane-associated lipoprotein resulted in protective antibody response that was 100-1000 fold

higher than the response elicited by immunization with rBCG expressing the same antigen in the

cytoplasm or as a secreted fusion protein (51). Similar results were also observed when proteins of

the porcine reproductive and respiratory syndrome virus (7) or pneumococcal surface protein A (33)

were expressed as 19 Kda-fusion proteins on the mycobacterial surface. In this study,

immunization with HPE-∆MPT64-BCG did not induce specific humoral response against MPT64

but rather elicited a higher and more persistent CD8 T cell response compared to that induced by

the other rBCG expressing MPT64 in other cellular compartments. These results underline the

usefulness of the PE-delivery system for the expression of heterologous antigens in BCG for which

a strong cell mediated immune response is pursued.

Acknowledgment

This work has been supported by an E.U. 6th Framework grant (“Innovac” project; LSH-2005-036871) to

G.D. and R.M and by the italian MIUR (2007BEP8WH) to G.F. We would like to thank Dr. Maria


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

24

Emiliana Caristo and the staff at the animal facility at the Catholic University of the Sacred Hearth for the

professional support provided. We also thank Michael J. Brennan for the helpful insights provided during

the experiments and for careful reviewing the manuscript.

Figure legends

Figure 1. Whole cells ELISA on M. bovis BCG wild type or recombinant BCG expressing

PE_∆MPT64 or ∆MPT64HA. The assay was developed using an anti-MPT64 mouse antiserum as

primary antibody

Figure 2: Protective activity induced by a series of rBCG strains expressing the MPT64 antigen in

different cellular compartments or expressing the PE domain only. Immunized and control mice

were infected 10 weeks post-immunization with M. tuberculosis Erdman. 28 days later mice were

sacrificed and lung and spleen bacterial load were determined by CFU counting. A) Lung; B)

Spleen. (* p < 0,05 Naïve vs. vaccinated groups; ** p< 0,05 BCG vs. HPE-∆MPT64-BCG).

Figure 3: Protective activity induced by the HPE-∆MPT64-BCG strain at day 70 post-infection.

Immunized and control mice were infected 10 weeks post-immunization with M. tuberculosis

Erdman. 70 days later mice were sacrificed and lung and spleen bacterial load were determined by

CFU counting. A) Bacterial loads at day 70 in the lung and spleen tissue (* p < 0,05 Naïve vs.

vaccinated groups; ** p< 0,05 BCG vs. HPE-∆MPT64-BCG).


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

25

Figure 4: Histopathological analysis carried out on lung tissue of mice immunized with the various

BCG strains and infected with M. tuberculosis. The lung left lobes were removed, fixed and stained

with H&E. Extension of the tissue damage was assessed by determining: A) Median granuloma

surface area; B) Median total tissue surface area with lesions; C) Median number of granulomas per

lung left lobe; D) ratio between the tissue surface area with lesions and the total area (expressed in

%). At least three section per lung, and five lungs per group were analyzed as indicated in materials

and methods. Statistical nalysis was performed using the ttest (* p<0,05 versus naïve group;

**p<0,01 versus BCG group; E) Histopathological analysis performed on lung tissues isolated

from mice obtained 70 days following aerogenic challenge with M. tuberculosis Erdman.

Representative slides are shown for mice immunized with BCG, HPE-∆MPT64-BCG and Naïve.

Magnification is 40X, 200X and 400X from top to bottom.

Figure 5. Survival of vaccinated and control mice following a low-dose aerogenic challenge with

the virulent Mtb Erdman strain. Ten mice per group were used in this experiment. Log-rank

(Mantel – Cox) tests were performed to compare survival curves. Naïve (•) vs. BCG (�) and HPE-

∆MPT64-BCG (�) mice were statistically different (p<0.05).

Figure 6: Induction and persistence of MTP64-specific type 1 CD4+ and CD8+ cells. C57Bl/6 mice

were vaccinated with HPE-∆MPT64-BCG, 33PE-∆MPT64-BCG and H∆MPT64-BCG or with the

control 33PE-BCG strains. Spleen cells were obtained 2 or 11 weeks after vaccination, and the

number of T cells secreting IFN-γ in response to stimulation with MPT64 was assessed as described

in Materials and Methods. Each dot represents an individual mouse. The dashed line represents the

average +2 SD of the value obtained in mice vaccinated with the control strain 33PE-BCG.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

26

Fig. 7: Analysis of multifunctional CD4+ T cells specific for MPT64. Four groups of mice were

infected with 33PE-BCG (5 mice), HPE-∆MPT64-BCG (6 mice), 33PE-∆MPT64-BCG (5 mice) and

H∆MPT64-BCG (6 mice). Fifteen days later, spleen cells were obtained and cultured for 16h in the

absence or presence of MPT64. BrefeldinA was added for the last 8 hr of culture. Cells were then

stained for CD4 and for intracellular IFN-γ, IL-2 and TNF-α. A) MPT64-driven secretion of each

tested cytokine. Each dot represents the value of MPT64-specific CD4+ cell (number of cells

secreting the cytokine in the presence of MPT64 minus the number obtained in the sample cultured

in the absence of added antigen) for a single mouse. In the cases in which the value was negative, it

is reported as a 0. B) Evaluation of multifunctional T cells in MPT64-stimulated samples. Upper

panels: exemplificative analysis of one sample; numbers (1-6) refer each population to the color

code of the pie charts, reported in the lower panels. Pie charts: distribution of cytokine secretion of

the CD4+ T cells in MPT64-stimulated samples. Areas report the average proportion of each

functional population in each group of mice described above.

Figure 8: Immunoscope analysis of the response to MPT64. A) C57Bl/6 mice were vaccinated with

HPE-∆MPT64-BCG. Two weeks later spleen cells were obtained and cultured in the presence or

absence of MPT64. mRNA and cDNA were prepared and pooled. A complete immunoscope was

performed as described in Materials and Methods. Black squares indicate those spectra showing an

alteration of the Gaussian distribution of CDR3 length for the BV-BJ rearrangement. B) Examples

of the spectra obtained for the indicated shared rearrangements obtained culturing spleen cells in the

absence or presence of MPT64. Peaks corresponding to the expanded shared rearrangements are

shaded.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

27

References

1. Aagaard, C., T. T. Hoang, A. Izzo, R. Billeskov, J. Troudt, K. Arnett, A. Keyser, T.

Elvang, P. Andersen, and J. Dietrich. 2009. Protection and polyfunctional T cells induced

by Ag85B-TB10.4/IC31 against M. tuberculosis is highly dependent on the antigen dose.

PLoS. ONE. 4:e5930.

2. Andersen, P. and T. M. Doherty. 2005. The success and failure of BCG - implications for a

novel tuberculosis vaccine. Nat. Rev. Microbiol. 3:656-662.

3. Arden, B., S. P. Clark, D. Kabelitz, and T. W. Mak. 1995. Mouse T-cell receptor variable

gene segment families. Immunogenetics 42:501-530.

4. Bao, L., W. Chen, H. Zhang, and X. Wang. 2003. Virulence, immunogenicity, and

protective efficacy of two recombinant M. bovis bacillus Calmette-Guerin strains expressing

the antigen ESAT-6 from M. tuberculosis. Infect. Immun. 71:1656-1661.

5. Barker, L. F., M. J. Brennan, P. K. Rosenstein, and J. C. Sadoff. 2009. Tuberculosis

vaccine research: the impact of immunology. Curr. Opin. Immunol. 21:331-338.

6. Bastos, R. G., S. Borsuk, F. K. Seixas, and O. A. Dellagostin. 2009. Recombinant M. bovis

BCG. Vaccine 27:6495-6503.

7. Bastos, R. G., O. A. Dellagostin, R. G. Barletta, A. R. Doster, E. Nelson, and F. A.

Osorio. 2002. Construction and immunogenicity of recombinant M. bovis BCG expressing

GP5 and M protein of porcine reproductive respiratory syndrome virus. Vaccine 21:21-29.

8. Blander, J. M., D. B. Sant'Angelo, K. Bottomly, and C. A. Janeway, Jr. 2000. Alteration

at a single amino acid residue in the T cell receptor alpha chain complementarity determining


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

28

region 2 changes the differentiation of naive CD4 T cells in response to antigen from T helper

cell type 1 (Th1) to Th2. J. Exp. Med. 191:2065-2074.

9. Boyton, R. J. and D. M. Altmann. 2002. Is selection for TCR affinity a factor in cytokine

polarization? Trends Immunol. 23:526-529.

10. Brennan, M. J., U. Fruth, J. Milstien, R. Tiernan, N. S. de Andrade, and L. Chocarro.

2007. Development of new tuberculosis vaccines: a global perspective on regulatory issues.

PLoS. Med. 4:e252.

11. Cascioferro, A., G. Delogu, M. Colone, M. Sali, A. Stringaro, G. Arancia, G. Fadda, G.

Palu, and R. Manganelli. 2007. PE is a functional domain responsible for protein

translocation and localization on mycobacterial cell wall. Mol. Microbiol. 66:1536-1547.

12. Colditz, G. A., T. F. Brewer, C. S. Berkey, M. E. Wilson, E. Burdick, H. V. Fineberg, and

F. Mosteller. 1994. Efficacy of BCG vaccine in the prevention of tuberculosis. Meta- analysis

of the published literature . JAMA 271:698-702.

13. Delogu, G. and G. Fadda. 2009. The quest for a new vaccine against tuberculosis. J. Infect.

Dev. Ctries. 3:5-15.

14. Delogu, G., A. Howard, F. M. Collins, and S. L. Morris. 2000. DNA Vaccination against

Tuberculosis: Expression of a Ubiquitin- Conjugated Tuberculosis Protein Enhances

Antimycobacterial Immunity. Infect. Immun. 68:3097-3102.

15. Delogu, G., A. Li, C. Repique, F. Collins, and S. L. Morris. 2002. DNA vaccine

combinations expressing either tissue plasminogen activator signal sequence fusion proteins

or ubiquitin-conjugated antigens induce sustained protective immunity in a mouse model of

pulmonary tuberculosis. Infect. Immun. 70:292-302.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

29

16. Delogu, G., C. Pusceddu, A. Bua, G. Fadda, M. J. Brennan, and S. Zanetti. 2004.

Rv1818c-encoded PE_PGRS protein of M. tuberculosis is surface exposed and influences

bacterial cell structure. Mol. Microbiol. 52525252:725-733.

17. Delogu, G., M. Sanguinetti, C. Pusceddu, A. Bua, M. J. Brennan, S. Zanetti, and G.

Fadda. 2006. PE_PGRS proteins are differentially expressed by M. tuberculosis in host

tissues. Microbes. Infect. 8:2061-2067.

18. Dennehy, M. and A. L. Williamson. 2005. Factors influencing the immune response to

foreign antigen expressed in recombinant BCG vaccines. Vaccine 23:1209-1224.

19. Derrick, S. C., T. H. Evering, V. K. Sambandamurthy, K. V. Jalapathy, T. Hsu, B. Chen,

M. Chen, R. G. Russell, A. P. Junqueira-Kipnis, I. M. Orme, S. A. Porcelli, W. R.

Jacobs, Jr., and S. L. Morris. 2007. Characterization of the protective T-cell response

generated in CD4-deficient mice by a live attenuated M. tuberculosis vaccine. Immunology

120:192-206.

20. Dietrich, J., C. Aagaard, R. Leah, A. W. Olsen, A. Stryhn, T. M. Doherty, and P.

Andersen. 2005. Exchanging ESAT6 with TB10.4 in an Ag85B fusion molecule-based

tuberculosis subunit vaccine: efficient protection and ESAT6-based sensitive monitoring of

vaccine efficacy. J. Immunol. 174:6332-6339.

21. Flynn, J. L. and J. Chan. 2005. What's good for the host is good for the bug. Trends

Microbiol. 13:98-102.

22. Grode, L., M. Kursar, J. Fensterle, S. H. Kaufmann, and J. Hess. 2002. Cell-mediated

immunity induced by recombinant M. bovis Bacille Calmette-Guerin strains against an

intracellular bacterial pathogen: importance of antigen secretion or membrane-targeted antigen

display as lipoprotein for vaccine efficacy. J. Immunol. 168:1869-1876.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

30

23. Grode, L., P. Seiler, S. Baumann, J. Hess, V. Brinkmann, E. A. Nasser, P. Mann, C.

Goosmann, S. Bandermann, D. Smith, G. J. Bancroft, J. M. Reyrat, S. D. van, B.

Raupach, and S. H. Kaufmann. 2005. Increased vaccine efficacy against tuberculosis of

recombinant M. bovis bacille Calmette-Guerin mutants that secrete listeriolysin. J. Clin. Invest

115:2472-2479.

24. Hess, J., D. Miko, A. Catic, V. Lehmensiek, D. G. Russell, and S. H. Kaufmann. 1998. M.

bovis Bacille Calmette-Guerin strains secreting listeriolysin of Listeria monocytogenes. Proc.

Natl. Acad. Sci. U. S. A 95:5299-5304.

25. Himmelrich, H., R. Lo-Man, N. Winter, P. Guermonprez, C. Sedlik, M. Rojas, D.

Monnaie, M. Gheorghiu, M. Lagranderie, M. Hofnung, B. Gicquel, J. M. Clement, and

C. Leclerc. 2000. Immune responses induced by recombinant BCG strains according to level

of production of a foreign antigen: malE. Vaccine 18:2636-2647.

26. Hoft, D. F., A. Blazevic, G. Abate, W. A. Hanekom, G. Kaplan, J. H. Soler, F. Weichold,

L. Geiter, J. C. Sadoff, and M. A. Horwitz. 2008. A new recombinant bacille Calmette-

Guerin vaccine safely induces significantly enhanced tuberculosis-specific immunity in

human volunteers. J. Infect. Dis. 198:1491-1501.

27. Horwitz, M. A. and G. Harth. 2003. A new vaccine against tuberculosis affords greater

survival after challenge than the current vaccine in the guinea pig model of pulmonary

tuberculosis. Infect. Immun. 71:1672-1679.

28. Horwitz, M. A., G. Harth, B. J. Dillon, and S. Maslesa-Galic'. 2000. Recombinant bacillus

calmette-guerin (BCG) vaccines expressing the M.tuberculosis 30-kDa major secretory

protein induce greater protective immunity against tuberculosis than conventional BCG

vaccines in a highly susceptible animal model. Proc. Natl. Acad. Sci. U. S. A 97:13853-

13858.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

31

29. Iezzi, G., E. Scotet, D. Scheidegger, and A. Lanzavecchia. 1999. The interplay between the

duration of TCR and cytokine signaling determines T cell polarization. Eur. J. Immunol.

29:4092-4101.

30. Jain, R., B. Dey, N. Dhar, V. Rao, R. Singh, U. D. Gupta, V. M. Katoch, V. D.

Ramanathan, and A. K. Tyagi. 2008. Enhanced and enduring protection against tuberculosis

by recombinant BCG-Ag85C and its association with modulation of cytokine profile in lung.

PLoS. ONE. 3:e3869.

31. Jeon, C. Y., S. H. Hwang, J. H. Min, D. R. Prevots, L. C. Goldfeder, H. Lee, S. Y. Eum,

D. S. Jeon, H. S. Kang, J. H. Kim, B. J. Kim, D. Y. Kim, S. M. Holland, S. K. Park, S. N.

Cho, C. E. Barry, III, and L. E. Via. 2008. Extensively drug-resistant tuberculosis in South

Korea: risk factors and treatment outcomes among patients at a tertiary referral hospital. Clin.

Infect. Dis. 46:42-49.

32. Koenig, R. 2008. Drug-resistant tuberculosis. In South Africa, XDR TB and HIV prove a

deadly combination. Science 319:894-897.

33. Langermann, S., S. R. Palaszynski, J. E. Burlein, S. Koenig, M. S. Hanson, D. E. Briles,

and C. K. Stover. 1994. Protective humoral response against pneumococcal infection in mice

elicited by recombinant bacille Calmette-Guerin vaccines expressing pneumococcal surface

protein A. J. Exp. Med. 180:2277-2286.

34. Li, Z., A. Howard, C. Kelley, G. Delogu, F. Collins, and S. Morris. 1999. Immunogenicity

of DNA vaccines expressing tuberculosis proteins fused to tissue plasminogen activator signal

sequences. Infect. Immun. 67:4780-4786.

35. Malin, A. S., K. Huygen, J. Content, M. Mackett, L. Brandt, P. Andersen, S. M. Smith,

and H. M. Dockrell. 2000. Vaccinia expression of M. tuberculosis-secreted proteins: tissue


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

32

plasminogen activator signal sequence enhances expression and immunogenicity of M.

tuberculosis Ag85. Microbes. Infect. 2:1677-1685.

36. McShane, H., R. Brookes, S. C. Gilbert, and A. V. Hill. 2001. Enhanced immunogenicity of

CD4(+) t-cell responses and protective efficacy of a DNA-modified vaccinia virus Ankara

prime-boost vaccination regimen for murine tuberculosis. Infect. Immun. 69:681-686.

37. Nicolo, C., S. G. Di, M. Orsini, S. Rolla, S. Columba-Cabezas, S. Romano, V, G.

Ricciardi, B. M. Chan, and F. Ria. 2006. M. tuberculosis in the adjuvant modulates the

balance of Th immune response to self-antigen of the CNS without influencing a "core"

repertoire of specific T cells. Int. Immunol. 18:363-374.

38. Pai, R. K., M. Convery, T. A. Hamilton, W. H. Boom, and C. V. Harding. 2003. Inhibition

of IFN-γ-induced class II transactivator expression by a 19-kDa lipoprotein from M.

tuberculosis: a potential mechanism for immune evasion. J. Immunol. 171:175-184.

39. Pavelka, M. S., Jr., B. Chen, C. L. Kelley, F. M. Collins, and J. W. Jacobs, Jr. 2003.

Vaccine efficacy of a lysine auxotroph of M. tuberculosis. Infect. Immun. 71:4190-4192.

40. Penitente, R., C. Nicolo, E. P. Van den, S. G. Di, C. Agrati, F. Aloisi, E. E. Sercarz, and

F. Ria. 2008. Administration of PLP139-151 primes T cells distinct from those spontaneously

responsive in vitro to this antigen. J. Immunol. 180:6611-6622.

41. Price, D. A., T. E. Asher, N. A. Wilson, M. C. Nason, J. M. Brenchley, I. S. Metzler, V.

Venturi, E. Gostick, P. K. Chattopadhyay, M. Roederer, M. P. Davenport, D. I. Watkins,

and D. C. Douek. 2009. Public clonotype usage identifies protective Gag-specific CD8+ T

cell responses in SIV infection. J. Exp. Med. 206:923-936.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

33

42. Pym, A. S., P. Brodin, L. Majlessi, R. Brosch, C. Demangel, A. Williams, K. E. Griffiths,

G. Marchal, C. Leclerc, and S. T. Cole. 2003. Recombinant BCG exporting ESAT-6 confers

enhanced protection against tuberculosis. Nat. Med. 9:533-539.

43. Qie, Y. Q., J. L. Wang, W. Liu, H. Shen, J. Z. Chen, B. D. Zhu, Y. Xu, X. L. Zhang, and

H. H. Wang. 2009. More vaccine efficacy studies on the recombinant Bacille Calmette-

Guerin co-expressing Ag85B, Mpt64 and Mtb8.4. Scand. J. Immunol. 69:342-350.

44. Rao, V., N. Dhar, H. Shakila, R. Singh, A. Khera, R. Jain, M. Naseema, C. N.

Paramasivan, P. R. Narayanan, V. D. Ramanathan, and A. K. Tyagi. 2005. Increased

expression of M. tuberculosis 19 kDa lipoprotein obliterates the protective efficacy of BCG by

polarizing host immune responses to the Th2 subtype. Scand. J. Immunol. 61:410-417.

45. Ria, F., A. Gallard, C. R. Gabaglia, J. C. Guery, E. E. Sercarz, and L. Adorini. 2004.

Selection of similar naive T cell repertoires but induction of distinct T cell responses by native

and modified antigen. J. Immunol. 172:3447-3453.

46. Ria, F., R. Penitente, S. M. De Santis, C. Nicolo, S. G. Di, M. Orsini, D. Arzani, A.

Fattorossi, A. Battaglia, and G. F. Ferraccioli. 2008. Collagen-specific T-cell repertoire in

blood and synovial fluid varies with disease activity in early rheumatoid arthritis. Arthritis

Res. Ther. 10:R135.

47. Rolla, S., C. Nicolo, S. Malinarich, M. Orsini, G. Forni, F. Cavallo, and F. Ria. 2006.

Distinct and non-overlapping T cell receptor repertoires expanded by DNA vaccination in

wild-type and HER-2 transgenic BALB/c mice. J. Immunol. 177:7626-7633.

48. Sali, M., S. Clarizio, C. Pusceddu, A. Zumbo, G. Pecorini, S. Rocca, S. Zanetti, G.

Delogu, and G. Fadda. 2008. Evaluation of the anti-tuberculosis activity generated by

different multigene DNA vaccine constructs. Microbes. Infect.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

34

49. Singh, J. A., R. Upshur, and N. Padayatchi. 2007. XDR-TB in South Africa: no time for

denial or complacency. PLoS. Med. 4:e50.

50. Skeiky, Y. A., M. R. Alderson, P. J. Ovendale, J. A. Guderian, L. Brandt, D. C. Dillon, A.

Campos-Neto, Y. Lobet, W. Dalemans, I. M. Orme, and S. G. Reed. 2004. Differential

immune responses and protective efficacy induced by components of a tuberculosis

polyprotein vaccine, Mtb72F, delivered as naked DNA or recombinant protein. J. Immunol.

172:7618-7628.

51. Stover, C. K., G. P. Bansal, M. S. Hanson, J. E. Burlein, S. R. Palaszynski, J. F. Young,

S. Koenig, D. B. Young, A. Sadziene, and A. G. Barbour. 1993. Protective immunity

elicited by recombinant bacille Calmette-Guerin (BCG) expressing outer surface protein A

(OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med. 178:197-209.

52. Sun, R., Y. A. Skeiky, A. Izzo, V. Dheenadhayalan, Z. Imam, E. Penn, K. Stagliano, S.

Haddock, S. Mueller, J. Fulkerson, C. Scanga, A. Grover, S. C. Derrick, S. Morris, D. M.

Hone, M. A. Horwitz, S. H. Kaufmann, and J. C. Sadoff. 2009. Novel recombinant BCG

expressing perfringolysin O and the over-expression of key immunodominant antigens; pre-

clinical characterization, safety and protection against challenge with M. tuberculosis. Vaccine

27:4412-4423.

53. Wang, J., L. Thorson, R. W. Stokes, M. Santosuosso, K. Huygen, A. Zganiacz, M. Hitt,

and Z. Xing. 2004. Single mucosal, but not parenteral, immunization with recombinant

adenoviral-based vaccine provides potent protection from pulmonary tuberculosis. J.

Immunol. 173:6357-6365.

54. Weinrich Olsen A., L. A. van Pinxteren, O. L. Meng, R. P. Birk, and P. Andersen. 2001.

Protection of mice with a tuberculosis subunit vaccine based on a fusion protein of antigen

85b and esat-6. Infect. Immun. 69696969:2773-2778.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

35

55. World Health Organization. 2009. Global Tuberculosis Control. Surveillance, Planning,

Financing, In .


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Table 1. BCG recombinant strains used in this work

Acronym Notes Code Plasmid MPT64

localization

Plasmid

reference

HPE-∆MPT64-BCG

rBCG expressing the MPT64, lacking the

signal sequence, fused to the PE domain

of PE_PGRS33 under the control of the

hsp60 promoter.

rBCG1 pSTE2 Cell wall (11)

33PE-∆MPT64-BCG

rBCG expressing the MPT64, lacking the

signal sequence, fused to the PE domain

of PE_PGRS33 under the control of the

PE_PGRS33 (Rv1818c) promoter

rBCG6 pAL32 Cell wall This study

H∆MPT64-BCG

rBCG expressing the MPT64 protein

lacking the signal sequence, under the

control of the hsp60 promoter.

rBCG14 pPA2 Cytoplasm (11)

HPE-BCG

rBCG expressing the PE domain of

PE_PGRS33 under the control of the

hsp60 promoter.

rBCG121 pMV1818cPE

Cell wall (16)

33PE-BCG

rBCG expressing the PE domain of

PE_PGRS33 under the control of the

PE_PGRS33 (Rv1818c) promoter.

rBCG5 pMV7-27 Cell wall This study


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Table 2: MPT-64 specific, shared TCR-beta chain rearrangements are used differently depending on the BCG strain.

*p=0.0004; ** p=0.008; *** p=0.02

Vaccination with HPE-∆MPT64-

BCG

(positive mice

/total mice tested)

33PE-∆MPT64-

BCG

(positive mice

/total mice tested)

H∆MPT64-BCG

(positive mice

/total mice tested)

TCR rearrangement

BV3.1-BJ2.2 (127) 5/10 2/6 1/7

BV5.2-BJ21.6 (178) 7/10 3/6 0/7*

BV8.3-BJ1.5 (172) 6/10 0/6** 1/7***

BV20-BJ2.1 (118) 5/10 1/6 3/7


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Table 3: MPT-64 specific, shared TCR-beta chain rearrangements have distinct cytokine profiles.

+/-: rearrangement found associated with IFN-γ secreting cells in one out of four experiments;

+: rearrangement found associated with IFN-γ secreting cells in all four experiments;

-: rearrangement not found associated with IFN-γ secreting cells in four experiments.

Secretion of IFN-γ

TCR rearrangement

BV3.1-BJ2.2 (127) +/-

BV5.2-BJ21.6 (178) +

BV8.3-BJ1.5 (172) +

BV20-BJ2.1 (118) -


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

0

0,1

0,2

0,3

0,4

0,5

0,6

0,7

Abs a

t 405 n

m

HPE-∆MPT64-BCG BCGH∆MPT64-BCG

Figure 1


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

4

5

6

7

logC

FU

/lung

* * * * * *

**

BC

G

HP

E-∆∆∆∆

MP

T64

-BC

G

33P

E-∆∆∆∆

MP

T64

-BC

G

H∆∆∆∆M

PT64

-BC

G

HP

E-B

CG

33P

E-B

CG

Nai

ve

AFigure 2


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

B

BC

G

HP

E-∆∆∆∆

MP

T64

-BC

G

33P

E-∆∆∆∆

MP

T64

-BC

G

H∆∆∆∆M

PT64

-BC

G

HP

E-B

CG

33P

E-B

CG

Nai

ve

3

4

5

6

logC

FU

/sple

en

* * * * * *

Figure 2


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

3

4

5

6

7

8Lung

Spleen

logC

FU

/org

an

A

Nai

ve

BCG

HPE-∆

MPT6

4-BCG

Nai

ve

BCG

HPE-∆

MPT6

4-BCG

* * * *

**

Figure 3


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

C

A B

**

*

**

D

**

*

**

Figure 4

Naive BCG HPE_∆MPT64

BCG Naive BCG HPE_∆MPT64

BCG

Naive BCG HPE_∆MPT64

BCGNaive BCG HPE_∆MPT64

BCG


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

E

Naive BCG HPE_∆∆∆∆MPT64 BCGFigure 4


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Figure 5

0 100 200 300 4000

50

100

150

Days

Perc

en

t su

rviv

al


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Figure 6

102

103

104

105

MP

T64-s

pecif

ic IF

N- γ

γ γ γ

secre

tin

g C

D4+

cells

102

103

104

105

MP

T64-s

pecif

ic IF

N-

γγ γγ

secre

tin

g C

D8+

cells

33P

E-B

CG

HP

E-∆∆∆∆

MP

T64-B

CG

33P

E-∆∆∆∆

MP

T64-B

CG

H∆∆∆∆

MP

T64-B

CG

2 weeks 11 weeks

33P

E-B

CG

HP

E-∆∆∆∆

MP

T64-B

CG

33P

E-∆∆∆∆

MP

T64-B

CG

H∆∆∆∆

MP

T64-B

CG


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Cy

tok

ine

-se

cre

tin

g,

MP

T6

4-s

pe

cifi

c C

D4

+ce

lls

/ 1

06

CD

4+

cell

s

33PE

-BC

G

HPE

-∆∆∆∆M

PT

64

-BC

G

33PE

-∆∆∆∆M

PT

64

-BC

G

H∆∆∆∆

MP

T6

4-B

CG

A B

p=0.011

Ag- MPT64

IFN

-γCD4

TN

F-α

IL-212

3

4

5 6

Figure 7


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

1.1 1.2 1.3 1.4 1.5 1.6 2.1 2.2 2.3 2.4 2.5 2.7

1

2

3.1

4

5.1

5.2

5.3

6

7

8.1

8.2

8.3

9

10

11

12

13

14

15

16

17

18

19

20

BV

20

BJ2

.1B

V8

.3 B

J1

.5B

V5

.2 B

J1

.6B

V3

.1 B

J2

.2BV

BJ

Ag- MPT64

A BFigure 8


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

downloaded from //iai.asm.org/content/iai/early/2010/10/04/iai.00267-10.full.pdf · first and...

Documents