downloaded from on july 24, 2020 by guest · 2/24/2012 · 61 empirical antimicrobial...

Infectious Pericarditis Due to B. holmesii Nei T, et al.

1

Infectious Pericarditis Due to Bordetella holmesii 1

in an Adult Patient with Malignant Lymphoma: 2

First Report of a Case 3

4

Authors 5

Takahito Nei1†), Hideya Hyodo1‡), Kazunari Sonobe2), Kazuo Dan1‡), Ryoichi Saito3) 6

7

1) Department of Internal Medicine,†Divisions of Respiratory Medicine, Infection and 8

Oncology, ‡ Divisions of Hematology, Gastroenterology and Endocrinology and 9

Metabolism, Nippon Medical School 10

2) Department of Clinical Laboratory, Nippon Medical School 11

3) Department of Moleculo-genetic Sciences, Microbiology and Immunology, Tokyo 12

Medical and Dental University 13

14

Corresponding author: Takahito Nei, MD, PhD 15

Department of Internal Medicine (Divisions of Respiratory 16

Medicine, Infection and Oncology), Nippon Medical School 17

FAX: +81-3-5685-3075 18

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.06772-11 JCM Accepts, published online ahead of print on 29 February 2012

on Novem

ber 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

http://jcm.asm.org/


2

Phone: +81-3-5814-6266 19

E-mail address: [email protected] 20

E-mail address for each author: Takahito Nei, [email protected] 21

Hideya Hyodo, [email protected] 22

Kazunari Sonobe, [email protected] 23

Kazuo Dan, [email protected] 24

Ryoichi Saito, [email protected] 25

26

Conflict of interest Statement: None of the authors have financial relationships with any 27

commercial entity with an interest in the subject of this manuscript. 28

29

Key words: Bordetella holmesii, infectious pericarditis 30

31

Running title: Infectious Pericarditis Due to B. holmesii 32

33

34

Abstract 35

Bordetella holmesii is a fastidious Gram-negative rod first identified in 1995. Though 36

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


3

rare, it is isolated mainly in immunocompromised and asplenic hosts, and is associated with 37

bacteremia, pertussis-like respiratory tract infection and endocarditis. Herein, we describe a 38

unique B. holmesii infectious pericarditis patient with malignant lymphoma. (46 words) 39

Case Description 40

A 71-year-old male was hospitalized because of fever and dyspnea on effort. He had 41

received 8 cycles of chemotherapy for malignant lymphoma (diffuse large B-cell lymphoma) 42

over the prior year, but complete remission was not achieved. Because of a persistent lesion, 43

we initiated maintenance therapy including rituximab administration which was continued 44

until the present hospitalization. Approximately 2 weeks prior to presentation, he complained 45

of dyspnea on effort and a rising low-grade fever. Follow-up computed tomography 46

suggested pericardial effusion (Fig. 1A) and pleural change was suspected (Fig. 1B). He 47

was thus admitted under a diagnosis of possible pericarditis. Clinical examination findings 48

on presentation were unremarkable other than a temperature of 37.5°C. Initial laboratory 49

investigations revealed elevations of aspartate aminotransferase (AST) and alanine 50

aminotransaminase (ALT) to 30 and 59 IU/l, respectively (normal ranges: 10 to 28 and 5 to 51

33 IU/l, respectively), an alkaline phosphatase level of 392 IU/l (normal range: 104 to 338 52

IU/l), a hemoglobin level of 11.1 g/dl (normal range: 12 to 18 g/dl) and a C-reactive protein 53

(CRP) level of 22.99 mg/dl (normal value, less than 0.3 mg/dl). The white blood cell count 54

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


4

was 6,200/µl, i.e. within normal limits. However, the percentage of segmented neutrophils 55

was 86.5 % (normal range: 38 to 58 %). Serum electrolytes and creatinine were within 56

normal limits. Chest radiographs showed slight cardiomegaly, whereas abdominal 57

radiographs revealed no abnormalities. HBs antigen and anti-hepatitis C antibody were 58

negative. 59

In view of the possibility of pericarditis, he received pericardial drainage therapy and 60

empirical antimicrobial administration (ceftriaxone 2000mg/day) upon admission. The 61

pericardial effusion was bloody and contained neutrophil-rich inflammatory cells but no 62

malignant cells. Gram staining was negative. With empirical antimicrobial therapy, his 63

clinical symptoms disappeared and pericardial effusion did not re-accumulate after drain 64

removal. We ultimately removed more than 1,000ml of pericardial effusion, and culture of 65

approximately 20ml of this effusion was started. Forty-eight hours after starting the culture, 66

gray, smooth, round colonies less than 1mm in diameter, were isolated from blood agar 67

(Eiken Chemical Co., Tokyo, Japan) (Fig. 2). There was no colony growth at 24 h when 68

bacteria were inoculated onto 5% sheep blood agar plates and incubated in 5% CO2 under 69

aerobic conditions, whereas they grew after 5 days on MacConkey agar (Oriental Yeast Co., 70

Tokyo, Japan). Isolates were small gram-negative coccobacilli on microscopic observation 71

and no motility was seen in sulfide-indole-motility medium. Furthermore, isolates were 72

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


5

oxidase test negative and showed neither nitrate reduction nor urease production. We finally 73

identified the strain with 16s ribosomal RNA genotyping, as previously described [7], as 74

being Bordetella holmesii and a similarity search was conducted using the BLAST program 75

(DDBJ, Shizuoka, Japan). The results (1,456 bp) showed 100% similarity to the reference 76

strain (GenBank accession no. DQ409136) [similarity to B. pertussis (GenBank accession 77

no. BX640420), 99.73%; similarity to B. parapertussis (GenBank accession no. BX640434), 78

99.52%, similarity to B. bronchiseptica (GenBank accession no. BX640449), 99.52%]. 79

Furthermore, the isolates were confirmed by PCR detection of bhoE [2], a gene not found in 80

B. pertussis but present in B. holmesii, using primers Bh-bhoE-F (tggggagcaaacaggattag) 81

and Bh-bhoE-R (agagtgccctttcgtagcaa). Agglutination testing (Denka Seiken, Co., Ltd., 82

Tokyo, Japan) for identification of B. pertussis was negative. Susceptibility to representative 83

antimicrobial agents was determined by Etest on Mueller-Hinton agar. The present isolate 84

was sensitive to ampicillin (MIC, 1 µg/ml), ceftriaxone (MIC, 1 µg/ml), clarithromycin (MIC, 85

less than 2 µg/ml) and ciprofloxacin (MIC, less than 0.12 µg/ml). The patient’s fever resolved 86

within 2 days of commencing intravenous ceftriaxone, and the pericardial fluid did not 87

reaccumulate after beginning antimicrobial therapy. He felt better, and CRP normalized. 88

Administration of ceftriaxone was continued for 4 weeks, but myelosuppression associated 89

with ceftriaxone administration developed. Ceftriaxone was thus switched to levofloxacin, in 90

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


6

response to the ongoing neutropenia. He was given granulocyte-colony stimulating factor, 91

and his neutrophil count normalized. On the 63rd hospital day, he was discharged in good 92

condition. 93

94

The genus Bordetella belongs to the Alcaligenaceae family which is currently 95

comprised of eight known species. Among representative species, B. pertussis is the 96

causative agent of whooping cough (pertussis), and B. parapertussis and B. bronchiseptica 97

have also been implicated in respiratory tract infections in humans. The present species, B. 98

holmesii, was also recently reported to have been detected in patients with pertussis-like 99

respiratory syndrome [6, 15]. The other species, B. avium, B. hinzii and B. petrii, are rarely 100

detected in respiratory samples from patients with chronic respiratory infectious diseases 101

including cystic fibrosis [4, 15, 18]. Moreover, B. trematum has also reportedly been 102

detected in ear and wound infections [1, 19]. Immunocompromised status is considered to 103

be strongly associated with the establishment of infection due to these rare Bordetella 104

species. 105

B. holmesii was first described in 1995 as a cause of sepsis in 15 patients [20], 106

including at least three asplenic children, but no specific clinical findings were described. 107

The first detailed clinical case report was published later that year. A 12-year-old male with a 108

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


7

history of splenectomy for idiopathic thrombocytopenic purpura was diagnosed with sepsis 109

due to B. holmesii. However, he complained only of low-grade fever, no other symptoms, 110

and his physical state was essentially normal [8]. Since then, B. holmesii has been reported 111

as a causative microorganism of bacteremia, endocarditis and community-acquired 112

pneumonia. In these previous reports, it is noteworthy that most patients were in 113

immunocompromised states, mainly the asplenic condition [2, 5, 10, 11, 12, 14, 16]. 114

Shepard and colleagues reported 26 patients with B. holmesii bacteremia and 85 % were in 115

an anatomical or functional asplenic state [14]. Moreover, the clinical courses were usually 116

uneventful and relatively mild. Most patients recovered without complications. 117

The present case is the first description, to our knowledge, of infectious pericarditis 118

due to B. holmesii. Bacterial pericarditis accounts for approximately 5% of all pericarditis 119

cases [9, 13, 17] and occurs via direct infection during trauma, thoracic surgery, or catheter 120

drainage, by spread from an intrathoracic, myocardial, or subdiaphragmatic focus, and by 121

hematogenous dissemination. The frequent causative organisms are Staphylococcus spp. 122

and Streptococcus spp, which often cause rheumatic pancarditis, Haemophilus spp, and 123

Mycobacterium tuberculosis. M. tuberculosis is considered to be the most common 124

microorganism causing bacterial pericarditis, because the pericardium can be reached via 125

hematogenous spead or extension from adjacent organs, particularly the lungs or pleural 126

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


8

space [13]. In the present case, chest CT showed slight changes of the pleura and adjacent 127

lung parenchyma (Fig. 1B, 1C). However, we were not able to obtain pleura or lung samples 128

from the indicated regions, and can only speculate that B. holmesii had migrated to the 129

pericardium from the lung or pleural space. 130

We advocate that B. holmesii be considered among the possible causative microbes 131

of infectious pericarditis. A recent report [15] showed B. holmesii to be strongly associated 132

with pertussis-like respiratory syndrome caused by B. pertussis and B. parapertussis. 133

Furthermore, B. holmesii was identified as a causative microbe of bacterial pneumonia [3]. 134

Hence, we consider B. holmesii to be not only a cause of sepsis or septicemia in 135

immunocompromised or asplenic individuals but also a common cause of infectious 136

respiratory system diseases associated with involvement of adjacent organs or tissues 137

including the pericardium. Future development of a rapid and specific technique to detect B. 138

holmesii might have a major diagnostic impact. 139

In conclusion, B. holmesii is a rare but important cause of pericarditis. In view of the 140

possibility of this microbe causing respiratory system disease, awareness of B. holmesii is 141

warranted. 142

Acknowledgements 143

The authors thank Bierta Barfod, MD. for editing the manuscript and Toshie Sekine for 144

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


9

secretarial assistance. 145

146

References 147

[1] Daxboeck, F., E. Goerzer, P. Apfalter, M. Nehr, and R. Krause. 2004. Isolation of 148

Bordetella trematum from a diabetic leg ulcer. Diabet. Med. 21:1247-1248. 149

[2] Diavatopoulos, D. A., C. A. Cummings, H. G. van der Heide, M. van Gent, S. Liew, 150

D. A. Relman, and F. R. Mooi. 2006. Characterization of a highly conserved island in 151

the otherwise divergent Bordetella holmesii and Bordetella pertussis genomes. J. 152

Bacteriol. 188: 8385–8394. 153

[3] Dörbecker, C., C. Licht, F. Korber, G. Plum, C. Haefs, B. Hoppe, and H. Seifert. 154

2007. Community-acquired pneumonia due to Bordetella holmesii in a patient with 155

frequently relapsing nephrotic syndrome. J. Infect. 54:e203-e205. 156

[4] Fry, N. K., J. Duncan, M. T. Edwards, R. E. Tilley, D. Chitnavis, R. Harman, H. 157

Hammerton, and L. Dainton. 2007. A UK clinical isolate of Bordetella hinzii from a 158

patient with myelodysplastic syndrome. J. Med. Microbiol. 56:1700-1703 159

[5] Greig, J. R., S. S. Gunda, and J. T. C. Kwan. 2001. Bordetella holmesii bacteraemia in 160

an individual on haemodialysis. Scand. J. Infect. Dis. 33:716-717. 161

[6] Harrington, A. T., J. A. Castellanos, T. M. Ziedalski, J. E. Clarridge III, and B. T. 162

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


10

Cookson. 2009. Isolation of Bordetella avium and novel Bordetella strain from patients 163

with respiratory disease. Emerg. Infect. Dis. 15:72-74. 164

[7] Kageyama, A., K. Torikoe, M. Iwamoto, J. Masuyama, Y. Shibuya, H. Okazaki, 165

K .Yazawa, S. Minota, R. M. Kroppenstedt, and Y. Mikami. 2004. Nocardia arthritidis 166

sp. nov., a new pathogen isolated from a patient with rheumatoid arthritis in Japan. J. 167

Clin. Microbiol. 42: 2366-2371. 168

[8] Lindquist, S. W., D. J. Weber, M. E. Mangum, D. G. Hollis, and J. Jordan. 1995. 169

Bordetella holmesii sepsis in an asplenic adolescent. Pediatr. Infect. Dis. J. 14:813-815. 170

[9] Maisch B., and A. D. Ristić. 2002. The classification of pericardial disease in the age 171

of modern medicine. Curr. Cardiol. Rep. 4:13-21. 172

[10] McCavit, T. L., S. Grube, P. Revell, and C. T. Quinn. 2008. Bordetella holmesii 173

bacteremia in sickle cell disease. Pediatr. Blood Cancer 51:814-816. 174

[11] Morris, J. T., and M. Myers. 1998. Bacteremia due to Bordetella holmesii. Clin. Infect. 175

Dis. 27:912-913. 176

[12] Njamkepo, E., F. Delisle, I. Hagege, G. Gerbaud, and N. Guiso. 2000. Bordetella 177

holmesii isolated from a patient with sickle cell anemia: analysis and comparison with 178

other Bordetella holmesii isolates. Clin. Microbiol. Infect. 6:131-136. 179

[13] Sagristà-Sauleda J., J. A. Barrabés, G. Permanyer-Miralda, and J. Soler-Soler. 180

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


11

1993. Purulent pericarditis: review of a 20-year experience in a general hospital. J. Am. 181

Coll. Cardiol. 22: 1661–1665. 182

[14] Shepard, C. W., M. I. Daneshvar, R. M. Kaiser, D. A. Ashford, D. Lonsway, J. B. 183

Patel, R. E. Morey, J. G. Jordan, R. S. Weyant, and M. Fischer. 2004. Bordetella 184

holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin. 185

Infect. Dis. 38:799-804. 186

[15] Spilker, T., A. A. Liwienski, and J. J. LiPuma. 2008. Identification of Bordetella spp. in 187

respiratory specimens from individuals with cystic fibrosis. Clin. Microbiol. Infect. 188

14:504-506. 189

[16] Tang, Y. W., M. K. Hopkins, C. P. Kolbert, P. A. Hartley, P. J. Severance, and D. H. 190

Persing. 1998. Bordetella holmesii-like organisms associated with septicemia, 191

endocarditis, and respiratory failure. Clin. Infect. Dis. 26:389-392. 192

[17] Troughton R. W., C. R. Asher, and A. L. Klein. 2004. Pericarditis. Lancet 193

363:717-727. 194

[18] Vandamme, P., J. Hommez, M. Vancanneyt, M. Monsieurs, B. Hoste, B. Cookson, 195

C. H. Wirsing von Konig, K. Kersters, and P. J. Blackall. 1995. Bordetella hinzii sp. 196

nov., isolated from poultry and humans. Int. J. Syst. Bacteriol. 45:37-45. 197

[19] Vandamme, P., M. Heyndrickx, M. Vancanneyt, B. Hoste, P. De Vos, E. Falsen, K. 198

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


12

Kersters, and K. H. Hinz. 1996. Bordetella trematum sp. nov., isolated from wounds 199

and ear infections in humans, and reassessment of Alcaligenes denitrificans Ruger and 200

Tan 1983. Int. J. Syst. Bacteriol. 46:849-858. 201

[20] Weyant, R. S., D. G. Hollis, R. E. Weaver, M. F. Amin, A. G. Steigerwalt, S. P. 202

O'Connor, A. M. Whitney, M. I. Daneshvar, C. W. Moss, and D. J. Brenner. 1995. 203

Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. 204

J. Clin. Microbiol. 33:1-7. 205

206

207

Figure legends 208

FIG. 1. Computed tomography (CT) of the chest on admission shows massive pericardial 209

effusion (FIG. 1A, white solid line) and slight pleural and lung changes adjacent to the 210

pericardium (FIG. 1B, black dashed line). High density lesions are seen in the pleura and 211

lung parenchyma adjacent to the pericardium while chest CT scan of a normal control 212

individual (TN) without pericarditis shows no such changes (FIG. 1C). 213

Fig. 2. Isolation of colonies from pericardial effusion and microscopic view of isolates (the 214

upper right panel, original magnification X1,000). Colonies grew slowly and at least 48 h 215

were required before they became observable. All colonies are less than 1mm in diameter 216

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


13

and appear as brown or green areas in the medium. Isolates were found to be short 217

gram-negative coccobacilli by microscopic study. 218

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Figure 1

A

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Figure 1Figure 1

B C

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Figure 2Figure 2

10μm

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

downloaded from on july 24, 2020 by guest · 2/24/2012 · 61 empirical antimicrobial...

Documents