draft...draft of mscs originating from mesoderm, including ucmscs, bone marrow mesenchymal stem...

Draft

Homogeneity and heterogeneity of biological characteristics in mesenchymal stem cells from human umbilical cords and

exfoliated deciduous teeth

Journal: Biochemistry and Cell Biology

Manuscript ID bcb-2019-0253.R1

Manuscript Type: Article

Date Submitted by the Author: 17-Nov-2019

Complete List of Authors: Yang, Chao; Sichuan Stem Cell BankChen, Yu; Sichuan Stem Cell BankZhong, Liwu; Sichuan Stem Cell BankYou, Min; Sichuan Stem Cell BankYan, Zhiling; Chengdu women's and children's central hospital, stomatologyLuo, Maowen; Sichuan Stem Cell BankZhang, Bo; Sichuan Stem Cell BankYang, Benyanzi; Sichuan Stem Cell BankChen, Qiang; Sichuan Stem Cell Bank

Keyword:human umbilical cord mesenchymal stem cells, stem cells from human exfoliated deciduous teeth, biological characteristics, migration, differentiation

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/bcb-pubs

Biochemistry and Cell Biology

Draft

Homogeneity and heterogeneity of biological characteristics in

mesenchymal stem cells from human umbilical cords and

exfoliated deciduous teeth

Chao Yang1*, Yu Chen1, Liwu Zhong1, Min You1, Zhiling Yan2, Maowen Luo1, Bo

Zhang1, Benyanzi Yang1, Qiang Chen1,3*

1 Stem Cells and Regenerative Medicine Research Center, Sichuan Stem Cell

Bank/Sichuan Neo-life Stem Cell Biotech Inc., Chengdu, China

2 Department of Stomatology, Chengdu Women's and Children's Central Hospital,

Chengdu, China

3 Center for Stem Cell Research & Application, Institute of Blood Transfusion, Chinese

Academy of Medical Sciences and Peking Union Medical College, Chengdu, China.

Corresponding authors:

Qiang Chen: Stem Cells and Regenerative Medicine Research Center, Sichuan Stem

Cell Bank/Sichuan Neo-life Stem Cell Biotech Inc., Chengdu, China; Center for Stem

Cell Research & Application, Institute of Blood Transfusion, Chinese Academy of

Medical Sciences and Peking Union Medical College, Chengdu, China.

and

Chao Yang: Stem Cells and Regenerative Medicine Research Center, Sichuan Stem

Cell Bank/Sichuan Neo-life Stem Cell Biotech Inc., Chengdu, China

E-mail address: [email protected] (Q.C.); [email protected](C.Y.)

Page 1 of 35



Draft

Abstract

Mesenchymal stem cells (MSCs) have proven powerful potential for cell-based therapy

both in regenerative medicine and disease treatment. Human umbilical cords and

exfoliated deciduous teeth are the main sources to derive MSCs with nearly no donor

injury and ethical issue. The goal of this study was to investigate the differences of

biological characteristics in human umbilical cord mesenchymal stem cells (UCMSCs)

and stem cells from human exfoliated deciduous teeth (SHEDs). UCMSCs and SHEDs

were identified by flow cytometry. The proliferation, differentiation, migration,

chemotaxis, paracrine, immunomodulatory, neurite growth-promoting capabilities and

acetaldehyde dehydrogenase (ALDH) activity were comparatively studied between

these two MSCs in vitro. The results showed that both SHEDs and UCMSCs expressed

cell surface markers characteristic of MSCs. Furthermore, SHEDs exhibited better

capacities in proliferation, migration, promotion of neurite growth and chondrogenic

differentiation. Meanwhile, UCMSCs showed more outstanding adipogenic

differentiation and chemotaxis abilities. Additionally, there is no significant difference

in osteogenic differentiation, immunomodulatory capacity, and the proportion of

ALDH bright compartment. Our findings indicate that although both UCMSCs and

SHEDs are mesenchymal stem cells and presented some similar biological

characteristics, they also have differences in many aspects, which might be instructive

to future clinical cellular therapeutics for different diseases.

Keywords

human umbilical cord mesenchymal stem cells; stem cells from human exfoliated

deciduous teeth; biological characteristics; migration;

Page 2 of 35



Draft

Introduction

Mesenchymal stem cells (MSCs) are progenitor cells which are characterized by

the ability to self-renewal and differentiate into multi-lineage cells including adipocytes,

chondroblasts, and osteoblasts(Bernardo and Fibbe 2013). In addition, MSCs are of low

immunogenicity because of not expressing the major histocompatibility complex

(MHC) class II antigens(Bernardo and Fibbe 2013). It is indeed because of their low

immunogenicity, broad immunoregulatory abilities and multi-differentiation potentials,

MSCs were used in a wide range of potential auto- and allo-transplanted therapeutic

applications, such as regenerative medicine and abnormal immune response(Bernardo

and Fibbe 2013; Mendicino et al. 2014).

MSCs have been isolated from many tissues, including bone marrow, umbilical

cord, adipose, and dental tissues(Du et al. 2016; Gottipamula et al. 2014; Gronthos et

al. 2000; Miura et al. 2003; Zuk et al. 2001). Among these MSC sources, umbilical cord

is perinatal tissue and can be collected after parturition, while exfoliated deciduous teeth

can be obtained during dental transitional period of the children. Both parturition and

deciduous teeth exfoliation are normal and necessary physiological processes; therefore,

human umbilical cord and exfoliated deciduous teeth are the main sources to derive

MSCs with nearly no invasive intervention or ethical issue. Nowadays, a great many of

stem cell banks have been established in many countries. Based on the properties

mentioned above, both human umbilical cord mesenchymal stem cells (UCMSCs) and

stem cells from human exfoliated deciduous teeth (SHEDs) have been isolated for

experimental and clinical research and cryopreserved for future applications(Arora et

al. 2009; Ma et al. 2012; Qin et al. 2016).

Human dental tissues originate from ectoderm, and are differentiated from cranial

neural crest cells, to be more exact, while human umbilical cords develop from the

mesoderm(Bosshardt 2005; Gronthos et al. 2000; Kerkis et al. 2006; Sobolewski et al.

1997). Previous studies have compared the characteristics and functions of MSCs

developed from ectoderm, such as SHEDs, dental pulp stem cells (DPSCs), dental

follicle stem cells (DFSCs)(Guo et al. 2013; Wang et al. 2018; Yang et al. 2017).

Furthermore, some studies have also comparatively analyzed the biological properties

Page 3 of 35



Draft

of MSCs originating from mesoderm, including UCMSCs, bone marrow mesenchymal

stem cells (BMMSCs) and adipose-derived mesenchymal stem cells (ADMSCs)(Du et

al. 2016; Hu et al. 2013). By current classification, both UCMSCs and SHEDs belong

to MSCs, and they may have some similar properties. However, due to the fact that they

originate from different blastoderms, we speculate that these two types of MSCs may

present more different biological characteristics than MSCs from the same blastoderm.

So far, the biological characteristics between UCMSCs and SHEDs have not been

comparably analyzed in detail. Therefore, the main goal of this study was to perform

the comparison of biological characteristics between UCMSCs and SHEDs, including

proliferation, differentiation, migration, chemotaxis, paracrine, immunomodulatory,

neurite growth -promoting capabilities and acetaldehyde dehydrogenase (ALDH)

activity. Our findings may be beneficial for choosing suitable MSCs for different

applications and instructive to future clinical cellular therapeutics.

Materials and Methods

Isolation and cultivation of SHEDs and UCMSCs

The research protocol in this study was compatible with the Code of Ethical

Principles for Medical Research Involving Human Subjects of the World Medical

Association (Declaration of Helsinki) and approved by the Institutional Review Board

of Sichuan Neo-life Stem Cell Biotech Inc. Human exfoliated deciduous teeth and

umbilical cords were collected with written informed consent from the parents of the

donors. For the isolation of SHEDs, human exfoliated deciduous teeth were rinsed with

sterile phosphate buffered saline (PBS) twice, then the attachments on the surface of

the teeth were removed. After the surface was cleaned, the teeth were washed with

sterile PBS twice. The dental pulp cavities of the deciduous teeth were exposed and the

pulp tissues were collected. After being cleaned with sterile PBS and cut with medical

scissors, the pulp tissue blocks were digested with digestive enzyme mixture. After

digestion and centrifugation, the pulp tissues blocks were resuspended and cultivated

in Dulbecco's Modified Eagle Medium (DMEM, Gibco, USA) supplemented with F12,

and 10% fetal bovine serum (FBS, Gibco, USA). Meanwhile, Human UCMSCs were

Page 4 of 35



Draft

isolated and cultivated as described previously(Yang et al. 2018a). Briefly, the

umbilical cords were rinsed with sterile PBS and cut into segments with the length of 1

cm. After being cut into small pieces, the cord tissue blocks were cultivated in DMEM

supplemented with F12, and 10% FBS. Both SHEDs and UCMSCs were cultivated in

a humidified atmosphere at 37 °C with 5% CO2, and the cultivation medium was

replaced every two days. SHEDs and UCMSCs at passage 3 were used for the following

experiments.

Surface marker analysis

A total of 3×106 SHEDs or UCMSCs were digested and collected for flow

cytometry analysis. SHEDs and UCMSCs were incubated with FITC-conjugated

primary antibodies against CD29, CD44, CD73 and CD90, and PE-conjugated primary

antibodies against CD34, CD105 and CD166, and PC7 conjugated primary antibody

against CD45. In addition, SHEDs and UCMSCs incubated with FITC-, PE- and PC7-

conjugated IgM Isotype Control antibody were set as controls. All the antibodies were

purchased from Beckman Coulter. After being incubated with antibodies in the dark at

room temperature for 20 min and washed twice with PBS, the cells were run in a

Beckman Coulter DxFLEX (Beckman Coulter, USA), and the data were analyzed using

CytExpert software (Beckman Coulter, USA).

Cell proliferation assay

Cell Counting Kit-8 (CCK-8, Dojindo, Japan) was used to perform the cell

proliferation assay. The amount of the formazan dye generated by dehydrogenases in

live cells is relative to the number of cells. A total of 3×103 SHEDs or UCMSCs were

cultivated in each well of 96-well plates for 7 days. Before spectrophotometry

measurement was performed, the original culture medium was removed, and 110 μl of

medium containing 10% CCK-8 was added in each well. After incubation for 3 hours,

100 μl of the supernatant was collected from each sample for spectrophotometry

measurement. The absorbance at 450 nm was recorded using a spectrophotometer

(Thermo Fisher, USA).

Page 5 of 35



Draft

Tri-lineage differentiation and quantitative RT-PCR analysis

The differentiation capacity of SHEDs and UCMSCs into adipocytes, osteocytes,

and chondrocytes was evaluated using STEMPRO Adipogenesis Differentiation Kits,

Osteogenesis Differentiation Kits, and Chondrogenesis Differentiation Kits,

respectively. All the differentiation kits were purchased from Gibco. The operating

procedures followed the instructions of the manufacturer of the kits. Briefly, a total of

1×105 SHEDs or UCMSCs were seeded in each well of 12-well plates and two parallel

replicates were prepared. After cultivation for 24 h, the medium was replaced by

Adipogenesis, Osteogenesis, or Chondrogenesis differentiation medium, respectively.

After cultivation in differentiation medium for 14 days, half of the cells were

collected for quantitative reverse transcription polymerase chain reaction (qRT-PCR)

analysis. Total RNA was extracted from cells using RNAiso Plus (Takara, Japan). The

complementary DNA (cDNA) synthesis was performed using a RevertAid First Strand

cDNA Synthesis Kit (Thermo Fisher, USA) on a GeneAmp 9700 PCR System (Applied

Biosystem, USA). SYBR Premix Ex Taq II (perfect real time) (Takara, Japan) and

cDNA were placed in a StepOnePlus Real-Time PCR System ((Applied Biosystem,

USA) for qRT-PCR analysis. All of the operating procedures followed the

manufacturers’ protocols and described previously(Yang et al. 2014). We monitored

the expression of CCAAT/enhancer-binding protein alpha (CEBPA) for adipogenesis,

aggrecan (ACAN) for chondrogenesis and runt-related transcription factor 2 (RUNX2)

for osteogenesis. PCR primer sequences and PCR products sizes are listed in Table 1.

Sequences for primers were designed and blasted at Primer BLAST website

(https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). The relative expression

of the housekeeping gene GAPDH was used as reference for normalization. Relative

expression levels were calculated using the delta/delta calculation method for

quantification(Livak and Schmittgen 2001). Three parallel replicates were prepared.

After cultivation for 21 days, the remaining cells were fixed in 4%

paraformaldehyde. The staining and observation of osteogenesis, adipogenesis and the

chondrogenesis were performed as described previously(Yang et al. 2018a). The

Page 6 of 35



Draft

images of the stained cells were observed and acquired under a microscope (Leica

Optical, Germany).

Transwell migration analysis

Transwell with 8 µm pore size polycarbonate membrane insert (Corning, USA)

was used to evaluated the deformation and migration ability. SHEDs or UCMSCs were

resuspended with DMEM/F12 without FBS and adjusted to a concentration of 2×105

cells/ml. 600 μl of DMEM/F12 containing 10% FBS was added into each well, then

200 μl of cell suspension mentioned above was inoculated into the insert chamber.

After cultivation for 24 hours, the medium was removed, and the cells were rinsed twice

using PBS. The cells were fixed with methanol for 20 minutes，then the cells in the

insert chamber were wiped with swabs. The cells in the well and under the insert

chamber were stained in crystal violet solution for 15 minutes. Then the cells were

washed with distilled water for 3 times, and the images of the stained cells were

acquired under a microscope (Leica Optical, USA). The data were analyzed using

ImageJ software (National Institutes of Health, USA).

Chemotaxis effects of collected supernatant

To evaluate the chemotaxis effects of SHEDs and UCMSCs supernatant on the

migratory activity of NIH/3T3 cells (mouse embryo fibroblast cell line, purchased from

Cell Bank of Chinese Academy of Sciences, China), a chemotaxis migration assay was

performed using Transwell with 8 µm pore size polycarbonate membrane insert

(Corning, USA). A total of 1×106 SHEDs or UCMSCs were resuspend in 10 ml of

DMEM/F12 containing 10% FBS and cultured for 3 days, and the supernatant of

SHEDs and UCMSCs was collected. Meanwhile, NIH/3T3 cells were resuspend with

DMEM/F12 without FBS and adjusted to a concentration of 2×105 cells/ml. 600 μl of

DMEM/F12 containing 10% FBS, SHEDs supernatant or UCMSCs supernatant was

added into each well, then 200 μl of NIH/3T3 cells suspension mentioned above was

inoculated into each insert chamber. After cultivation for 24 hours, the medium was

Page 7 of 35



Draft

removed, and the cells were rinsed twice using PBS. Then the rest of operating

procedures were the same as the staining part of ‘transwell migration analysis’

mentioned above. Because of non-uniform distribution, 7 images of the stained cells in

one well were acquired orderly under a microscope (Leica Optical, USA) and

represented all the cells in the well. The data were analyzed using ImageJ software

(National Institutes of Health, USA) and the cells of the 7 images in one well were

added up.

Enzyme‑linked immunosorbent assay of paracrine

A total of 1×106 SHEDs or UCMSCs were resuspend in 10 ml of DMEM/F12

containing 10% FBS and cultured for 3 days, and then the cell culture medium was

collected. The amount of prostaglandin E2 (PGE2), transforming growth factor β1

(TGF-β1), hepatocyte growth factor (HGF) and angiopoietin-1 (ANG-1) in the

supernatant was detected by enzyme‑ linked immunosorbent assay (ELISA). All the

ELISA kits were purchased from R&D Systems (USA). The experiment of ELISA was

performed according to the instructions of the manufacturer.

Human peripheral mononuclear cells proliferation and secretion assay

Immunomodulatory ability of SHEDs and UCMSCs were evaluated by indirect

co-culture using transwell with 0.4 µm pore size polycarbonate membrane insert

(Corning, USA). A total of 1.5×104 SHEDs or UCMSCs were seeded in each well of

24-well plates in DMEM/F12 with 10% FBS. The cells were inactivated by culture

medium with 10 μg/ml mitomycin C (Sigma, USA) for 2 hours. Following washing

with PBS for 5 times, 3×105 human peripheral blood mononuclear cells (hPBMCs, with

informed consent from the donors) resuspended in 200 μl of RPMI 1640 (Hyclone,

USA) containing 10% FBS and 10 μg/ml phytohemagglutinin (PHA, Sigma, USA)

were added in each insert chambers and co-cultured with the inactivated SHEDs and

UCMSCs for 3 days. The hPBMCs cultured in the insert chambers without SHEDs and

UCMSCs were set as control. The supernatant of each insert chamber was collected for

detecting the amount of IFN-γ and TNF-α using ELISA kits (R&D Systems, USA)

Page 8 of 35



Draft

according to the instructions of the manufacturer. For detection of the proliferation of

hPBMCs, a total volume of 20 μl of CCK-8 solution was added to the medium of each

chamber. After being incubated for 3 hours, 100 μl of each sample was collected and

detected by spectrophotometer at 450 nm (Thermo Fisher, USA).

Assessment of promoting neurite growth effects of collected supernatant

A total of 1×106 SHEDs or UCMSCs were resuspend in 10 ml DMEM/F12

containing 10% FBS and cultured for 3 days, and the supernatant of SHEDs and

UCMSCs was collected. Meanwhile, SH-SY5Y cells (human neuroblastoma cell line,

provided by Medical Research Center of Chengdu Third People's Hospital, China) were

resuspended in DMEM/F12 medium supplemented with 10% FBS and cultured in each

well of 6-well plates for 24 hours. Then SH-SY5Y cells were serum-starved and

cultured with SHED or UCMSC supernatant and DMEM/F12 medium supplemented

with 10% FBS (set as control group), respectively for 48 hours. The images of the SH-

SY5Y cells were acquired under a microscope at 10× magnification (Leica Optical,

USA). Both number and length of all neurofilament structures were calculated. The

data were analyzed using NeuronJ plugin for ImageJ software (National Institutes of

Health, USA)(Meijering 2010; Pezzini et al. 2017).

Aldehyde dehydrogenase activity analysis

Single cells of SHEDs and UCMSCs were collected to perform aldehyde

dehydrogenase activity analysis using ALDEFLUOR Kit (STEMCELL Technologies,

USA). All the operating procedures were performed according to the instructions of the

manufacturer of the product. Briefly, cell samples were adjusted to a concentration of

3×106 cells/ml with the ALDEFLUOR Assay Buffer. 1 ml of the adjusted cell

suspension was placed into each test sample tube. 5 μl of the activated ALDEFLUOR

Reagent were added into the tube and mixed immediately. Then 0.5 ml of cell

suspension were added to the tube containing 5 μl of ALDEFLUOR DEAB Reagent,

which was set as the control tube. The test and control tubes were incubated at 37 °C

without agitation for 45 minutes. Following incubation, cell samples were centrifuged

Page 9 of 35



Draft

for 5 minutes at 250 × g. After the removal of the supernatant, the cell pellets were

resuspended in 0.5 ml ALDEFLUOR Assay Buffer and detected with Beckman Coulter

Cytomics FC500 (Beckman Coulter, USA), and the data were analyzed using CXP

Software (Beckman Coulter, USA).

Statistical analysis

All data are presented as the mean ± standard deviation (SD). Multiple comparison

of results was performed with analysis of variance (ANOVA) and Bonferroni's multiple

comparison test (control group was involved). An independent samples t-test analysis

of variance was used to analyze differences between SHEDs and UCMSCs. Statistical

calculations were performed with IBM SPSS Statistics 21 software (IBM SPSS, USA).

P < 0.05 is considered statistically significant.

Results

Identification and proliferation of SHEDs and UCMSCs

The primary SHEDs were harvested after 14-18 days of culture, and primary

UCMSCs were harvested after 11-16 days (Fig. 1A). Both purified SHEDs and

UCMSCs presented classic spindle shape after two passages of subculture (Fig. 1B and

1C), and flow cytometric analysis showed that ≥99% of SHEDs and UCMSCs

population expressed CD29, CD44, CD73, CD90, CD105 and CD166. Moreover, these

cells were negative for CD34 and CD45 (Fig. 2 and Table 2). Additionally, the CCK-

8 results revealed that there was no significant difference in proliferation between

SHEDs and UCMSCs at the initial 5 days, but SHEDs presented higher proliferation

capacity than UCMSCs on the seventh day (Fig. 1D).

Comparison of the differentiation capacities of SHEDs and UCMSCs

After being cultured in adipogenesis, chondrogenesis and osteogenesis

differentiation medium for 21 days, the staining results showed that SHEDs and

UCMSCs could differentiate into adipogenic, chondrogenic and osteogenic cells (Fig.

3A and 3B). To evaluate the differentiation ability between SHEDs and UCMSCs more

Page 10 of 35



Draft

accurately, these cells cultured in differentiation medium mentioned above for 14 days

were collected to measure the genes expression level of CEBPA, ACAN and RUNX2

which were used to represent adipogenesis, chondrogenesis and osteogenesis,

respectively. The qRT-PCR results revealed that the expression level of CEBPA of

UCMSCs was fivefold higher than that of SHEDs, while ACAN expression of SHEDs

was threefold higher than that of UCMSCs. In addition, there was no significant

difference in RUNX2 gene expression between SHEDs and UCMSCs (Fig. 3C).

Migration abilities of SHEDs and UCMSCs

To evaluate the transmigration ability of SHEDs and UCMSCs, a transwell assay

was performed. Cells transmigrated across the membrane were stained by crystal violet

solution. After the cells had been cultured for 24 hours, the results showed that most of

the transmigrating cells, either SHEDs or UCMSCs, were under the insert chamber, and

nearly no cell was in the wells. Therefore, we counted the cells under the inserts. The

number of SHEDs transmigrated across the membrane was 168.33±41.45, while the

number of UCMSCs was 102.07±49.24 (Fig. 4A).

Comparison of the chemotaxis effects of the supernatant on NIH/3T3 cells

The chemotaxis effects of the SHEDs and UCMSCs supernatant was evaluated on

the transmigration of NIH/3T3 cells using transwell assay. SHEDs and UCMSCs

supernatant were collected and added in the wells, and medium containing FBS were

used as a control medium. NIH/3T3 cells were resuspended in medium without FBS

and seeded in inserts. NIH/3T3 cells transmigrated across the membrane were stained

by crystal violet solution. After being cultured for 24 hours, most of the transmigrating

NIH/3T3 cells were in the wells, but not under the inserts. Therefore, we counted the

cells in the wells. The number of NIH/3T3 transmigrating into the control medium was

85.33±5.51, while the number into SHEDs and UCMSCs supernatant were

304.00±109.04 and 443.40±40.57 (Fig. 4B).

Paracrine levels of SHEDs and UCMSCs

Page 11 of 35



Draft

Four paracrine cytokines related to regeneration and immunomodulation were

detected to compare the corresponding functions of SHEDs and UCMSCs. The ELISA

results showed that the ANG-1 paracrine level of SHEDs is 6084.07±2074.52 pg/ml,

while the level of ANG-1 in UCMSC is 5546.64±3409.10 pg/ml. The level of HGF in

SHED supernatant is 6659.48±2614.33 pg/ml, and that in UCMSC supernatant is

9570.82±12615.73 pg/ml. The PGE2 paracrine level of SHEDs is 1500.05±1857.21

pg/ml as compared with 1857.20±1263.41 pg/ml for that in UCMSCs. The differences

of above three paracrine cytokines between SHEDs and UCMSCs were not found to be

statistically significant, while it is still interesting that the mean value of HGF level in

UCMSCs is one-third higher than that of SHEDs. However, the value of standard

deviation is quite large, which may have made the difference of the two groups not

statistically significant. Finally, the TGF-β1 paracrine level is 3816.74±276.43 pg/ml

and 2524.92±391.66 pg/ml for SHEDs and UCMSCs (p＜0.01), respectively (Fig. 5A).

The inhibitory effects of SHEDs and UCMSCs on hPBMCs

The proliferation and inflammatory cytokines secretion were used to evaluate the

activity and function of hPBMCs modulated by the MSCs. After being co-cultured for

3 days, CCK-8 assay was used to evaluate the proliferation capacity of PBMCs.

Compared with control group (hPBMCs in medium alone), the proliferation capacity

was inhibited both in SHED and UCMSC co-culture groups (Fig. 5B). Additionally,

the secretion of inflammatory cytokines, including IFN-γ and TNF-α were inhibited

significantly in both co-culture groups. However, there’s no significant difference in

neither proliferation capacity nor secretion level of inflammatory cytokines between

SHED and UCMSC co-culture groups (Fig. 5C and 5D).

Comparison of neurite growth of SH-SY5Y cells promoted by supernatant from SHEDs

and UCMSC

Inducing neurite outgrowth of human neuroblastoma SH-SY5Y cells was used to

evaluate the neurotrophic effect of SHED and UCMSC supernatant. The supernatant of

Page 12 of 35



Draft

SHEDs was significantly more effective on neurite outgrowth than UCMSC

supernatant and control medium after 48 hours or 72 hours induction (64.69±19.38 μm

vs 39.27±8.25 μm and 34.82±8.02 μm for 48 hours and 62.46±14.59 μm vs

36.64±11.74 μm and 37.29±6.55 μm for 72 hours).However, there’s no significant

difference of neurite length in each group between 48 hours and 72 hours. Additionally,

the somas of SH-SY5Y cells in SHED supernatant raised and presented higher

refractivity than that in UCMSC supernatant and control medium (Fig. 6A and 6B).

Comparison of the ALDH activity of SHEDs and UCMSCs

As a marker of stem cells, ALDH activity was detected by ALDEFLUOR Reagent,

a florescent substrate which could to be metabolized by different ALDH isoforms. After

SHEDs and UCMSCs being processed with ALDEFLUOR Kit, the flow cytometric

analysis showed there was no significant difference in the ALDH activity between

SHEDs and UCMSCs. Specifically, the percentage of ALDH+ SHEDs is 11.38±2.26%,

while the percentage of ALDH+ UCMSCs is 11.36±2.82% (p=0.993) (Fig. 7).

Discussion

Stem cell-based tissue engineering has the potential of developing new methods

for solving serious problem of tissue or organ defect. Nowadays, MSCs have been

isolated from many fetal and adult tissues and presented common characteristics, such

as plastic adherence, colony formation, rapid proliferation, multi-differentiation

capacity and so on(Dominici et al. 2006). Previous studies have reported that MSCs

from different tissues also presented heterogeneity of biological features which affected

their biological functions(Choudhery et al. 2013; Du et al. 2016; Hu et al. 2013; Yan et

al. 2013). Thus, it is significative to select suitable MSCs by comparing their

characteristics for different medical applications. Whereas the comparison of MSCs

from different tissue sources has been investigated, this is the first study to compare the

multifaceted biological characterization in SHEDs and UCMSCs, which are of different

blastoderm origins.

In this study, both cells from exfoliated deciduous teeth and umbilical cords

Page 13 of 35



Draft

adhered to plastic and presented similar spindle morphologies. Moreover, the

immunophenotypic characterization also showed that they exhibited expression

patterns like defined MSCs. More specifically, more than 99% of the cells were

positive for mesenchymal antigens, and less than 2% of the cells were positive for

hematopoietic progenitors and endothelial cell marker (CD34) and leukocyte common

antigen (CD45) (Dominici et al. 2006). This surface epitope results demonstrated that

the cells we obtained at passage 3 are very pure MSCs.

It is well known that MSCs derived from different tissues present high

proliferation capacity as a common characteristic. In the previous study, it has been

proved that the proliferation capacity of UCMSCs is stronger than ADMSCs and

periodontal ligament stem cells (PDLSCs) (Adegani et al. 2013; Choudhery et al.

2013). SHEDs have also been demonstrated to have higher proliferation rate than

BMMSCs and DPSCs(Miura et al. 2003). It is interesting to know whether SHEDs or

UCMSCs may have a higher proliferation rate. Our results revealed that both SHEDs

and UCMSCs exhibited high proliferation rate as previously published, and there is

no significant difference on the initial 5 days of culture. However, the proliferation

rate of SHEDs was higher than that of UCMSCs on the 7th day.

Multipotent differentiation potential is a classical and important feature of

MSCs(Dominici et al. 2006). The cells undergone adipogenesis, chondrogenesis and

osteogenesis differentiation could be positively stained by oil red O, alcian bule and

alizarin red S, respectively, and our results proved that both SHEDs and UCMSCs we

obtained had multiple-lineage differentiation capacity. However, the qRT-PCR results

revealed that the differentiation capacity between SHEDs and UCMSCs was not

exactly the same. More exactly, although there was no significant difference in

RUNX2 gene expression related to osteogenesis differentiation. CEBPA gene

expression level of UCMSCs was higher than that of SHEDs after induced

differentiation. By contrast, ACAN gene expression level of SHEDs was higher than

that of UCMSCs after induced differentiation. In other words, the differentiation

results indicated that UCMSCs had a stronger adipogenesis differentiation potential,

while SHEDs might present a stronger chondrogenesis differentiation capacity.

Page 14 of 35



Draft

Previous research reported that there was no significant difference between ASCs and

UCMSCs in term of chondrogenic potential, but better than that of amnion membrane

mesenchymal stem cells (Choudhery et al. 2013; Dabrowski et al. 2017); therefore,

SHEDs might exhibit extraordinary chondrogenic capacity among the many MSCs

tissue origins. Furthermore, these results might also guide clinical applications and

affect the outcome of regenerative medicine. For instance, it might obtain better

clinical outcome to choose SHEDs over other MSCs concerning cartilage regeneration.

Replacement of damaged or diseased cells by differentiation is one of the

mechanisms of MSCs to exert their biological functions(Spees et al. 2016). More and

more research showed that paracrine effect of MSCs is also important and affect the

biological functions(Liang et al. 2014; Spees et al. 2016). For instance, paracrine

factors could present trophic or chemotaxis effects to promote the migration of

endogenous cells to repair the defection tissues. Herein, we used NIH/3T3 cells and

transwell assay to simulate the endogenous cell migration and evaluate the chemotaxis

effects of SHEDs and UCMSCs. The results revealed that both SHED and UCMSC

supernatant presented better chemotaxis effects than control medium. Furthermore,

UCMSC supernatant exhibited more remarkable effects than SHED supernatant to

attract the NIH/3T3 cells. From this perspective, it seemed that UCMSCs might obtain

more regenerative effects by promoting the migration of endogenous cells. However,

it has been previously shown that the migration ability of MSCs themselves is also of

paramount importance for mediating regenerative effects at sites of tissue

damage(Marquez-Curtis and Janowska-Wieczorek 2013; Naaldijk et al. 2015). Thus,

we also detected the migration ability of SHEDs and UCMSCs themselves using

transwell assay, and the results showed that SHEDs exhibited more extraordinary

migration ability than UCMSCs. The chemotaxis and migration results indicated that

SHEDs and UCMSCs might present different repair advantages after transplantation.

More specifically, SHEDs might migrate to the lesion site more easily than UCMSCs,

but UCMSCs might perform greater attraction for the migration of endogenous cells,

and the results might also guide the clinical application of MSCs. For example, which

MSCs, SHEDs or UCMSCs, would obtain better therapeutic effect with local injection

Page 15 of 35



Draft

in the lesion site or intravenous infusion is worthy of consideration.

As mentioned above, paracrine effects play a critical role on the biological

functioning of MSCs. MSCs innately secrete plenty of various bioactive cytokines,

and there is no doubt that MSCs have both immunomodulatory and trophic

function(Arnold I. Caplan 2012; Caplan and Dennis 2006). The immunomodulatory

capacity and not expressing the major histocompatibility complex class II antigens

allows allogeneic MSCs to be used clinically for inflammatory disease without

abnormal excessive activation of immune cells(van den Akker et al. 2013; Zhao et al.

2015). In order to evaluate and compare the immunomodulatory capacity of SHEDs

and UCMSCs, we detected the secretion levels of PGE2 and TGF-β1 related to

immunomodulation(Kim et al. 2015). Previous study reported that upregulation of

PGE2 enhanced the immunosuppressive effects of UCMSCs by inhibiting T-cell

activation and blocking the induction of inflammatory cytokines, while promoting the

secretion of the anti-inflammatory cytokines(Yang et al. 2018b). Meanwhile,

MSCs showed decreased activity in inhibiting T cells after TGF-β1 signaling pathway

was blocked(Niu et al. 2017). Our results showed that there was no significant

difference in the secretion level of PGE2, but TGF-β1 level of SHEDs were higher

than that of UCMSCs. Then we performed the indirect co-culture experiment to verify

the effects of the anti-inflammatory cytokines, and the result showed that both SHEDs

and UCMSCs could inhibit the proliferation of hPBMCs and the secretion of TNF-α

and IFN-γ as the inflammatory cytokines, but there were no significant differences

between them. Additionally, we detected the levels of ANG-1 and HGF to evaluate

the trophic function. ANG-1 from MSCs has been reported to play a role in preventing

apoptosis, enhancing angiogenesis, reducing the levels of pro-inflammatory cytokines

and increasing the expression of the anti-inflammatory cytokines and neurotropic

proteins, and overexpressing ANG-1 improved the therapeutic potential of MSCs for

many diseases (Shujia et al. 2008; Tian et al. 2018). Moreover, previous studies

indicated a clear beneficial effect of HGF on the survival of MSCs, the promotion of

angiogenesis and anti-fibrosis, which presented great potential for the treatment of

lung injury, and hepatocirrhosis, etc (Chang et al. 2016; Chen et al. 2017). Our data

Page 16 of 35



Draft

demonstrated SHEDs and UCMSCs secreted high levels of HGF and ANG-1.

However, there was no significant difference in the secretion levels of ANG-1 and

HGF between SHEDs and UCMSCs, which indicated that both might have similar

trophic effects.

MSCs presented beneficial neuroprotective and regenerative effects for the

treatment of nerve injury and degenerative disease via secreting neurotrophic factors,

neural differentiation and anti-apoptosis properties (Sakai et al. 2012; Wang et al. 2017;

Yang et al. 2017). Additionally, previous study speculated that MSCs might mainly

exert function via the production of local factors with protective and anti-inflammatory

properties, rather than by replacement (Frausin et al. 2015). Anyway, promoting

neurite outgrowth is one of the mechanisms for neural function recovery after lesion

including injury and degenerative disease. It has been reported previously that

secretomes collected from DPSCs exhibit the potential to enhance the neurite

outgrowth of SH-SY5Y cells (Ahmed et al. 2016). In this study, our results

demonstrated that the supernatant collected from SHEDs had the preeminent effect to

enhance the neurite outgrowth of SH-SY5Y cells when compared to supernatant from

UCMSCs and DMEM/F12 with 10% FBS, indicating that SHEDs might be the better

source for neural diseases, and the results were also in line with the developmental

origins of dental stem cells, which are derived from cranial neural crest cells (Yu et al.

2015).

ALDH can catalyze the pyridine nucleotide linked oxidization of aldehydes into

carboxylic acids, and the cell populations that expressed high activity of the ALDH

were in clinical development for use as agents to repair tissue damage (Balber 2011).

Such ALDH bright cell populations have been sorted from human cord blood, bone

marrow, mobilized peripheral blood, and so on (Balber 2011). For MSCs, ALDH

activity was known to be a classical feature of stem cells and play a critical role in

tissue regeneration. Flow cytometry has been used to distinguish and sort ALDH

bright cell populations from the whole MSCs population (Najar et al. 2018a; Najar et

al. 2018b). MSCs with high levels of the ALDH activity were showed to have

advantages in hypoxia response faculty, angiogenic potential, immunomodulation,

Page 17 of 35



Draft

hematopoietic supporting capacity, multiple-lineage differentiation potential when

compared with MSCs with low levels of the ALDH activity (Najar et al. 2018a; Najar

et al. 2018b). Our data demonstrated that the percentage of ALDH bright species in

SHEDs and UCMSCs, respectively, was very close on average for multiple samples.

However, as far as individual sample was concerned, the percentage varied in either

SHED group or UCMSC group (from 8.84% to 15.36%). Therefore, the level of

ALDH activity should be detected or sorted before application to ensure the

therapeutic effects.

Conclusions

In summary, the similarities and differences of biological characteristics between

SHEDs and UCMSCs were compared in this study. Our results indicated that there

were no significant differences in osteogenesis capacity, immunomodulation and the

level of ALDH activity. However, SHEDs exhibited more extraordinary capacities in

proliferation, chondrogenesis, migration, and neurite outgrowth promotion, while

UCMSCs showed the more preeminent abilities in adipogenesis and chemotaxis.

Moreover, the comparative results might provide a guideline and optimize the

selection of MSCs according to different clinical requirements and applications.

Acknowledgements

This study was supported by Project of Health Commission of Sichuan Province

(19PJ146). The authors would like to gratefully acknowledge Dr. Tongtong Zhang

(Medical Research Center of Chengdu Third People's Hospital, China) for providing

SH-SY5Y cells.

Conflict of interest

The authors declare that they have no conflict of interest. No financial conflict of

interest exists in the submission of this manuscript.

Page 18 of 35



Draft

ReferencesAdegani, F.J., Langroudi, L., Arefian, E., Shafiee, A., Dinarvand, P., and Soleimani,

M. 2013. A comparison of pluripotency and differentiation status of four mesenchymal adult stem cells. Mol Biol Rep 40(5): 3693-3703. doi:10.1007/s11033-012-2445-7.

Ahmed, N.E., Murakami, M., Kaneko, S., and Nakashima, M. 2016. The effects of hypoxia on the stemness properties of human dental pulp stem cells (DPSCs). Scientific reports 6: 35476. doi:10.1038/srep35476.

Arnold I. Caplan. 2012. MSCs as Therapeutics. Stem Cell Biology and Regenerative Medicine: 79-90. doi:10.1007/978-1-4614-5711-4_5.

Arora, V., Arora, P., and Munshi, A.K. 2009. Banking stem cells from human exfoliated deciduous teeth (SHED): saving for the future. J Clin Pediatr Dent 33(4): 289-294. Available from https://www.ncbi.nlm.nih.gov/pubmed/19725233 [accessed.

Balber, A.E. 2011. Concise review: aldehyde dehydrogenase bright stem and progenitor cell populations from normal tissues: characteristics, activities, and emerging uses in regenerative medicine. Stem cells 29(4): 570-575. doi:10.1002/stem.613.

Bernardo, M.E., and Fibbe, W.E. 2013. Mesenchymal stromal cells: sensors and switchers of inflammation. Cell stem cell 13(4): 392-402. doi:10.1016/j.stem.2013.09.006.

Bosshardt, D.D. 2005. Are cementoblasts a subpopulation of osteoblasts or a unique phenotype? J Dent Res 84(5): 390-406. doi:10.1177/154405910508400501.

Caplan, A.I., and Dennis, J.E. 2006. Mesenchymal stem cells as trophic mediators. Journal of cellular biochemistry 98(5): 1076-1084. doi:10.1002/jcb.20886.

Chang, H.K., Kim, P.H., Cho, H.M., Yum, S.Y., Choi, Y.J., Son, Y., et al. 2016. Inducible HGF-secreting Human Umbilical Cord Blood-derived MSCs Produced via TALEN-mediated Genome Editing Promoted Angiogenesis. Molecular therapy : the journal of the American Society of Gene Therapy 24(9): 1644-1654. doi:10.1038/mt.2016.120.

Chen, S., Chen, X., Wu, X., Wei, S., Han, W., Lin, J., et al. 2017. Hepatocyte growth factor-modified mesenchymal stem cells improve ischemia/reperfusion-induced acute lung injury in rats. Gene therapy 24(1): 3-11. doi:10.1038/gt.2016.64.

Choudhery, M.S., Badowski, M., Muise, A., and Harris, D.T. 2013. Comparison of

Page 19 of 35



https://www.ncbi.nlm.nih.gov/pubmed/19725233

Draft

human mesenchymal stem cells derived from adipose and cord tissue. Cytotherapy 15(3): 330-343. doi:10.1016/j.jcyt.2012.11.010.

Dabrowski, F.A., Burdzinska, A., Kulesza, A., Sladowska, A., Zolocinska, A., Gala, K., et al. 2017. Comparison of the paracrine activity of mesenchymal stem cells derived from human umbilical cord, amniotic membrane and adipose tissue. J Obstet Gynaecol Res 43(11): 1758-1768. doi:10.1111/jog.13432.

Dominici, M., Le Blanc, K., Mueller, I., Slaper-Cortenbach, I., Marini, F., Krause, D., et al. 2006. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8(4): 315-317. doi:10.1080/14653240600855905.

Du, W.J., Chi, Y., Yang, Z.X., Li, Z.J., Cui, J.J., Song, B.Q., et al. 2016. Heterogeneity of proangiogenic features in mesenchymal stem cells derived from bone marrow, adipose tissue, umbilical cord, and placenta. Stem cell research & therapy 7(1): 163. doi:10.1186/s13287-016-0418-9.

Frausin, S., Viventi, S., Verga Falzacappa, L., Quattromani, M.J., Leanza, G., Tommasini, A., et al. 2015. Wharton's jelly derived mesenchymal stromal cells: Biological properties, induction of neuronal phenotype and current applications in neurodegeneration research. Acta Histochem 117(4-5): 329-338. doi:10.1016/j.acthis.2015.02.005.

Gottipamula, S., Ashwin, K.M., Muttigi, M.S., Kannan, S., Kolkundkar, U., and Seetharam, R.N. 2014. Isolation, expansion and characterization of bone marrow-derived mesenchymal stromal cells in serum-free conditions. Cell and tissue research 356(1): 123-135. doi:10.1007/s00441-013-1783-7.

Gronthos, S., Mankani, M., Brahim, J., Robey, P.G., and Shi, S. 2000. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America 97(25): 13625-13630. doi:10.1073/pnas.240309797.

Guo, L., Li, J., Qiao, X., Yu, M., Tang, W., Wang, H., et al. 2013. Comparison of odontogenic differentiation of human dental follicle cells and human dental papilla cells. PloS one 8(4): e62332. doi:10.1371/journal.pone.0062332.

Hu, L., Hu, J., Zhao, J., Liu, J., Ouyang, W., Yang, C., et al. 2013. Side-by-side comparison of the biological characteristics of human umbilical cord and adipose tissue-derived mesenchymal stem cells. BioMed research international 2013: 438243. doi:10.1155/2013/438243.

Kerkis, I., Kerkis, A., Dozortsev, D., Stukart-Parsons, G.C., Gomes Massironi, S.M.,

Page 20 of 35



Draft

Pereira, L.V., et al. 2006. Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers. Cells, tissues, organs 184(3-4): 105-116. doi:10.1159/000099617.

Kim, H.S., Yun, J.W., Shin, T.H., Lee, S.H., Lee, B.C., Yu, K.R., et al. 2015. Human umbilical cord blood mesenchymal stem cell-derived PGE2 and TGF-beta1 alleviate atopic dermatitis by reducing mast cell degranulation. Stem cells 33(4): 1254-1266. doi:10.1002/stem.1913.

Liang, X., Ding, Y., Zhang, Y., Tse, H.F., and Lian, Q. 2014. Paracrine mechanisms of mesenchymal stem cell-based therapy: current status and perspectives. Cell transplantation 23(9): 1045-1059. doi:10.3727/096368913X667709.

Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4): 402-408. doi:10.1006/meth.2001.1262.

Ma, L., Makino, Y., Yamaza, H., Akiyama, K., Hoshino, Y., Song, G., et al. 2012. Cryopreserved dental pulp tissues of exfoliated deciduous teeth is a feasible stem cell resource for regenerative medicine. PloS one 7(12): e51777. doi:10.1371/journal.pone.0051777.

Marquez-Curtis, L.A., and Janowska-Wieczorek, A. 2013. Enhancing the migration ability of mesenchymal stromal cells by targeting the SDF-1/CXCR4 axis. BioMed research international 2013: 561098. doi:10.1155/2013/561098.

Meijering, E. 2010. Neuron tracing in perspective. Cytometry A 77(7): 693-704. doi:10.1002/cyto.a.20895.

Mendicino, M., Bailey, A.M., Wonnacott, K., Puri, R.K., and Bauer, S.R. 2014. MSC-based product characterization for clinical trials: an FDA perspective. Cell stem cell 14(2): 141-145. doi:10.1016/j.stem.2014.01.013.

Miura, M., Gronthos, S., Zhao, M., Lu, B., Fisher, L.W., Robey, P.G., et al. 2003. SHED: stem cells from human exfoliated deciduous teeth. Proceedings of the National Academy of Sciences of the United States of America 100(10): 5807-5812. doi:10.1073/pnas.0937635100.

Naaldijk, Y., Johnson, A.A., Ishak, S., Meisel, H.J., Hohaus, C., and Stolzing, A. 2015. Migrational changes of mesenchymal stem cells in response to cytokines, growth factors, hypoxia, and aging. Experimental cell research 338(1): 97-104. doi:10.1016/j.yexcr.2015.08.019.

Najar, M., Crompot, E., van Grunsven, L.A., Dolle, L., and Lagneaux, L. 2018a.

Page 21 of 35



Draft

Aldehyde Dehydrogenase Activity in Adipose Tissue: Isolation and Gene Expression Profile of Distinct Sub-population of Mesenchymal Stromal Cells. Stem Cell Rev 14(4): 599-611. doi:10.1007/s12015-017-9777-6.

Najar, M., Dolle, L., Crompot, E., Verhulst, S., van Grunsven, L.A., Busser, H., et al. 2018b. Isolation and Characterization of Bone Marrow Mesenchymal Stromal Cell Subsets in Culture Based on Aldehyde Dehydrogenase Activity. Tissue engineering. Part C, Methods 24(2): 89-98. doi:10.1089/ten.TEC.2017.0312.

Niu, J., Yue, W., Le-Le, Z., Bin, L., and Hu, X. 2017. Mesenchymal stem cells inhibit T cell activation by releasing TGF-beta1 from TGF-beta1/GARP complex. Oncotarget 8(59): 99784-99800. doi:10.18632/oncotarget.21549.

Pezzini, F., Bettinetti, L., Di Leva, F., Bianchi, M., Zoratti, E., Carrozzo, R., et al. 2017. Transcriptomic Profiling Discloses Molecular and Cellular Events Related to Neuronal Differentiation in SH-SY5Y Neuroblastoma Cells. Cell Mol Neurobiol 37(4): 665-682. doi:10.1007/s10571-016-0403-y.

Qin, H.L., Zhu, X.H., Zhang, B., Zhou, L., and Wang, W.Y. 2016. Clinical Evaluation of Human Umbilical Cord Mesenchymal Stem Cell Transplantation After Angioplasty for Diabetic Foot. Exp Clin Endocrinol Diabetes 124(8): 497-503. doi:10.1055/s-0042-103684.

Sakai, K., Yamamoto, A., Matsubara, K., Nakamura, S., Naruse, M., Yamagata, M., et al. 2012. Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal cord by multiple neuro-regenerative mechanisms. The Journal of clinical investigation 122(1): 80-90. doi:10.1172/JCI59251.

Shujia, J., Haider, H.K., Idris, N.M., Lu, G., and Ashraf, M. 2008. Stable therapeutic effects of mesenchymal stem cell-based multiple gene delivery for cardiac repair. Cardiovasc Res 77(3): 525-533. doi:10.1093/cvr/cvm077.

Sobolewski, K., Bankowski, E., Chyczewski, L., and Jaworski, S. 1997. Collagen and glycosaminoglycans of Wharton's jelly. Biol Neonate 71(1): 11-21. doi:10.1159/000244392.

Spees, J.L., Lee, R.H., and Gregory, C.A. 2016. Mechanisms of mesenchymal stem/stromal cell function. Stem cell research & therapy 7(1): 125. doi:10.1186/s13287-016-0363-7.

Tian, K.W., Zhang, Y.Y., Jiang, H., and Han, S. 2018. Intravenous C16 and angiopoietin-1 improve the efficacy of placenta-derived mesenchymal stem cell therapy for EAE. Scientific reports 8(1): 4649. doi:10.1038/s41598-018-22867-

Page 22 of 35



Draft

9.

van den Akker, F., de Jager, S.C., and Sluijter, J.P. 2013. Mesenchymal stem cell therapy for cardiac inflammation: immunomodulatory properties and the influence of toll-like receptors. Mediators of inflammation 2013: 181020. doi:10.1155/2013/181020.

Wang, F., Jia, Y., Liu, J., Zhai, J., Cao, N., Yue, W., et al. 2017. Dental pulp stem cells promote regeneration of damaged neuron cells on the cellular model of Alzheimer's disease. Cell biology international 41(6): 639-650. doi:10.1002/cbin.10767.

Wang, H., Zhong, Q., Yang, T., Qi, Y., Fu, M., Yang, X., et al. 2018. Comparative characterization of SHED and DPSCs during extended cultivation in vitro. Molecular medicine reports 17(5): 6551-6559. doi:10.3892/mmr.2018.8725.

Yan, Z.J., Hu, Y.Q., Zhang, H.T., Zhang, P., Xiao, Z.Y., Sun, X.L., et al. 2013. Comparison of the neural differentiation potential of human mesenchymal stem cells from amniotic fluid and adult bone marrow. Cell Mol Neurobiol 33(4): 465-475. doi:10.1007/s10571-013-9922-y.

Yang, C., Li, X., Sun, L., Guo, W., and Tian, W. 2017. Potential of human dental stem cells in repairing the complete transection of rat spinal cord. Journal of neural engineering 14(2): 026005. doi:10.1088/1741-2552/aa596b.

Yang, C., Chen, Y., Li, F., You, M., Zhong, L., Li, W., et al. 2018a. The biological changes of umbilical cord mesenchymal stem cells in inflammatory environment induced by different cytokines. Molecular and cellular biochemistry 446(1-2): 171-184. doi:10.1007/s11010-018-3284-1.

Yang, C., Sun, L., Li, X., Xie, L., Yu, M., Feng, L., et al. 2014. The potential of dental stem cells differentiating into neurogenic cell lineage after cultivation in different modes in vitro. Cellular reprogramming 16(5): 379-391.

Yang, F.Y., Chen, R., Zhang, X., Huang, B., Tsang, L.L., Li, X., et al. 2018b. Preconditioning Enhances the Therapeutic Effects of Mesenchymal Stem Cells on Colitis Through PGE2-Mediated T-Cell Modulation. Cell transplantation 27(9): 1352-1367. doi:10.1177/0963689718780304.

Yu, T., Volponi, A.A., Babb, R., An, Z., and Sharpe, P.T. 2015. Stem Cells in Tooth Development, Growth, Repair, and Regeneration. Curr Top Dev Biol 115: 187-212. doi:10.1016/bs.ctdb.2015.07.010.

Zhao, K., Lou, R., Huang, F., Peng, Y., Jiang, Z., Huang, K., et al. 2015.

Page 23 of 35



Draft

Immunomodulation effects of mesenchymal stromal cells on acute graft-versus-host disease after hematopoietic stem cell transplantation. Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation 21(1): 97-104. doi:10.1016/j.bbmt.2014.09.030.

Zuk, P.A., Zhu, M., Mizuno, H., Huang, J., Futrell, J.W., Katz, A.J., et al. 2001. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7(2): 211-228. doi:10.1089/107632701300062859.

Page 24 of 35



Draft

Figure legends

Figure 1. Morphology and growth kinetics of human SHEDs and UCMSCs. (A)

Morphology of SHEDs and UCMSCs at the primary culture (50×). (B) Morphology of

SHEDs and UCMSCs at passage 3 (100×). (C) Magnification morphology of SHEDs

and UCMSCs at passage 3 (200×). (D) The growth kinetics of SHEDs and UCMSCs.

There was no significant difference in proliferation between SHEDs and UCMSCs at

the initial 5 days, but SHEDs presented higher proliferation capacity than UCMSCs on

the seventh day. Four SHED samples and four UCMSC samples were involved in this

experiment and three parallel replicates were prepared. *P < 0.05.

Figure 2. Surface antigens of human SHEDs and UCMSCs. (A) Flow cytometric

analysis of SHEDs at passage 3 revealed expression of CD29(99.99%), CD34(0.55%),

CD44(100%), CD45(0.92%), CD73(98.03%), CD90(100%), CD105(99.97%) and

CD166(99.95%); (B) UCMSCs at passage 3 revealed expression of CD29(100%),

CD34(0.66%), CD44(99.92%), CD45(0.88%), CD73(99.96%), CD90(99.96%),

CD105(99.99%) and CD166(100%). Flow cytometric analysis demonstrated that both

SHEDs and UCMSCs were positive for CD29, CD44, CD73, CD90, CD105 and

CD166, but negative for CD34 and CD45.

Figure 3. The differentiation capacities of SHEDs and UCMSCs. (A) The staining

pictures of tri-lineage differentiation of SHEDs and UCMSCs after induced by

adipogenesis, chondrogenesis and osteogenesis differentiation medium for 21 days; (B)

The genes expression level of CEBPA, ACAN and RUNX2 which were used to

represent adipogenesis, chondrogenesis and osteogenesis in SHEDs and UCMSCs after

induced by differentiation medium for 14 days. The results revealed that the expression

level of CEBPA of UCMSCs was fivefold higher than that of SHEDs, while ACAN

expression of SHEDs was threefold higher than that of UCMSCs. The experiment was

prepared parallel replicates and values represent means ± SD of four SHED samples

and four UCMSC samples. *P < 0.05; **P < 0.01.

Page 25 of 35



Draft

Figure 4. The migration abilities and chemotaxis effects of SHEDs and UCMSCs. (A)

Migration abilities and chemotaxis effects of SHEDs and UCMSCs. The number of

SHEDs transmigrated across the membrane was more than that of UCMSCs. The

experiment was repeated twice and values represent means ± SD of four SHED samples

and four UCMSC samples. (B) The chemotaxis effects of SHEDs and UCMSCs

supernatant. The number of NIH/3T3 cells transmigrating into the UCMSCs

supernatant were more than that of SHEDs supernatant and control medium. The

experiment was repeated twice and values represent means ± SD of four SHED samples

and four UCMSC samples. *P < 0.05; **P < 0.01.

Figure 5. Paracrine levels and inhibitory effects of SHEDs and UCMSCs on hPBMCs.

(A) The secretion levels of ANG-1, HGF, PGE2 and TGF-β1 in SHEDs and UCMSCs

supernatant; (B) The proliferation capacities of hPBMCs were inhibited by SHEDs and

UCMSCs; (C) The IFN-γ secretion levels of hPBMCs were inhibited by SHEDs and

UCMSCs; (D) The TNF-α secretion levels of hPBMCs were inhibited by SHEDs and

UCMSCs; The results revealed that both SHEDs and UCMSCs could inhibited the

proliferation and secretion of hPBMCs, but there’s no significant difference of them

between SHED and UCMSC co-culture groups. The paracrine levels detection

experiment was repeated twice and values represent means ± SD of eighteen SHED

samples and ten UCMSC samples. The inhibitory effects experiment was repeated

twice and values represent means ± SD of four SHED samples and four UCMSC

samples. *P < 0.05; **P < 0.01.

Figure 6. The neurite growth of SH-SY5Y cells promoted by supernatant from SHEDs

and UCMSC for 48 and 72 hours. (A) The cellular morphology of SH-SY5Y cells

cultured in DMEM/F12 containing 10% FBS (as control medium), SHEDs supernatant

and UCMSCs supernatant for 48 hours; (B) The cellular morphology of SH-SY5Y cells

cultured in DMEM/F12 containing 10% FBS (as control medium), SHEDs supernatant

Page 26 of 35



Draft

and UCMSCs supernatant for 72 hours. The results showed that the supernatant of

SHEDs was significantly more effective on neurite outgrowth than UCMSC

supernatant and control medium, and SH-SY5Y cells in SHED supernatant raised and

presented higher refractivity. The experiment was repeated twice and values represent

means ± SD of four SHED samples and four UCMSC samples. *P < 0.05; **P < 0.01.

Figure 7. The ALDH activity of SHEDs and UCMSCs. The percentage of ALDH+

SHEDs is 11.38±2.26%, while the percentage of ALDH+ UCMSCs is 11.36±2.82%

(p=0.993). The experiment was repeated twice and values represent means ± SD of nine

SHED samples and four UCMSC samples.

Page 27 of 35



Draft

TablesTable 1. Oligonucleotide Primer Sequences for RT-PCRs

Table 2. The statistic of the flow cytometric analysis of SHEDs and UCMSCs

The experiment was repeated twice and results are the average of four SHED samples and four UCMSC samples. Data are shown as the mean ± SD.

Target gene

Primer sequence(forward, reverse)

Productlength (bp)

Annealingtemperature

(°C)NCBI No.

CEBPATATAGGCTGGGCTTCCCCTTAGCTTTCTGGTGTGACTCGG

94 59 NM_001285829.1

ACANGCACAGCCACCACCTACAAACGGTGAGTGGGTGCATACACAA

247 59 NM_001135.3

RUNX2GTAAGAAGAGCCAGGCAGGTGGCGGGGTGTAAGTAAAGGT

139 59 NM_001024630.3

SHEDs UCMSCsPositive (%) SD Positive (%) SD

CD29 99.99 0.01 99.99 0.01CD34 0.47 0.09 0.54 0.17CD44 99.99 0.01 99.94 0.06CD45 1.33 0.21 0.75 0.27CD73 98.92 0.98 99.95 0.09CD90 99.77 0.40 99.86 0.22CD105 99.87 0.23 99.93 0.08

Page 28 of 35



Draft

Figures

Figure 1

Page 29 of 35



Draft

Figure 2

Page 30 of 35



Draft

Figure 3

Page 31 of 35



Draft

Figure 4

Page 32 of 35



Draft

Figure 5

Page 33 of 35



DraftFigure 6

Page 34 of 35



DraftFigure 7

Page 35 of 35



draft...draft of mscs originating from mesoderm, including ucmscs, bone marrow mesenchymal stem...

Documents