draft - tspace repository: homedraft development of dna markers for slmlo1.1, a new mutant allele of...

Draft

Development of DNA markers for Slmlo1.1, a new mutant allele of the powdery mildew resistance gene SlMlo1 in

tomato (Solanum lycopersicum)

Journal: Genome

Manuscript ID gen-2018-0114.R1

Manuscript Type: Article

Date Submitted by the Author: 10-Jul-2018

Complete List of Authors: Kim, Daeun; Pusan National University, Department of Horticultural BioscienceJin, Bingkui; Pusan National University, Department of Horticultural BioscienceJe, Byoung Il; Pusan National University, Department of Horticultural BioscienceChoi, Youngmi; Pusan National University, Department of Horticultural BioscienceKim, Byung Sup; Gangneung-Wonju National University, Department of Plant ScienceJung, Hee-Jeong; Sunchun National University, Department of Plant ScienceNou, Ill-Sup; Sunchun National University, Department of HorticulturePark, Younghoon; Pusan National University, Department of Horticultural Bioscience; Pusan National University, Life and Industry Convergence Research Institute

Keyword: disease resistance, molecular marker, Oidium neolycopersici, powdery mildew, Solanum lycopersicum

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/genome-pubs

Genome

Draft

1

1 Development of DNA markers for Slmlo1.1, a new mutant allele of the powdery

2 mildew resistance gene SlMlo1 in tomato (Solanum lycopersicum)

3

4 Daeun Kim a, Bingkui Jina, Byoung Il Jea, Youngmi Choi a, Byung Sup Kimb, Hee-Jeong

5 Jungc, Ill-Sup Nouc, Younghoon Parka,d*

6

7 a Department of Horticultural Bioscience, Pusan National University, Miryang 627-706,

8 Republic of Korea

9 b Department of Plant Science, Gangneung-Wonju National University, Gangneung 210-

10 720, Republic of Korea

11 c Department of Horticulture, Suncheon National University, Suncheon 540-950, Republic

12 of Korea

13 dLife and Industry Convergence Research Institute, Pusan National University, Miryang

14 627-706, Republic of Korea

15

16 *Corresponding author

17 E-mail: [email protected]

18

Page 1 of 38


Genome

mailto:[email protected]

Draft

2

19 Abstract

20 Reductions in growth and quality due to powdery mildew (PM) disease cause significant

21 economic losses in tomato production. Oidium neolycopersici was identified as the fungal species

22 responsible for tomato PM disease in South Korea in the present study, based on morphological and

23 internal transcribed spacer DNA sequence analyses of PM samples collected from two remote

24 regions (Muju and Miryang). The genes involved in resistance to this pathogen in the tomato

25 accession ‘KNU-12’ (Solanum lycopersicum var. cerasiforme) were evaluated, and the inheritance

26 of PM resistance in ‘KNU-12’ was found to be conferred via simple Mendelian inheritance of a

27 mutant allele of the PM susceptibility locus Ol-2 (SlMlo1). Full-length cDNA analysis of this newly

28 identified mutant allele (Slmlo1.1) showed that a 1-bp deletion in its coding region led to a

29 frameshift mutation possibly resulting in SlMlo1 loss-of-function. An alternatively-spliced

30 transcript of Slmlo1.1 was observed in the cDNA sequences of ‘KNU-12’, but its direct influence

31 on PM resistance is unclear. A derived cleaved amplified polymorphic sequence (dCAPS) and a

32 high-resolution melting (HRM) marker were developed based on the 1-bp deletion in Slmlo1.1, and

33 could be used for efficient marker-assisted selection (MAS) using ‘KNU-12’ as the source for

34 durable and broad-spectrum resistance to PM.

35

36 Key words: disease resistance, molecular marker, Oidium neolycopersici, powdery mildew,

37 Solanum lycopersicum.

38

Page 2 of 38


Genome

Draft

3

39 Introduction

40 Powdery mildew (PM) disease is caused by obligate biotrophic ascomycete fungi belonging to the

41 order Erysiphales. The major pathogens causing PM in tomato (Solanum lycopersicum) are Oidium

42 spp. (O. neolycopersici and O. lycopersici) and Leveillula taurica (Kiss et al. 2001; Kashimoto et al.

43 2003; Lebeda et al. 2015). Oidium neolycopersici forms a single spore on the conidiophore during its

44 sporophyte development stage, therefore being morphologically distinct from O. lycopersici, which

45 produces a chain of spores (Jones et al. 2001; Kiss et al. 2004). In terms of disease symptoms, O.

46 neolycopersici and O. lycopersici are similar. Both produce signs resembling white powder on the

47 upper surface of leaves and petioles and on stems, but not on leaf underside. Leveillula taurica

48 produces the same signs in leaves, on both their upper and under sides, but not on stems (Jacob et al.

49 2008). The first incidence of PM caused by L. taurica in South Korea was reported from Jinju in 1995

50 (Kang et al. 1995), but few studies of O. neolycopersici and O. lycopersici in South Korea are publicly

51 available.

52 Powdery mildew disease occurs on tomato cultivars at all growth stages from seedlings to mature

53 plants, and in greenhouse and field cultures. Severe infection results in etiolation, early senescence,

54 and reduction of fruit size and quality, leading to notable fruit losses, reduced yields, and economic

55 damage (Jones et al. 2001; Jacob et al. 2008). By combining high temperature and low relative

56 humidity (RH), PM disease severity can be reduced in tomato cultivated in greenhouse environments

57 (Whipps and Budge 2000; Jacob et al. 2008). Foliar application of synthetic fungicides or potassium

58 silicate are additional methods to manage PM disease (Yanar et al. 2011). Although cultivating PM-

59 resistant (PMR) tomato cultivars is the most efficient way to prevent PM disease, there are not many

60 commercial PMR cultivars available to farmers worldwide.

61 Tomato accessions resistant to PM caused by Oidium spp. have been reported, and the genetic

62 inheritance of their resistances has also been studied (Seifi et al. 2014). In the wild tomato species S.

Page 3 of 38


Genome

Draft

4

63 habrochaites, two dominant and possibly allelic PM-resistance genes, Ol-1 and Ol-3, were detected

64 in the long arm of chromosome (Chr.) 6, and gene Ol-5 was closely linked to these loci (Bai et al.

65 2005). In S. peruvianum, another pair of possibly allelic and dominant genes, Ol-4 and Ol-6, were

66 found on the short arm of Chr. 6 (Bai et al. 2005). All the dominant genes referred above confer PM

67 resistance through a hypersensitive reaction (HR) mechanism. One of the quantitative trait loci (QTLs)

68 associated with PM resistance, Ol-qtl1, was detected in S. neorickii (Accession: G1.1601), in the

69 chromosomal region proximal to Ol-1, Ol-3, and Ol-5 (Bai et al. 2003). Additionally, the QTLs Ol-

70 qtl2 and Ol-qtl3 were reported from Chr. 12, on the vicinity of Lv, which is a locus conferring

71 resistance to PM caused by L. taurica in this accession (Chunwongse et al. 1994; Faino et al. 2012).

72 A single recessive PM resistance gene for ol-2 (Slmlo1) was found on Chr. 4 of S. lycopersicum var.

73 cerasiforme (Accession: LA1230) (Ciccarese et al. 1998), and, to date, it is the only PM resistance

74 gene cloned in tomato.

75 As noted above, most sources of PM resistance in tomato have been identified among wild

76 Solanum species. Due to linkage drag of unfavorable traits from wild strains, introgression of these

77 genes into cultivated tomatoes can be a time-consuming process. Breeding efficiency can be greatly

78 improved by using molecular markers, for example through marker-assisted selection (MAS), which

79 are tightly linked with or developed from the gene controlling PM resistance. Although several

80 genetic mapping studies of PM resistance genes using polymerase chain reaction (PCR) revealed a

81 series of tightly linked markers, studies demonstrating their applicability to MAS have not been

82 reported so far. Furthermore, an efficient method for the differential diagnosis of different PM

83 pathogen races (isolates) in tomato is lacking (Kashimoto et al. 2003; Bai et al. 2005), and therefore

84 the race-specificity for each PM resistance gene is not yet fully understood. This may hamper the use

85 of published markers in MAS programs targeting cultivation areas for which the composition of PM

86 pathogens in the population is not yet characterized. Thus, the current study aimed to discern which

Page 4 of 38


Genome

Draft

5

87 pathogen species cause tomato PM disease in South Korea, and to characterize the PM resistance

88 genes in the tomato accession ‘KNU-12’. The results indicated PM resistance in ‘KNU-12’ might be

89 conferred by a novel mutant allele of ol-2 identified here. Based on this mutant allele of ol-2, gene-

90 based molecular markers that might be useful for MAS were developed.

91

92 Materials and methods

93 Plant materials

94 The tomato accession ‘KNU-12’ was selected for this study due to its natural resistance to PM

95 demonstrated in a greenhouse at Pusan National University (PNU, Miryang, South Korea) during

96 the summer of 2012. This inbred line (female) was crossed with ‘PMS’ (male), an advanced

97 breeding line susceptible to PM, to produce generation F1. A single F1 plant was then self-pollinated

98 to produce generation F2, and F2 individuals were subsequently self-pollinated to produce 111 F3

99 families (F2:3). All artificial pollination and progeny seed production was conducted in a greenhouse

100 at PNU, from 2013 to 2014. Commercial F1 hybrid cultivars, either purchased or provided from

101 private seed companies in South Korea, were used for validating SCAR and derived cleaved

102 amplified polymorphic sequence (dCAPS) analyses.

103

104 PM pathogen identification

105 Powdery mildew pathogens that occurred naturally on tomato plants in a greenhouse located in

106 Muju, Jeonnnam Province (July 2014) and Miryang, Gyeongnam Province (July 2015), South

107 Korea were collected and subject to species identification. White mycelial mats (hyphae,

108 conidiophores, and conidia) were brushed off from the adaxial sides of fresh leaves of PM-infected

109 ‘PMS’ plants, and then used for either microscopic observation or DNA analysis. A small quantity

Page 5 of 38


Genome

Draft

6

110 of brushed samples was mounted on a microscope slide with a drop of double distilled water

111 (ddH2O) and examined using light microscopy.

112 Genomic DNA was extracted using the GenExTM Plant KIT (GenExTM Plant, GeneAll, Seoul,

113 South Korea), and the internal transcribed spacer (ITS) region of nuclear ribosomal DNA (rDNA)

114 was amplified by PCR in 10-μL total volume reactions containing 1 μL genomic DNA (20 ng), 1

115 μL 10× buffer SolgTM (SolGent, Daejeon, Korea), 0.2 μL dNTPs (10 mM, SolGent), 0.5 μL of

116 each forward (PMITS1) and reverse (PMITS2) primer (10 pmol) (Table 1) (Kiss et al. 2001), and 0.1

117 μL eTaqSolgTM Taq polymerase (5 U μL-1, SolGent). Amplifications were conducted on the T100TM

118 thermocycler (BIO-RAD, Hercules, CA, USA) as follows: denaturation for 10 min at 94 °C

119 followed by 40 cycles of denaturation for 1 min at 94 °C, annealing for 1 min at 53 °C, and

120 extension for 1 min at 72 °C. Amplicons were electrophoresed on a 2% agarose gel and purified

121 from the gel using the ExpinTM Gel SV gel extraction kit (GeneAll, Seoul, Korea). Purified PCR

122 products were cloned using the pGEM T-Easy Vector System Ι (Promega, Madison, WI, USA).

123 Sequencing of recombinant plasmids was conducted using the dye terminator method of Genotech

124 (Daejeon, Korea). For molecular identification of the fungi and respective taxonomic assignment,

125 the resulting sequences (MJ_PM-1 and MR_PM-1) were compared with the ITS sequences of

126 various PM pathogen species through the basic local alignment search tool using a nucleotide query

127 (BLASTn) in the UNITE database (http://unite.ut.ee) (Abarenkov et al. 2010).

128

129 PM disease evaluation

130 Two independent bioassays for PM disease were conducted in 2014 and 2015. In 2014, 10 plants

131 per F3 family were evaluated with two replicates per family, while in 2015 five plants per F3 family

132 were evaluated with three replicates per family. The PM spore suspensions used in the bioassays

133 were prepared by diluting the PM specimens obtained as described in the ‘PM pathogen

Page 6 of 38


Genome

http://unite.ut.ee

Draft

7

134 identification’ section to 9.75×104 conidia mL-1 with ddH2O. These suspensions were spread three

135 times on whole seedlings at the 4–5-true-leaf stage until run-off, at three-day intervals. After

136 inoculation, seedlings were grown for two weeks in a greenhouse at PNU under 26–28 °C/10–15 °C

137 day/night temperature conditions, and the PM disease symptoms developed were scored. The level

138 of PM resistance was evaluated based on the Disease Symptom Index (DSI) as follows: DSI = 0, no

139 symptoms; DSI = 1, symptoms covering less than 10% of the leaf area; DSI = 2, symptoms on 10–

140 30% of the leaf area; and DSI = 3, symptoms covering more than 30% of the leaf area.

141

142 Evaluation of molecular markers linked to PM resistance

143 Cultivars ‘KNU-12’ and ‘PMS’ were genotyped using previously published molecular markers

144 that were reported to be linked to PM resistance [dct136 for Ol-qtl1 (Bai et al. 2004); Y258 and

145 tg111 for Ol-qtl3 (Bai et al. 2004); P2147, tg25-1, tg25-2, and H9A11 for Ol-1 and Ol-5 (Bai et al.

146 2005); Tom316, Tom332, U3-2, and M/SlMlo1 for ol-2 (Bail et al. 2008; Pavan et al. 2008);

147 GP79L and 32.5Cla for Ol-4 and Ol-6 (Bai et al. 2005)]. Details of these markers and the primers

148 used to amplify them are presented in Table 2. Genomic DNA of ‘KNU-12’ and ‘PMS’ was

149 extracted from two or three true leaves using sodium dodecyl sulfate extraction buffer, and the PCR

150 was conducted using the mixture described in the ‘PM pathogen identification’ section.

151 Amplifications were conducted as follows: denaturation for 2 min at 94 °C, 35 cycles of

152 denaturation for 15 s at 94 °C, annealing for 30 s at 58 °C, and extension for 1 min at 72 °C.

153 Amplicons were electrophoresed on a 1.0% agarose gel for 1 h at 130 V and visualized under a gel

154 image analysis system (CoreBio-MAXTM, Davinch-K, Seoul, Korea) after ethidium bromide

155 (EtBr) dying.

156

157 Evaluation of ol-2 gene (SlMlo1) allele variation and development of gene-based SCAR

Page 7 of 38


Genome

Draft

8

158 The genomic DNA sequence of ol-2 from ‘KNU-12’ and ‘PMS’ was determined using three

159 primer pairs, 1-1, 1-2, and 1-3, which were designed based on the SlMlo1 gene sequence (SGN

160 accession number Solyc04g049090) using primer3 software (http://frodo.w i.mit.edu/cgi-

161 bin/primer3/primer3.cgi/). To find a gene-based SCAR marker for ol-2, the primer pair

162 SCAR_SlMlo1.1 (Table 1) was designed targeting an insertion/deletion (indel) positioned in an

163 intron region of the gene. Primer amplifications and cloning and sequencing of the PCR products

164 were conducted as described in the ‘PM pathogen identification’ section. SCAR_SlMlo1.1 marker

165 genotyping of commercial F1 cultivars was evaluated by polyacrylamide gel using a Fragment

166 Analyzer

167

168 Full-length cDNA cloning of ol-2 and development of gene-based dCAPS

169 True leaves (6-7th) of ‘KNU-12’ and ‘PMS’ seedlings were collected and immediately ground in

170 liquid nitrogen. Total RNA was extracted using the RNeasy® Plant Mini Kit (QIAGEN,

171 Germantown, MD, USA), and its quality and quantity were checked on the Agilent 2100

172 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA). Purified RNA was diluted to 10 ng

173 μL-1 and full-length cDNA of the ol-2 gene was synthesized using a SMARTer® RACE 5’/3’ kit

174 (Takara, Kusatsu, Japan) following the manufacturer’s instructions. Gene-specific primers for rapid

175 amplification of cDNA ends (RACE) PCR (5′ reverse primer: 5-

176 GATTACGCCAAGCTTTCACCCCCATGGTTAGCCTTATGGCT-3, 3′ forward primer: 5-

177 GATTACGCCAAGCTTGCATTTCTGGAGCAAGTCCCCCGTGTT-3) were designed based on

178 the SlMlo1 coding sequences (CDS). Cloning and sequencing of the RACE PCR products were

179 carried out using the methods described by Kim et al. (2017). Sequence alignment and analysis of

180 full-length cDNA were carried out using ClustalX 1.83.

Page 8 of 38


Genome

Draft

9

181 Primers for ol-2 gene-based dCAPS (dCAPS_SlMlo1.1) (Table 1) were designed using dCAPS

182 Finder (http://helix.wustl.edu/dcaps/dcaps.html), and the PCR for dCAPS genotyping was

183 conducted as described in the ‘Evaluation of molecular markers linked to PM resistance’ section.

184 Restriction enzyme digestion of PCR products was performed by adding 0.5 μL Time-SaverTM FokΙ

185 (1,000 U mL-1, NEB®, Ipswich, MA, USA), 1.5 μL 10× CutsmartTM buffer (NEB®), and 3 μL of

186 ddH2O to 10 μL of the PCR products and letting the mixture sit for 1 h at 37 °C. Digested PCR

187 products were electrophoresed on a 2.5% agarose gel for 1 h at 130 V, and visualized under a gel

188 image analysis system (CoreBio-MAXTM) after being dyed with EtBr.

189

190 Conversion of dCAPS to a high-resolution melting marker

191 To develop a high-resolution melting (HRM) marker, a 3′-blocked and unlabeled oligonucleotide

192 probe (Luna Probe; BioFire Defense, Salt Lake, UT, USA) was designed based on the targeted indel

193 mutation (Table 1). Using the saturating dye EvaGreen® Plus (Biotium, Hayward, CA, USA), a

194 PCR was performed to generate melting curves characteristic of the probed genotype using the

195 LightScanner® Instrument System (Roche, Basel, Switzerland). This PCR involved pre-

196 denaturation at 95 °C for 5 min followed by cycles of denaturation at 95 °C for 20 s, annealing at

197 60 °C for 20 s, and extension at 72 °C for 30 s, and a final extension for 40 s at 72 °C. Primer and

198 probe sets for indel detection are described in Table 1.

199

200 Detection of alternative transcripts

201 Ten ‘KNU-12’ seedlings at the 4–5-true-leaf stage were inoculated with the PM suspension as

202 described in the ‘PM disease evaluation’ section. Control plants were treated with ddH2O for mock

203 inoculation. Inoculated leaves were collected from three seedlings at 0, 12, 24, and 48 h post-

204 inoculation (hpi), and immediately frozen in liquid nitrogen. Total RNA extraction and cDNA

Page 9 of 38


Genome

Draft

10

205 synthesis were performed as described in the ‘Full-length cDNA cloning of ol-2 and development

206 of gene-based dCAPS’ section.

207 Complementary DNAs were PCR-amplified using the primer set ‘ASC-1’ (Table 1) that was

208 designed to flank the 9th exon of ol-2. Amplifications were carried out in a 10-μL mixture

209 containing 1 μL cDNA (20 ng), 1 μL 10× SolgTM buffer (SolGent), 0.2 μL dNTPs (10 mM,

210 SolGent), 0.5 μL of each forward and reverse primer (10 pmol), and 0.1 μL eTaqSolgTM Taq

211 polymerase (5U μL-1, ,SolGent), as follows: denaturation for 10 min at 94 °C followed by 35 cycles

212 of denaturation for 1 min at 94 °C, annealing for 1 min at 61 °C, and extension for 1 min at 72 °C.

213 Amplicons were electrophoresed on a 2.5% agarose gel for 1 h at 130 V and visualized under a gel

214 image analysis system (CoreBio-MAXTM) after being dyed with EtBr.

215

216 Results

217 PM pathogen identification

218 The morphological characteristics and the rDNA ITS sequences of PM pathogen samples

219 collected in Muju (MJ_PM1) and Miryang (MR_PM1), South Korea were analyzed. Microscopic

220 observation clearly showed that the type of conidiogenesis displayed by MJ_PM1 and MR_PM1

221 specimens (Fig. 1) corresponded to that of O. neolycopersici; formation of non-catenate, single

222 conidia with ellipsoid-ovoid shape and mean length greater than 30 μm (Kiss et al. 2001).

223 A DNA fragment of 579 bp was sequenced from the ITS of MJ_PM1 and MR_PM1

224 (Supplementary File 1). No ITS sequence variation was observed between these samples.

225 Comparison of these ITS sequences with that of other Erysiphales species showed that MJ_PM1

226 and MR_PM1 were most closely related to O. neolycopersici. The BLASTn search conducted on

227 the UNITE database retrieved 29 sequences that were 100% identical (E-value = 0.0) to the query

Page 10 of 38


Genome

Draft

11

228 sequences and annotated as O. neolycopersici. Among them, 22 sequences originated from fungi

229 isolated from tomato hosts in Japan, China, South Korea, and many unspecified countries (Kiss et

230 al. 2001) (Supplementary File 1). Thus, microscopical examination and ITS sequence analysis

231 indicated that O. neolycopersici might be the predominant Oidium anamorph causing tomato PM in

232 South Korea.

233

234 Bioassay of PM resistance

235 The inheritance of PM resistance in ‘KNU-12’ was investigated using generation F1 and 111 F3

236 family populations. In the first evaluation, generation F1 and 87 F3 families were scored as

237 susceptible (S, DSI = 1–3), while 24 F3 families were scored as resistant (R, DSI = 0–0.9). In the

238 second evaluation, generation F1 and 89 F3 families were scored as S (DSI = 1–3), while 22 F3

239 families were scored as R (DSI = 0–0.9). The DSIs of F3 families were consistent between the two

240 evaluations except for two F3 families (F3-121 and F3-144, Table 2). The DSI values of the two

241 replicates per F3 family were averaged, and the final disease reaction was scored based on the

242 average DSI per-family. The ratio of R (21 F3 families) and S (90 F3 families) in the final evaluation

243 was 1:3 (X2 = 0.68 and P = 0.41), indicating that PM resistance in ‘KNU-12’ is conferred via a

244 simple Mendelian model of inheritance of a single recessive locus (Table 3).

245

246 Development of DNA markers for PM resistance

247 Cultivars ‘KNU-12’ and ‘PMS’ were genotyped for DNA makers that were previously reported

248 to be linked to PM resistance (Table 2, Fig. 2). However, all markers except GP79L were

249 monomorphic between ‘KNU-12’ and ‘PMS’. This marker, which has been reported as linked to the

250 dominant loci Ol-4 and Ol-6 (Fig. 2) (Bai et al. 2005), was genotyped for the 111 F3 plants

251 examined here, but no significant linkage to PM resistance was observed (data not shown),

Page 11 of 38


Genome

Draft

12

252 indicating that the resistance in ‘KNU-12’ is not conferred by those loci. Phenotype evaluation of

253 generation F1, which showed the single recessive inheritance of PM resistance in ‘KNU12’, also

254 supported this assumption. Although considering the inheritance pattern ol-2 could be associated

255 with PM resistance in ‘KNU-12’, none of the ol-2 linked markers, including the gene-based marker

256 M/SlMlo1 showed polymorphisms between ‘KNU-12’ and ‘PMS’ cultivars. Thus, PM resistance in

257 ‘KNU-12’ seems to be mediated by an allele of ol-2 that is different from the original mutant allele

258 of Ol-2 in ‘LA1230’ (S. lycopersicum var. cerasiforme).

259 To develop a gene-based marker for Ol-2 that is polymorphic between ‘KNU-12’ and ‘PMS’,

260 three primer pairs (1-1, 1-2, and 1-3) encompassing the genomic DNA sequence of the Ol-2 gene

261 (SGN accession number: Solyc04g049090; 5344 bp) (Fig. 3) were designed, and each region was

262 amplified by PCR. A polymorphism in amplicon size was identified by the primer set ‘1-3’ that was

263 designed to amplify the region between the 13th and 15th exon. Cloning this amplicon using primer

264 ‘1-3’ revealed a 14-bp indel in the intron between the 14th and 15th exons, and a 1-bp indel in the

265 15th exon (Fig. 4). The 14-bp indel occurred within a simple sequence repeat (SSR) region that

266 comprised 21 TA dinucleotide motifs [(TA)21] in ‘PMS’ and 14 TA dinucleotide motifs [(TA)14] in

267 ‘KNU-12’. Based on these indels, SCAR (SCAR_SlMlo1.1) and dCAPS (dCAPS_SlMlo1.1)

268 markers were developed to genotype the ol-2 allele in ‘KNU-12’, ‘PMS’, and F2 hybrid plants. The

269 SCAR_SlMlo1.1 marker used a forward primer and a reverse primer flanking the 14-bp indel and

270 amplified 194-bp DNA fragments from ‘KNU-12’ and 208-bp DNA fragments from ‘PMS’. The

271 dCAPS_SlMlo1.1 marker used a forward primer and a reverse primer flanking the 1-bp indel and

272 produced 200-bp DNA fragments from ‘KNU-12’ and 170-bp and 30-bp DNA fragments from

273 ‘PMS’ after restriction enzyme digestion of the PCR amplicon using BclΙ (Fig. 5).

274

275 Genetic association between the markers and PM resistance

Page 12 of 38


Genome

Draft

13

276 The SCAR_SlMlo1.1 marker was used to genotype 111 ‘KNU-12’ × ‘PMS’ F2 plants (Fig. 5).

277 The F2 plants that were scored as having a PM-resistant phenotype among the F3 families (F2:3)

278 showed the marker genotype for ‘KNU-12’, while plants that were scored as having the susceptible

279 phenotype among their F3 families showed the marker genotype for either ‘PMS’ or heterozygosity

280 (57 plants) (Table 3). Furthermore, all F2 plants for which resistant and susceptible individuals were

281 segregated in their F3 families (Table 3) showed the marker genotype for heterozygosity. To further

282 verify this result, we selected 10 seedlings from each F3 family of heterozygous F2, extracted their

283 genomic DNA, and pooled DNA samples for PCR. All PCR analyses of pooled DNA samples from

284 each F3 plant revealed the PCR bands specific to ‘KNU-12’ and ‘PMS’. All F2 plants were also

285 genotyped using dCAPS_SlMlo1.1 markers, and the results matched those for SCAR_SlMlo1.1

286 (Fig. 5). Therefore, we confirmed that PM resistance in ‘KNU-12’ is conferred by a single recessive

287 gene that is cosegregated with SlMlo1.

288

289 Applicability of the gene-based markers in MAS and marker conversion to HRM

290 The applicability of the SCAR_SlMlo1.1 and dCAPS_SlMlo1.1 markers in MAS was validated

291 by testing 96 commercial F1 hybrid cultivars. None of these cultivars were labeled as PM-resistant

292 in their commercial bulletins, and therefore were considered susceptible to PM. Tests with

293 dCAPS_SlMlo1.1 markers, revealed that all F1 cultivars had the marker genotype for ‘PMS’, except

294 for two that showed the marker genotype for ‘KNU-12’. These results indicated that the 1-bp indel

295 in the 15th exon of the SlMlo1.1 is unique to PM-resistant ‘KNU-12’ plants. Therefore, the

296 dCAPS_SlMlo1.1 marker can be effectively used as a universal gene-based marker for MAS of the

297 PM resistance allele of ‘KNU-12’.

298 Because dCAPS marker genotyping based on agarose gel electrophoresis is a time-consuming

299 and costly procedure, a marker suitable for automated high-throughput genotyping platforms, such

Page 13 of 38


Genome

Draft

14

300 as real time PCR-based HRM is required. To convert the dCAPS marker into a HRM markers, we

301 used 3′-blocked and unlabeled oligonucleotide probes for melting curve analysis of the 1-bp indel.

302 This HRM marker (HRM_SlMlo1.1) was evaluated using ‘KNU-12’, ‘PMS’, and F1 and F2 plants

303 derived from ‘KNU-12’ × ‘PMS’. Three different melting curves were distinguishable with two

304 homozygous types (A/A for ‘PMS’ and one F2 plant, -/- for ‘KNU-12’) and a heterozygous type

305 (A/- for the F1 plant) (Fig. 6).

306

307 Full-length cDNA sequencing of SlMlo1.1

308 The full-length cDNA sequence of the SlMlo1 gene was analyzed by RACE PCR to identify any

309 additional sequence variations in its coding region in ‘KNU-12’ and ‘PMS’ plants (Supplementary

310 File. 2). For each line, three cDNA molecules (three colonies) were sequenced, and the 1-bp indel in

311 the 5th exon was confirmed for all sequences. No additional sequence variation was detected

312 between ‘KNU-12’ and ‘PMS’. However, a frameshift mutation caused by the 1-bp deletion

313 possibly resulted in the loss of function of the Ol-2 gene product (designated as SlMlo1.1 in this

314 study) in ‘KNU-12’ plants (Bai et al. 2008).

315 Interestingly, a deletion of the entire 9th exon was also detected in one of the three cDNA

316 molecules cloned from ‘KNU-12’. Therefore, we attempted to verify whether this cDNA molecule

317 originated from a SlMlo homolog that is present in a different genomic location (Zheng et al. 2016),

318 or if it originated from alternative splicing during the RNA processing of Slmlo1.1. The PCR

319 amplification of genomic DNA of ‘KNU-12’ using the primer set for the two introns flanking the 9th

320 exon resulted in a wild-type PCR band of 842 bp without the deletion, indicating that the deletion of

321 the 9th exon might be due to alternative splicing. We further investigated the level of alternative

322 transcripts by PCR amplification of the cDNA samples synthesized as described in the ‘Detection of

323 alternative transcripts’ section. The cDNA samples were PCR amplified using the primer set ‘ASC-

Page 14 of 38


Genome

Draft

15

324 1’ designed for binding to the 8th exon (forward primer) and 10th exon (reverse primer) flanking the

325 9th exon. In addition to the strong PCR band with the wild-type allele size (172 bp), a very weak

326 PCR band showing around 122 bp indicative of the deletion of the 9th exon was observed in all

327 amplified cDNA samples, including non-inoculated leaves (Fig. 7). Thus, alternative splicing

328 possibly occurred in both ‘KNU12’ and ‘PMS’ samples, but it does not seem to be event-specific or

329 related to the inoculation of the PM pathogen.

330

331 Discussion

332 Gene SlMlo1 is a member of the SlMlo family, and it is homologous to the Mlo (Mildew locus

333 O) gene (Zheng et al. 2016) of barley that has been shown to be involved in broad-spectrum PM

334 resistance (Bai et al. 2008). Although PM resistance involving ol-2 is not associated with the race-

335 specific HR observed in dominant resistance loci, it is known to have a non-race-specific

336 mechanism involving the formation of papillae (plant cell wall appositions) that arrest fungal

337 penetration (Bai et al. 2005).

338 A previous genome-wide study of the tomato SlMlo gene family characterized 15 SlMlo

339 homologs (Zheng et al. 2016). Using transgenic plants, Zheng et al. (2016) also demonstrated that

340 simultaneous silencing of SlMlo1 and two of its closely related homologs, SlMlo5 and SlMlo8,

341 conferred a higher level of resistance than the ol-2 mutation. However, the possibility that PM

342 resistance in ‘KNU-12’ arose from a naturally occurring mutant allele of SlMlo5 or SlMlo8 has been

343 ruled out, as the Slmlo1.1 sequence in ‘KNU-12’ was a perfect match, except for a single deletion.

344 Furthermore, the previously reported ol-2 gene-based marker [M/SlMol, a sequence characterized

345 amplified region (SCAR) marker targeting the 19-bp deletion in the 7th exon of SlMlo1] (Bai et al.

346 2008) was not polymorphic between ‘KNU-12’ and ‘PMS’, suggesting that PM resistance in ‘KNU-

Page 15 of 38


Genome

Draft

16

347 12’ is conferred by another resistance allele of Slmlo1 (ol-2). This allele was newly identified in the

348 present study based on gene sequence analysis and an association study using an F2:3 population.

349 The ol-2 allele was originally identified from ‘LA1230’, an accession of S. lycopersicum var.

350 cerasiforme (a cherry tomato-type cultivar) (Jones et al. 2001; Bai et al. 2005). Horticultural traits

351 of ‘KNU12’ are similar to that of S. lycopersicum var. cerasiforme (data not shown) and a

352 phylogenetic study based on the SolCAP single nucleotide polymorphism array showed that ‘KNU-

353 12’ was clustered in the group of S. lycopersicum var. cerasiforme accessions (Sim et al. 2015).

354 This implies that ‘KNU12’ belongs to the subspecies S. lycopersicum var. cerasiforme. The ol-2

355 gene (Slmlo1) in S. lycopersicum var. cerasiforme, which is an ortholog of Mlo in barley, has

356 advantages with respect to tomato breeding. Although other PM resistance genes are found in wild

357 species of tomato, the ol-2 gene originated from cherry tomato-type accessions that represent an

358 admixture of wild (S. pimpinellifolium) and cultivated species (S. lycopersicum). By using this

359 subspecies as a source of PM resistance genes, breeders can easily introduce the gene into cultivated

360 cherry or round tomato cultivars while avoiding the adverse effects of linkage drag that may result

361 from using wild sources of resistance genes. In addition, the loss-of-function mutation in Ol-2 in

362 tomato (SlMlo) has been reported to result in a broad-spectrum, non-race-specific resistance to PM,

363 like that in barley (Mlo) and Arabidopsis (AtMlo) homologs (Pavan et al. 2010). It has also been

364 suggested that wild-type Mlo homologs are plant factors required and targeted by both adapted and

365 non-adapted PM to induce PM susceptibility (Appiano et al. 2015). Tomato Slmlo mutants

366 overexpressing barley wild-type Mlo (HvMlo) were susceptible to O. neolycopersici and to a non-

367 adapted PM species, Blumeria graminis f. sp. hordei. Similarly, tomato Slmlo1 mutants proved to

368 be less susceptible to L. taurica compared to a wild-type control cultivar, but they restored

369 susceptibility when transformed with pepper wild-type CaMlo2 (Zheng et al. 2013).

Page 16 of 38


Genome

Draft

17

370 During the validation of SlMlo1.1 gene-based markers using commercial F1 cultivars susceptible

371 to PM, PCR bands of various sizes were detected by SCAR_SlMlo1.1 among different cultivars,

372 indicating that the 14-bp deletion in an intron is not unique to ‘KNU-12’ and is not associated with

373 the PM resistance phenotype. Diverse polymorphisms at this intron may be attributed to the

374 different number of (TA)n SSR motifs carried by different cultivars. However, for the 1-bp indel

375 marker, most cultivars showed the marker genotype for ‘PMS’. This implies that the 1-bp deletion

376 at 3rd amino acid in 15th exon might induce a frameshift in the coding region, altering the function of

377 SlMol1. The Mlo gene family codes for proteins harboring seven transmembrane domains (TMs)

378 and a calmodulin-binding site (CaMBD) that are functionally conserved among monocot and dicot

379 species (Appiano et al. 2015). The CaMBD is positioned in the 15th exon of Mlo, which codes for

380 the extreme carboxy-terminal end of the protein. Thus, the frameshift mutation induced by the 1-bp

381 deletion in this region might significantly impair the molecular function of SlMlo.

382 In addition, in terms of gene evolution, finding the intron deletion allele in many F1 cultivars,

383 while the exon-15 deletion was only observed in two cultivars, indicated that exon deletion might

384 have occurred after the mutation in the intron. The two F1 cultivars that showed the dCAPS marker

385 genotype for ‘KNU-12’ need to be further evaluated for their resistance phenotype. Nevertheless,

386 the uniqueness of the 1-bp indel found in elite commercial cultivars indicated that the dCAPS

387 marker can be used for efficient and effective MAS of the Slmlo1.1 allele of ‘KNU-12’ as a source

388 of PM resistance. Incorporating recessive gene(s) such as Slmlo1.1 can be more difficult and time

389 consuming than incorporating dominant allele(s) in a conventional breeding process. Thus, dCAPS

390 is also advantageous for selecting recessive homozygous plants at early growth stage using

391 molecular markers.

392 The putative alternative splicing of SlMlo1 observed in the present study might be related to the

393 diversification of disease resistance genes (R genes) and their mechanism of conferring resistances.

Page 17 of 38


Genome

Draft

18

394 The crucial role of alternative splicing in regulating plant defense responses has been reported for

395 many R genes, including RPS4 in Arabidopsis (Zhang and Gassmann 2007), Mla6 and Mla13 in

396 barley (Dennis et al. 2003), and Pi-ta in rice (Yang et al. 2014). Isoforms produced by alternatively

397 spliced transcripts may suppress the negative regulation of immunity by pathogens or directly

398 engage in effector-triggered signaling (Yang et al. 2014). In tobacco, the tobacco mosaic virus

399 (TMV)-resistance gene N specifically recognizes the 50 kDa helicase (p50) of TMV. Alternative

400 splicing of N resulted in translation of an isoform (NAT) in addition to the usual isoform (NRT), and

401 the ratio of these isoforms was related to TMV tolerance (Dinesh-Kumar and Baker 2000).

402 However, it is unclear whether truncated transcripts of Slmlo1.1 in ‘KNU-12’ have any influence on

403 its level of resistance to PM.

404 In conclusion, PM resistance in a cherry tomato-type accession ‘KNU-12’ is conferred by a

405 natural null allele (Slmlo1.1) of SlMlo that forms multiple alleles of ol-2. A 1-bp deletion in a

406 coding region of Slmlo1.1 causes a frameshift mutation that possibly results in the loss-of-function

407 of SlMlo1. The dCAPS and HRM markers developed in the present study for detecting this deletion

408 could be efficiently used for MAS where ‘KNU-12’ is utilized as a source for durable and broad-

409 spectrum resistance to PM.

410

411 Acknowledgments

412 This research was supported by the Golden Seed Project (Center for Horticultural Seed

413 Development, No. 2013007-05-1-SBF10), Ministry of Agriculture, Food and Rural Affairs

414 (MAFRA), Ministry of Oceans and Fisheries (MOF), Rural Development Administration (RDA),

415 and Korea Forest Service (KFS).

416

417

Page 18 of 38


Genome

Draft

19

418 References

419 Abarenkov, K., Nilsson, R.H., Larsson, K.H., Alexander, I.J., Eberhardt, U., and Erland, S., et al.

420 2010. The UNITE database for molecular identification of fungi – recent updates and future

421 perspectives. New Phytol. 186 (2): 281–285. doi:10.1111/j.1469-8137.2009.03160.x.

422 Appiano, M., Pavan, S., Catalano, D., Zheng, Z., Bracuto, V., and Lotti, C., et al. 2015.

423 Identification of candidate MLO powdery mildew susceptibility genes in cultivated

424 Solanaceae and functional characterization of tobacco NtMLO1. Transgenic Res. 24 (5): 847–

425 858. doi:10.1007/s11248-015-9878-4.

426 Bai, Y., Huang, C.C., van der Hulst, R., Meijer-Dekens, F., Bonnema, G., and Lindhout, P., et al.

427 2003. QTLs for tomato powdery mildew resistance (Oidium lycopersici ) in Lycopersicon

428 parviflorum G1.1601 co-localize with two qualitative powdery mildew resistance genes. Mol.

429 Plant Microbe In. 16 (2): 169–176. doi:10.1094/MPMI.2003.16.2.169.

430 Bai, Y., van der Hulst, R., Huang, C.C., Wei, L., Stam, P., and Lindhout, P. 2004. Mapping Ol-4, a

431 gene conferring resistance to Oidium neolycopersici and originating from Lycopersicon

432 peruvianum LA2172, requires multi-allelic, single-locus markers. Theor. Appl. Genet. 109 (6):

433 1215–1223. doi:10.1007/s00122-004-1698-5.

434 Bai, Y., van der Hulst, R., Bonnema, G., Marcel, T.C., Meijer-Dekens, F., and Niks, R.E., et al.

435 2005. Tomato defense to Oldium neolycopersici : Dominant OI genes confer isolate-

436 dependent resistance via a different mechanism than recessive oI-2. Mol. Plant Microbe In. 18

437 (4): 354–362. doi:10.1094/MPMI-18-0354.

438 Bai, Y., Pavan, S., Zheng, Z., Zappel, N.F., Reinstädler, A., and Lotti, C., et al. 2008. Naturally

439 occurring broad-spectrum powdery mildew resistance in a central American tomato accession

440 is caused by loss of Mlo function. Mol. Plant Microbe In. 21 (1): 30–39. doi:10.1094/MPMI-

441 21-1-0030.

Page 19 of 38


Genome

Draft

20

442

443 Chunwongse, J., Bunn, T.B., Crossman, C., Jiang, J., and Tanksley, S.D. 1994. Chromosomal

444 localization and molecular marker tagging of the powdery mildew resistance gene (Lv) in

445 tomato. Theor. Appl. Genet. 89 (1): 76–79. doi:10.1007/BF00226986.

446 Ciccarese, F., Amenduni, M., Schiavone, D., and Cirulli, M. 1998. Occurrence and inheritance of

447 resistance to powdery mildew (Oidium lycopersici) in Lycopersicon species. Plant Pathol. 47

448 (4): 417–419. doi:10.1046/j.1365-3059.1998.00254.x.

449 Dinesh-Kumar, S.P., and Baker, B.J. 2000. Alternatively spliced N resistance gene transcripts:

450 Their possible role in tobacco mosaic virus resistance. P. Natl. Acad. Sci. USA 97 (4): 1908–

451 1913. doi:10.1073/pnas.020367497.

452 Faino, L., Azizinia, S., Hassanzadeh, B.H., Verzaux, E., Ercolano, M.R., and Visser, R.G.F., et al.

453 2012. Fine mapping of two major QTLs conferring resistance to powdery mildew in tomato.

454 Euphytica 184 (2): 223–234. doi:10.1007/s10681-011-0551-6.

455 Jacob, D., David, D.R., Sztjenberg, A., and Elad, Y. 2008. Conditions for development of powdery

456 mildew of tomato caused by Oidium neolycopersici. Phytopathology 98 (3): 270–281.

457 doi:10.1094/PHYTO-98-3-0270.

458 Jones, H., Whipps, J.M., and Gurr, S.J. 2001. The tomato powdery mildew fungus Oidium

459 neolycopersici. Mol. Plant Pathol. 2 (6): 303–309. doi:10.1046/j.1464-6722.2001.00084.x.

460 Kang, S.W., Kwon, J.H., Shin, W.K., and Kim, K.H. 1995. Occurrence of powdery mildew on

461 tomato caused by Oidiopsis taurica (Lév.) Arnaud (= Leveillula taurica) in Korea. Kroean J.

462 Plant Pathol. 11 (4): 380–382.

463 Kashimoto, K., Matsuda, Y., Matsutani, K., Sameshima, T., Kakutani, K., and Nonomura, T., et al.

464 2003. Morphological and molecular characterization for a Japanese isolate of tomato powdery

Page 20 of 38


Genome

Draft

21

465 mildew Oidium neolycopersici and its host range. J. Gen. Plant Pathol. 69 (3): 176–185.

466 doi:10.1007/s10327-002-0034-7.

467 Kiss, L., Cook, R.T.A., Saenz, G.S., Cunnington, J.H., Takamatsu, S., and Pascoe, I., et al. 2001.

468 Identification of two powdery mildew fungi, Oidium neolycopersici sp. nov. and O.

469 lycopersici, infecting tomato in different parts of the world. Mycol. Res. 105 (6): 684–697.

470 doi:10.1017/S0953756201004105.

471 Kiss, L., Takamatsu, S., and Cunnington, J.H. 2005. Molecular identification of Oidium

472 neolycopersici as the causal agent of the recent tomato powdery mildew epidemics in North

473 America. Plant Dis. 89 (5): 491–496. doi:10.1094/PD-89-0491.

474 Lebeda, A., Mieslerová, B., Jankovics, T., Kiss, L., and van der Linde, E.J. 2015. First detection of

475 tomato powdery mildew caused by Oidium neolycopersici in South Africa. S. Afr. J. Bot. 99:

476 153–157. doi:10.1016/j.sajb.2015.03.196.

477 Pavan, S., Jacobsen, E., Visser, R.G.F., and Bai, Y. 2010. Loss of susceptibility as a novel breeding

478 strategy for durable and broad-spectrum resistance. Mol. Breeding 25 (1): 1-12.

479 doi:10.1007/s11032-009-9323-6.

480 Pavan, S., Zheng, Z., Borisova, M., van Den Berg, P., Lotti, C., and de Giovanni, C., et al. 2008.

481 Map- vs. homology-based cloning for the recessive gene ol-2 conferring resistance to tomato

482 powdery mildew. Euphytica 162 (1): 91–98. doi:10.1007/s10681-007-9570-8.

483 Seifi, A., Gao, D., Zheng, Z., Pavan, S., Faino, L., and Visser, R.G.F., et al. 2014. Genetics and

484 molecular mechanisms of resistance to powdery mildews in tomato (Solanum lycopersicum)

485 and its wild relatives. Eur. J. Plant Pathol. 138 (3): 641–665. doi:10.1007/s10658-013-0314-4.

486 Sim, S.C., Kim, M., Chung, S.M., and Park, Y. 2015. Assessing the genetic variation in cultivated

487 tomatoes (Solanum lycopersicum L.) using genome-wide single nucleotide polymorphisms.

488 Hortic. Environ. Biote. 56 (6): 800–810. doi:10.1007/s13580-015-0107-0.

Page 21 of 38


Genome

Draft

22

489 Whipps, J.M., and Budge, S.P. 2000. Effect of humidity on development of tomato powdery

490 mildew (Oidium lycopersici) in the glasshouse. Eur. J. Plant Pathol. 106 (4): 395–397.

491 doi:10.1023/A:1008745630393.

492 Yang, S., Tang, F., and Zhu, H. 2014. Alternative splicing in plant immunity. Int. J. Mol. Sci. 15

493 (6): 10424–10445. doi:10.3390/ijms150610424.

494 Yanar, Y., Yanar, D., and Gebologlu, N. 2011. Control of powdery mildew (Leveillula taurica) on

495 tomato by foliar sprays of liquid potassium silicate (K2SiO3). Afr. J. Biotechnol. 10 (16):

496 3121–3123. doi:10.5897/AJB11.215.

497 Zhang, X.C., and Gassmann, W. 2007. Alternative splicing and mRNA levels of the disease

498 resistance gene RPS4 are induced during defense responses. Plant. Physiol. 145 (4): 1577–

499 1587. doi:10.1104/pp.107.108720.

500 Zheng, Z., Appiano, M., Pavan, S., Bracuto, V., Ricciardi, L., and Visser, R.G.F., et al. 2016.

501 Genome-wide study of the tomato SlMLO gene family and its functional characterization in

502 response to the powdery mildew fungus Oidium neolycopersici. Front. Plant Sci. 7: 380.

503 doi:10.3389/fpls.2016.00380.

504 Zheng, Z., Nonomura, T., Appiano, M., Pavan, S., Matsuda, Y., and Toyoda, H., et al. 2013. Loss

505 of function in Mlo orthologs reduces susceptibility of pepper and tomato to powdery mildew

506 disease caused by Leveillula taurica. PLoS ONE 8 (7): e70723.

507 doi:10.1371/journal.pone.0070723.

508

509

510

511

512

Page 22 of 38


Genome

Draft

23

513

514

515

516

517

518 Figure Captions

519

520 Fig. 1. Powdery mildew disease in tomato. (A) Tomato leaf showing symptoms of powdery mildew

521 (Oidium neolycopersici) infection in Miryang, South Korea. Light microscopy photographs of

522 tomato powdery mildew pathogen collected from Miryang, Gyeongnam Province (B) and Muju,

523 Jeonnam Province (C) in South Korea. Conidiophores producing single conidia (anamorph of

524 Pseudoidium sp.) indicate that these two isolates correspond to O. neolycopersici. Bar = 30 μm.

525

526 Fig. 2. Evaluation of public markers linked to powdery mildew (PM) resistance in the tomato

527 inbred accessions ‘KNU-12’ (PM-resistant) and ‘PMS’ (PM-susceptible). DNA samples of ‘KNU-

528 12’ and ‘PMS’ were tested using two replicates per marker. Polymorphic bands (red arrows) were

529 only detected in marker GP79L. The SlMlo1 gene-based marker M/SlMlo1 for the ol-2 locus is

530 monomorphic between ‘KNU-12’ and ‘PMS’.

531

532 Fig. 3. Location of the mutation sequences and primer sets used for genomic DNA amplification of

533 SlMlo1 (SGN gene annotation number: Solyc04g049090). The first exon and exons 7th to 15th are

534 displayed in gray boxes. Exons 2nd to 6th are not represented. Introns are displayed as the gray

535 diagonal line. Numbers below exons indicate the location of the first nucleotide of each exon based

Page 23 of 38


Genome

Draft

24

536 on the genomic sequence of SlMlo1. The 19-bp deletion in powdery mildew (PM) resistance line

537 LA1230 is shown as a yellow vertical line in the 7th exon. This 19-bp deletion was used to develop

538 the SCAR marker M/SlMlo1 (Bai et al. 2008). The 14-bp deletion in an intron between the 14th and

539 15th exons and the 1-bp deletion in the 15th exon that were observed in the PM-resistance line

540 ‘KNU-12’ are indicated by the red horizontal and vertical lines, respectively. Genomic regions

541 amplified by the primer sets ‘1-1’, ‘1-2’, and ‘1-3’ are indicated by horizontal lines above the gene

542 sequence. The 9th exon, which is predicted to be alternatively spliced in ‘KNU-12’, is presented in

543 black. Blue arrows above the 8th and 10th exons represent the forward (ASC-1F) and reverse (ASC-

544 1R) primers that were used for assessing alternative splicing of the 9th exon.

545

546 Fig. 4. Comparison of partial SlMlo1 gene sequences that were PCR-amplified by primer set ‘1-3’

547 and cloned from tomato inbred line ‘KNU-12’ (powdery mildew resistance) and ‘PMS’ (powdery

548 mildew susceptibility). A 14 bp insertion/deletion (indel) in the 14th intron (in red) and a 1 bp indel

549 (bold letter) in the 15th exon were detected. The 14th exon (>14) and 15th exon (>15) are indicated

550 by gray shading. Solyc04g049090 is the genomic DNA sequence of SlMlo1 in the reference

551 genome of tomato.

552

553 Fig. 5. Genotyping of the F2 population derived from ‘KNU-12’ [powdery mildew (PM)-resistant]

554 × ‘PMS’ (PM-susceptible) using ol-2 gene-based SCAR_SlMlo1.1 (upper lanes) and

555 dCAPS_SlMlo1.1 (lower lanes) markers. M, 100-bp marker; K, ‘KNU-12’; P, ‘PMS’. From the 3rd

556 lane to the right, 46 F2 individuals were tested as indicated in Table 2 (F

2:3-1–F

2:3-66).

557 Cosegregation between the marker genotype and disease reaction was observed for both markers.

558 The relatively weak band corresponding to the ‘PMS’ allele in heterozygous dCAPS_SlMlo1.1 was

Page 24 of 38


Genome

Draft

25

559 possibly due to the forward primer (enzyme site-derived primer) having lower PCR efficiency on

560 the wild-type allele compared to the mutant allele.

561

562 Fig. 6. Development of the high-resolution melting (HRM) maker (HRM_SlMlo1.1) based on the

563 1-bp indel in the 15th exon of the powdery mildew (PM) resistance gene Slmlo1.1. The HRM

564 marker genotype of PM-resistant tomato ‘KNU-12’ and PM-susceptible tomato ‘PMS’ and their F2

565 progeny are shown in blue and yellow melting curves, respectively. The red melting curve with two

566 peaks indicates the maker genotype of heterozygous F1 progeny.

567

568 Fig. 7. Assessment of alternative splicing in the 9th exon of Slmlo1.1. M, 100-bp marker; gDNA-

569 Control, amplified using gDNA of powdery mildew-resistant tomato inbred line ‘KNU-12’ by a

570 primer set designed for the two introns flanking the 9th exon (PCR amplicon size: 842 bp); SP-

571 Clone, amplified using the plasmid of the 9th exon deletion mutation by a primer set (ASC-1)

572 binding to the 8th and 10th exons (122 bp); WT-Clone, amplified using the plasmid of the wild-type

573 sequence (172 bp), cDNAs-0, 12, 24, 48; amplified from cDNAs extracted from ‘KNU-12’ at 0, 12,

574 24, and 48 h post inoculation using the primer ‘ASC-1’. Weak PCR bands of cDNAs-0, 12, and 24

575 specific to SP-Clone indicate a possible alternative splicing of SlMlo1.

576

577

578

579

580

581

Page 25 of 38


Genome

Draft

26

582

583 Supplementary File Captions

584

585 Supplementary File 1. DNA sequence of rRNA ITS of PM pathogen isolate from Muju (MJ_PM1)

586 and Miryang (MR_PM1) (A) and 29 ITS sequence accessions (GeneBank ID) that showed 100%

587 identity to MJ_PM1 and MR_PM1 (B).

588

589 Supplementary File 2. Multiple sequence alignment of full-length cDNA sequences revealed by

590 the RACE PCR of ‘PMS’ and ‘KNU12’. KNU12-1 and KNU12-2 are two different colonies with

591 sequence variation at the 9th exon (the 9th exon sequence is missing in KNU12-2 possibly due to

592 alternative splicing). The first base of each exon is marked by > and by the number of the

593 corresponding exon. The deleted 9th exon in KNU-12 and the 1-bp indel for dCAPS_SlMlo1.1 are

594 marked by red dashes. Primer sequences for ASC-1 and dCAPS_SlMlo1.1 are shown in gray

595 blocks. Start (ATG) and stop (TGA) codons are shown in bold.

596

597

Page 26 of 38


Genome

Draft

Table 1. Primers used in the present study.

Use Primer name Primer sequence (5’-3’)

ITS sequencing PMITS1 F: TCGGACTGGCCTCAGGGAGA

PMITS2 R: TCACTCGCCG TTACTGAGGT

Genomic SlMlo1 sequencing 1-1 F: AACATGTGTGCCTATTTGTTCG

R: TCATTTGAAGTTTTGTGCCAAC

1-2 F: CGTATCTTTG GGTGCCATTT

R: ATGGCTAGGTCTGCAGCATT

1-3 F: GGCAGAAT GCGTTTCAAGTT

R: TTGTTTCCAAAAGTAAAATCTGACA

SlMlo1.1 genotyping SCAR_SlMlo1.1 F: GCAGCTATGTGACTCTCCCTCT

R: GCTGTATGGTGCCAGCTTCT

dCAPS_SlMlo1.1 F: TATATAGAGAAATTCTGTAGATGTGATC

R: TGGATAACCGCGTAATAAGT

HRM_SlMlo1.1 F: TGATCATACAGGTCCATTGCAGCT

R: AGCTTCTAAGAGCTGTTGCCACAT

Probe: AATTCTGTAGATGGGTTCATCAATG

Alternative splicing

assessment

ASC-1 F: GCACATTTAACTCCACAAAATCA

R: ATGGCACCCAAAGATACGAG

Page 27 of 38


Genome

Draft

Table 2. Published DNA markers that are linked to the loci associated with powdery mildew

(PM) resistance in tomato.

Marker Primer sequence (5’-3’)

Marker

type Chr.

Target

locus

(enzyme)

dct136 F: CGAAGTGTCGGATCCGAAGGCTTT dCAPS 6 Ol-qtl1

R: AACACAATCGGAAAAAA (XmmI)

Y258 F: GTAATTCCAAAAAGTGAGGT CAPS 12 Ol-qtl3

R: TTGCGTCTAGAGTTATTTT (MboI)

tg111 F: TGCCAACCCGGACAAAGA SCAR 12 Ol-qtl3

R: TGGGGAAGTGATTAGACAGGACA

P2147 F: TAACAATCTCGACCATAGTTCC CAPS 6 Ol-1, Ol-5

R: CCATACCCGAATTTCCTTCC (DdeI)

tg25-1 F: TAATTTGGCACTGCCGT SCAR 6 Ol-1, Ol-5

R: TTGTYATRTTGTGYTTATCG

tg25-2 F: TAATTTGGCACTGCCGT SCAR 6 Ol-1, Ol-5

R: CATGTTGYGYTTATCRAAAGTC

H9A11 F: TGCTCTAACAAAATCACCAAAATC SCAR 6 Ol-1, Ol-5

R: AAATGGTCAAACAAAGTCTATTGAG

Tom316 F: GAGTTGTTCTTTGGTTGTTT SSR 4 ol-2

R: TAGATTTTTCGTGTAGATGT

Tom332 F: GATACCATTAAAGCTCATTC SSR 4 ol-2

R: GGTTTCCGTCATTATGTCAG

U3-2 F: AGTGGTTGGCGGATAGGTG SCAR 4 ol-2

R: TTGGCAAGGTGGGAAAACT

M/SlMlo1 F: ACCCTTAAGAAACTAGGGCAAA SCAR 4 ol-2

R: ACCATCATGAACCCATGTCT

GP79L F: CACTCAATGGGGGAAGCAAC CAPS 6 Ol-4, Ol-6

R: AATGGTAAACGAGCGGGACT (ApoI)

32.5Cla F: ACACGAAACAAAGTGCCAAG CAPS 6 Ol-4, Ol-6

R: CCACCACCAAACAGGAGTGTG (HinfI)

Page 28 of 38


Genome

Draft

Table 3. Disease assay of powdery mildew (PM) and genotyping of ol-2 gene-based SCAR_SlMlo1.1 marker for 111 F2:3 families derived from the

tomato (Solanum lycopersicum) inbred line ‘KNU-12’ (PM-resistant) x ‘PMS’ (PM-susceptible).

F2:3 Phenotypea

Genotypeb

F2:3 Phenotypea

Genotypeb

F2:3 Phenotype

a

Genotypeb

2014 2015 Aver F2 F3 2014 2015 Aver F2 F3 2014 2015 Aver F2 F3

1 1.2 2.3 S

H Seg

56 1.9 2.9 S

S S

107 1.2 2.1 S

H Seg

2 1.3 1.9 S

H Seg

58 2.2 2.6 S

S S

109 2.5 2.4 S

H Seg

3 0.0 0.4 R

R R

59 1.9 2.6 S

S S

110 0.2 0.1 R R R

7 0.0 0.0 R

R R

60 0.0 0.0 R

R R

112 1.4 2.2 S

H Seg

8 1.8 2.1 S

H Seg

61 0.1 0.1 R

R R

114 1.5 2.0 S

H Seg

9 1.7 2.8 S

S S

62 1.6 1.6 S

H Seg

115 1.9 2.2 S H Seg

10 1.9 2.8 S

S S

64 2.1 3.0 S S S

116 1.5 2.6 S S S

11 2.3 2.9 S

S S

66 2.6 3.0 S

S S

117 1.6 1.5 S

H Seg

12 1.6 1.6 S

H Seg

67 2.1 1.0 S

S S

119 1.3 2.4 S

H Seg

13 0.0 0.0 R

R R

68 2.8 2.9 S

S S

120 0.0 0.0 R R R

14 1.6 3.0 S

S S

69 1.9 2.1 S

H Seg

121 0.6 2.5 S

H Seg

15 1.6 2.7 S

H Seg

70 1.4 1.7 S H Seg

122 1.9 2.8 S

S S

Page 29 of 38


Genome

Draft

17 0.0 0.0 R

R R

72 2.5 2.8 S

S S

123 2.0 2.6 S H Seg

19 1.6 1.8 S

H Seg

74 2.1 1.9 S

H Seg

124 1.5 2.2 S

H Seg

20 1.6 2.9 S

S S

75 2.6 2.0 S

H Seg

125 1.1 1.8 S

H Seg

21 0.0 0.0 R

R R

76 1.4 1.9 S H Seg

126 1.5 1.8 S

H Seg

25 1.7 2.7 S

S S

77 1.1 1.7 S H Seg

127 1.7 3.0 S S S

26 0.0 0.0 R

R R

80 1.0 2.0 S H Seg

128 1.6 2.1 S

H Seg

28 1.5 1.8 S

S S

81 1.2 2.3 S H Seg

131 1.5 1.6 S

H Seg

30 2.6 2.8 S

S S

82 0.1 0.2 R

R R

132 1.8 2.0 S

H Seg

32 2.3 2.9 S

S S

83 1.7 2.4 S

H Seg

133 1.4 2.1 S

H Seg

35 - 0.0 R

R R

84 2.1 1.7 S

H Seg

134 0.0 0.1 R R R

36 2.0 2.0 S

H Seg

85 0.0 0.0 R R R

135 1.5 1.9 S H Seg

37 1.5 1.4 S

H Seg

86 1.0 2.1 S H Seg

136 1.7 2.0 S

H Seg

38 1.9 2.8 S

S S

87 1.1 2.6 S H Seg

137 1.4 2.3 S H Seg

41 1.1 2.0 S

H Seg

88 2.2 2.6 S S S

138 0.0 0.2 R R R

42 0.0 0.0 R

R R

91 1.6 2.5 S H Seg

139 1.2 2.5 S H Seg

43 2.1 2.6 S

S S

94 1.8 2.1 S

H Seg

140 2.1 1.3 S

H Seg

44 2.3 2.9 S

S S

95 1.9 1.8 S

H Seg

141 2.4 2.7 S S S

45 2.1 2.9 S

S S

96 1.7 1.7 S

H Seg

142 1.4 2.6 S

S S

Page 30 of 38


Genome

Draft

46 1.9 2.8 S

S S

97 1.7 2.0 S

H Seg

143 2.5 2.4 S

S S

48 1.8 2.6 S

S S

99 0.0 0.0 R

R R

144 0.9 2.3 S H Seg

49 0.0 0.1 R

R R

101 1.6 2.6 S

H Seg

145 1.0 1.8 S H Seg

50 2.0 1.5 S

H Seg

102 1.6 2.5 S

S S

147 1.4 2.0 S H seg

52 0.0 0.0 R

R R

103 1.6 2.5 S

H Seg

150 2.5 2.6 S S S

53 1.5 2.1 S

H Seg

104 1.8 2.3 S H Seg

54 0.0 0.0 R

R R

105 1.5 2.7 S

H Seg

55 0.0 0.1 R

R R 106 1.8 2.5 S S S

aPhenotyping followed the disease assay method described in the text. ‘aver’ indicates the average value of disease index (DSI) in 2014 and 2015. R,

resistant (average DSI < 1.0); S, susceptible (average DSI ≥ 1.0).

bF2 individuals and 10 seedlings per F3 family were genotyped using SCAR_SlMlo1.1 and dCAPS_SlMlo1.1 markers. R, homozygous marker

genotype for ‘KNU-12’ (PM-resistant); S, homozygous marker genotype for ‘PMS’ (PM-susceptible); H, heterozygous marker genotype; seg,

segregation.

Page 31 of 38


Genome

Draft

Fig. 1. Powdery mildew disease in tomato. (A) Tomato leaf showing symptoms of powdery mildew (Oidium neolycopersici) infection in Miryang, South Korea. Light microscopy photographs of tomato powdery mildew pathogen collected from Miryang, Gyeongnam Province (B) and Muju, Jeonnam Province (C) in South Korea.

Conidiophores producing single conidia (anamorph of Pseudoidium sp.) indicate that these two isolates correspond to O. neolycopersici. Bar = 30 μm.

248x82mm (300 x 300 DPI)

Page 32 of 38


Genome

Draft

Fig. 2. Evaluation of public markers linked to powdery mildew (PM) resistance in the tomato inbred accessions ‘KNU-12’ (PM-resistant) and ‘PMS’ (PM-susceptible). DNA samples of ‘KNU-12’ and ‘PMS’ were

tested using two replicates per marker. Polymorphic bands (red arrows) were only detected in marker GP79L. The SlMlo1 gene-based marker M/SlMlo1 for the ol-2 locus is monomorphic between ‘KNU-12’ and

‘PMS’.

284x63mm (300 x 300 DPI)

Page 33 of 38


Genome

Draft

Fig. 3. Location of the mutation sequences and primer sets used for genomic DNA amplification of SlMlo1 (SGN gene annotation number: Solyc04g049090). The first exon and exons 7th to 15th are displayed in

gray boxes. Exons 2nd to 6th are not represented. Introns are displayed as the gray diagonal line. Numbers below exons indicate the location of the first nucleotide of each exon based on the genomic sequence of

SlMlo1. The 19-bp deletion in powdery mildew (PM) resistance line LA1230 is shown as a yellow vertical line in the 7th exon. This 19-bp deletion was used to develop the SCAR marker M/SlMlo1 (Bai et al. 2008). The 14-bp deletion in an intron between the 14th and 15th exons and the 1-bp deletion in the 15th exon that were observed in the PM-resistance line ‘KNU-12’ are indicated by the red horizontal and vertical lines,

respectively. Genomic regions amplified by the primer sets ‘1-1’, ‘1-2’, and ‘1-3’ are indicated by horizontal lines above the gene sequence. The 9th exon, which is predicted to be alternatively spliced in ‘KNU-12’, is presented in black. Blue arrows above the 8th and 10th exons represent the forward (ASC-1F) and reverse

(ASC-1R) primers that were used for assessing alternative splicing of the 9th exon.

233x36mm (300 x 300 DPI)

Page 34 of 38


Genome

Draft

>14

Solyc04g049090 ...TGTCAAGTCAAAACATTATGGAAGTTGATGCATATATATATTCAGGGTGATCATACA

PMS ...TGTCAAGTCAAAACATTATGGAAGTTGATGCATATATATATTCAGGGTGATCATACA

KNU-12 ...TGTCAAGTCAAAACATTATGGAAGTTGATGCATATATATATTCAGGGTGATCATACA

************************************************************

Solyc04g049090 GGTCCATTGCAGCTATGTGACTCTCCCTCTTTATGCCTTAGTTACACAGGTAGGTACTCT

PMS GGTCCATTGCAGCTATGTGACTCTCCCTCTTTATGCCTTAGTTACACAGGTAGGTACTCT

KNU-12 GGTCCATTGCAGCTATGTGACTCTCCCTCTTTATGCCTTAGTTACACAGGTAGGTACTCT

************************************************************

Solyc04g049090 GATCTACATTATGAAAATGTTATATATATATATATATATATATATATATATATATATATA

PMS GATCTACATTATGAAAATGTTATATATATATATATATATATATATATATATATATATATA

KNU-12 GATCTACATTATGAAAATGTTATATATATATATATATATATATATATA------------

************************************************

>15

Solyc04g049090 --CTTATATAGAGAAATTCTGTAGATGGGTTCATCAATGAAGCCTATCATCTTTGGTGAT

PMS TACTTATATAGAGAAATTCTGTAGATGGGTTCATCAATGAAGCCTATCATCTTTGGTGAT

KNU-12 --CTTATATAGAGAAATTCTGTAGATGGGTTC-TCAATGAAGCCTATCATCTTTGGTGAT

******************************** ***************************

Solyc04g049090 AATGTGGCAACAGCTCTTAGAAGCTGGCACCATACAGCGAAAAAACGGGTGAAACAT...

PMS AATGTGGCAACAGCTCTTAGAAGCTGGCACCATACAGCGAAAAAACGGGTGAAACAT...

KNU-12 AATGTGGCAACAGCTCTTAGAAGCTGGCACCATACAGCGAAAAAACGGGTGAAACAT...

************************************************************

Page 35 of 38


Genome

Draft

Fig. 5. Genotyping of the F2 population derived from ‘KNU-12’ [powdery mildew (PM)-resistant] × ‘PMS’ (PM-susceptible) using ol-2 gene-based SCAR_SlMlo1.1 (upper lanes) and dCAPS_SlMlo1.1 (lower lanes) markers. M, 100-bp marker; K, ‘KNU-12’; P, ‘PMS’. From the 3rd lane to the right, 46 F2 individuals were tested as indicated in Table 2 (F2:3-1–F2:3-66). Cosegregation between the marker genotype and disease

reaction was observed for both markers. The relatively weak band corresponding to the ‘PMS’ allele in heterozygous dCAPS_SlMlo1.1 was possibly due to the forward primer (enzyme site-derived primer) having

lower PCR efficiency on the wild-type allele compared to the mutant allele.

286x64mm (300 x 300 DPI)

Page 36 of 38


Genome

Draft

Fig. 6. Development of the high-resolution melting (HRM) maker (HRM_SlMlo1.1) based on the 1-bp indel in the 15th exon of the powdery mildew (PM) resistance gene Slmlo1.1. The HRM marker genotype of PM-resistant tomato ‘KNU-12’ and PM-susceptible tomato ‘PMS’ and their F2 progeny are shown in blue and

yellow melting curves, respectively. The red melting curve with two peaks indicates the maker genotype of heterozygous F1 progeny.

178x130mm (300 x 300 DPI)

Page 37 of 38


Genome

Draft

Fig. 7. Assessment of alternative splicing in the 9th exon of Slmlo1.1. M, 100-bp marker; gDNA- Control, amplified using gDNA of powdery mildew-resistant tomato inbred line ‘KNU-12’ by a primer set designed for the two introns flanking the 9th exon (PCR amplicon size: 842 bp); SP-Clone, amplified using the plasmid of the 9th exon deletion mutation by a primer set (ASC-1) binding to the 8th and 10th exons (122 bp); WT-

Clone, amplified using the plasmid of the wild-type sequence (172 bp), cDNAs-0, 12, 24, 48; amplified from cDNAs extracted from ‘KNU-12’ at 0, 12, 24, and 48 h post inoculation using the primer ‘ASC-1’. Weak PCR

bands of cDNAs-0, 12, and 24 specific to SP-Clone indicate a possible alternative splicing of SlMlo1.

134x115mm (300 x 300 DPI)

Page 38 of 38


Genome

draft - tspace repository: homedraft development of dna markers for slmlo1.1, a new mutant allele of...

Documents