DROSOPHILA COUCH POTATO MUTANTS EXHIBIT COMPLEX NEUROLOGICAL

ABNORMALITIES INCLUDING EPILEPSY PHENOTYPES

Edward Glasscock* and Mark A. Tanouye*,†

*Department of Molecular and Cell Biology

Division of Neurobiology

†Department of Environmental Science, Policy and Management

Division of Insect Biology

University of California

Berkeley, CA 94720

Genetics: Published Articles Ahead of Print, published on January 31, 2005 as 10.1534/genetics.104.028357

TANOUYE--2

RUNNING HEAD:

Couch potato Epilepsy Phenotypes

KEY WORDS:

Epilepsy, seizure, RNA-binding protein, bang-sensitive, couch potato

Corresponding Author:

Mark A. Tanouye

Department of Environmental Science, Policy, and Management

Life Sciences Addition, Rm. 131A

University of California

Berkeley, CA 94720

(510) 642-9404

(510) 643-6791 (FAX)

tanouye@uclink4.berkeley.edu

TANOUYE--3

ABSTRACT

RNA-binding proteins play critical roles in regulation of gene expression and impairment can

have severe phenotypic consequences on nervous system function. We report here the discovery

of several complex neurological phenotypes associated with mutants of couch potato (cpo), that

encodes a Drosophila RNA-binding protein. We show that mutation of cpo leads to bang-

sensitive paralysis, seizure susceptibility, and synaptic transmission defects. A new cpo allele

called cpoEG1 was identified based on a bang-sensitive paralytic mutant phenotype in a sensitized

genetic background (sda/+). In heteroallelic combinations with other cpo alleles, cpoEG1 shows

an incompletely penetrant bang-sensitive phenotype with ~30% of flies paralyzing. In response

to electroconvulsive shock, heteroallelic combinations with cpoEG1 exhibit seizure thresholds less

than half that of wild-type flies. Finally, cpo flies display several neurocircuit abnormalities in

the giant fiber (GF) system. The TTM muscles of cpo mutants exhibit long latency responses

coupled with decreased following frequency. DLM muscles in cpo mutants show drastic

reductions in following frequency despite exhibiting normal latency relationships. The labile

sites appear to be the electro-chemical GF-TTMn synapse and the chemical PSI-DLMn

synapses. These complex neurological phenotypes of cpo mutants support an important role for

cpo in regulating proper nervous system function, including seizure susceptibility.

TANOUYE--4

INTRODUCTION

RNA-binding proteins perform myriad crucial roles throughout the life of an RNA

molecule in eukaryotes. Subsequent to their genesis in the nucleus during transcription, pre-

messenger RNAs (pre-mRNAs) are bound by RNA-binding proteins, which mediate their

maturation into mRNAs via processing reactions, such as splicing, editing, capping, and

polyadenylation. RNA-binding proteins then assist in transporting mRNAs to the cytoplasm

where they are instrumental in regulating the translation, stability, and localization of the

transcripts. In addition to translated RNAs, the discovery of regulatory non-translated RNA

genes, termed microRNAs because of their minuscule size (<100 nucleotides) suggests

additional functions for RNA-binding proteins (Ambros 2001). Thus, RNA-binding proteins

serve a most critical role in the control of gene expression, especially in the nervous system

where extensive alternative splicing occurs and aberrations frequently result in neurological

disease.

Many neurological disorders result when the performance of RNA-binding proteins goes

awry, highlighting their importance in the maintenance of fundamental neuronal processes. For

example, in the human neurological condition paraneoplastic opsoclonus myoclonus ataxia

(POMA), patients lose inhibitory control of motor neurons in spinal cord and brainstem. POMA

is associated with the ectopic expression of the NOVA family of RNA-binding proteins, which

regulate neuron-specific alternative splicing (Jensen et al. 2000). In humans with Fragile X

syndrome, impaired expression of the cytoplasmic RNA-binding protein, FMRP, leads to mental

retardation, likely resulting from misregulation of mRNA transport or translation (Perrone-

Bizzozero and Bolognani 2002).

TANOUYE--5

Several neurological disorders that have been characterized in animal models with

defective RNA-binding proteins include jerky and quaking in mice and pumilio in Drosophila.

The jerky mice exhibit temporal lobe epilepsy analogous to the most common seizure disorder in

human adults. The jerky gene encodes an RNA-binding protein postulated to regulate mRNA

usage in neurons, which is inactivated in the mutant (Liu et al. 2002). The quaking mice exhibit

tonic-clonic seizures and hypomyelination. An RNA-binding protein involved with mRNA

nuclear export appears responsible for the “quaking” defects (Larocque et al. 2002). In

Drosophila, pumilio mutants show defects in embryonic development and maintainence of

neuronal excitability. The pumilio mutant exhibits increased rates of long-term facilitation at the

larval neuromuscular junction (Schweers et al. 2002). The pumilio gene has been shown to

encode an RNA-binding protein that acts as a translational repressor (Wreden et al. 1997).

The work presented here examines a Drosophila RNA-binding protein gene called couch

potato (cpo) that causes several neurological abnormalities including epilepsy phenotypes when

impaired. The cpo gene was originally identified in a screen for genes expressed in sensory organ

precursor cells during peripheral nervous system (PNS) development (Bellen et al. 1992a). Cpo

protein is localized to the nucleus and is expressed in the PNS and central nervous system (CNS)

of embryos, larvae, and adults, as well as other tissues such as midgut, glia, and salivary glands

(Bellen et al. 1992b). The protein contains an RNA recognition motif (RRM) and a nuclear

localization sequence (Bellen et al. 1992b). The RRM domain of cpo shows homology to the

hermes gene of M. musculus, G. gallus and Xenopus laevis; the C. elegans gene mec-8 and the

human gene RBP-MS (Gerber et al. 1999; Lundquist et al. 1996; Shimamoto et al. 1996). The

cpo gene has also been linked to the human neurodegenerative disorder spinocerebellar ataxia

type 1 (SCA1). The defective human SCA-1 gene causes neurodegeneration when expressed in

TANOUYE--6

Drosophila; this phenotype is enhanced by overexpressing cpo (Fernandez-Funez et al. 2000).

Partial loss of function mutations of Drosophila cpo cause a variety of behavioral phenotypes

including overall sluggishness and abnormal phototaxis, geotaxis, flight ability, ether recovery,

and mating vigor (Bellen et al. 1992a; Hall 1994).

In this paper, we identify a new cpo allele, cpoEG1. Electrophysiological analysis shows

that the cpoEG1 mutation contributes to numerous defects in the giant fiber (GF) neural circuit.

Additionally, the cpoEG1mutation contributes to increased seizure susceptibility manifested as

seizure thresholds that are less than half that of wild-type flies. We have examined existing cpo

alleles and have shown that they fail to complement the electrophysiological defects associated

with cpoEG1. Taken together, these findings suggest a neurological basis for the complex cpo

behavioral defects described previously. In addition to the previously postulated role that cpo

plays in PNS differentiation and normal adult behavior, this work provides evidence that RNA-

binding proteins are also essential for the proper functioning of synapses in the adult CNS and

for regulating susceptibility to seizure.

TANOUYE--7

METHODS

Fly stocks: The cpo gene is located on the third chromosome at map location 90D1-6 and

encodes a putative RNA-binding protein (Bellen et al. 1992b). The mutant cpo allele, cpoEG1,

was identified in a screen that selected for bang-sensitive paralytic mutant phenotypes revealed

in a sensitized genetic background provided by slamdance heterozygotes (sda/+) (Zhang et al.

2002). The screen utilized P-element hybrid dysgenesis with the transposon P[lacZ, w+]. In

brief, mutants were isolated in a mating of X^X, 8:P[lacZ, w+]/Y; ry Sb P[ry+ delta2.3]/+

females crossed to w/Y; sda males. Exceptional w/Y; sda/+ male progeny that showed bang-

sensitive paralysis were individually crossed to set up appropriate stocks. The cpoEG1 allele has

previously been called line N (Zhang et al. 2002). Five additional cpo alleles: cpocp1, cpocp2,

cpov3, cpol2, and cpol∆cp11, were obtained as a generous gift (H. Bellen, Baylor College of

Medicine). The cpocp1 and cpocp2 alleles are due to 17-kb P[lArB] insertions at scaffold position

1229712298. The cpocp1, cpocp2, and cpov3 alleles have been reported as viable with delayed

development (Bellen et al. 1992a); at present, they behave as recessive lethals. The cpov3 allele is

due to a 10-kb P[lacZ, w+] insertion at 1230512306. The cpol2 allele is due to a P[lacZ, w+]

insertion at 1229712298. The cpol∆cp11 allele is due to 200-bp deletion of the cpo promoter,

causing a loss of cpo expression, except in the chordotonal neurons, which express Cpo later in

development than wild-type (Bellen et al. 1992a, b). The cpol2 and cpol∆cp11 alleles behave as

recessive lethals. Note that scaffold position 1229712298 appears to be a hot-spot for

transposon insertions since at least seven of the known cpo alleles map to this position. This hot-

spot is 38-bp upstream of the cpo transcription start site. The cpo∆125 allele was generated in this

work as a precise excision of the P-element in cpoEG1 flies that reverts cpoEG1 phenotypes to

wild-type. The slamdance (sda) gene maps to 97D and encodes an aminopeptidase N (Zhang et

TANOUYE--8

al. 2002). The sda allele utilized was sdaiso7.8, caused by a 2-bp insertion in the 5’ untranslated

region. The sda mutation causes seizure sensitivity and bang-sensitive paralysis (Zhang et al.

2002). Duplication and deficiency mapping for cpoEG1 was done using the following strains

obtained from the Bloomington Stock Center at Indiana University: Df(3R)P-14=Df(3R) 90C2-

D1;91A1-2 and Tp(3;Y)L58=Tp(3;Y) 88D;93D;Y. Stocks were maintained on standard

cornmeal-molasses medium at 21-24°C. Other markers and stocks are described in Lindsley and

Zimm (1992).

Behavioral testing: Testing for BS paralysis was performed on flies 1-4 days posteclosion. BS

paralysis was assayed by transferring the flies to a clean empty food vial (Applied Scientific) and

then vortexing on a VWR vortex at maximum setting for 10-s. Any fly that lay motionless

following the vortex was scored BS. Flies were considered recovered when they were able to

resume an upright standing position. Flies were rested for a minimum of 2 hrs following CO2

anesthesia prior to testing.

Electrophysiology: Electrophysiology was performed on male flies using methods previously

described to stimulate and record giant fiber (GF)-driven muscle potentials and seizures (Kuebler

and Tanouye 2000). Briefly, the fly was removed from a food vial by sucking onto its head with

a 23-gauge syringe needle attached to a vacuum line. Another syringe needle was then used to

suck onto the abdomen, thereby completely immobilizing the fly. The fly was then mounted by

gluing a tungsten wire across the fly’s neck. In experiments, the GF was driven by brain

stimulation via bipolar tungsten electrodes inserted through the ventral antennal margin and into

the brain. The preparations were grounded by placing an electrode into the abdomen.

Stimulating, recording, and ground electrodes were all made from uninsulated tungsten wire

(WPI 0.075 mm), electrolytically sharpened to the desired diameter, usually less than one

TANOUYE--9

micron. Experiments requiring thoracic ganglion stimulation of DLM and TTM motoneurons

were conducted similarly except that stimulating electrodes were bent at 45° angles and inserted

just through the anterior pre-episternum, near the base of the first coxa, as described in Kuebler

and Tanouye 2000.

To assess GF circuit performance, single pulses of 0.2-ms were used. Latency and

following frequency experiments were done at 21-24°C on flies that were ≤ 7 days posteclosion,

unless otherwise noted. The latency was the time from the end of the stimulus pulse to the

beginning of the evoked muscle response. Following frequency was the highest frequency at

which the muscle responded to 19 out of 20 pulses at stimulation intensity 1.4 times the GF

threshold. Flies were allowed to rest at least 1 min between following frequency trials. GF

thresholds were defined as the lowest voltage that elicits a stable, short latency (~1.4 ms) dorsal

longitudinal muscle (DLM) response.

Seizures were elicited by delivering a short wavetrain (0.5 ms pulses at 200 Hz for 300

ms) of high-frequency electrical stimuli (HFS) to the brain. Electroconvulsive shock (ECS) is

HFS of sufficient intensity (i.e. above threshold) to elicit seizure. Seizures consist of aberrant

high-frequency activity in at least seven different muscle groups and over 30 muscle fibers in the

thorax (Kuebler and Tanouye 2000). This seizure-like activity in a particular muscle corresponds

to activity in the motoneuron that innervates it. Seizure is followed by a period of synaptic

failure in the GF pathway (Pavlidis and Tanouye 1995). In this work, seizures were monitored by

DLM activity. Recovery time was assessed as the time required to elicit four consecutive stable

DLM responses following a buzz using a GF stimulation rate of 0.5 Hz.

Molecular mapping of cpoEG1: Plasmid rescue of genomic DNA was used to determine the

approximate insertion site of the P-element in cpoEG1 flies (Wilson et al. 1989). Genomic DNA

TANOUYE--10

(2-5 µg) was digested with EcoRI and fragments were self ligated with T4 DNA ligase. Ligated

products were transformed into XL-1 Blue electrocompetent cells (Stratagene) and the

transformants selected on kanamycin (10 mg/ml) plates. Plasmid DNA from positive clones

(Amp+) was isolated and the genomic fragment DNA sequenced using a primer complementary

to a site near the end of the P-element sequence (CGACGGGACCACCTTATGTTATTT

CATCATG). The exact insertion site was then determined by sequencing back toward the P-

element using a primer specific for the flanking genomic fragment

(GCACGAGACGAGCAGCTA).

Anatomy of the GF system: GF morphology was examined by X-gal staining, utilizing a 2nd

chromosome enhancer trap line P[GAL4]A307 that expresses Gal4 predominantly in the GFs

(Phelan et al. 1996; Allen et al. 1998). Mutant cpo flies were generated with A307 in

heterozygous combination with a 2nd chromosome UAS-lacZ insertion to drive β-galactosidase

expression in the GFs. The nervous systems of these A307/+ UAS-lacZ/+; cpo flies were

dissected in phosphate-buffered saline (PBS) and fixed in 0.5% glutaraldehyde in PBS for 15-30

minutes. These whole-mount preparations were then washed in 0.1% Triton-X 100 in PBS (PBT)

and stored for up to 1 day at 4°C. For β-galactosidase detection, the tissues were equilibrated

with staining solution (5 mM K3Fe(CN)6, 5 mM K3Fe(CN)6, 3 mM MgCl2 in PBT) for 10

minutes at 37°C and then incubated in freshly prepared 0.08% X-gal (5-bromo-4-chloro-3-

indolyl-β-D-galactopyranoside) in staining solution at 37°C for about 2 hours. Following

staining, the tissues were washed twice in PBS and then dehydrated in a 50-100% ethanol series.

The dehydrated tissues were then cleared and mounted using xylenes.

TANOUYE--11

RESULTS

Isolation of the cpoEG1 mutation: The cpoEG1 mutation was identified in a P-element

mutagenesis screen for new seizure-sensitive mutants that utilized sda heterozygotes as a

sensitized genetic background (Zhang et al. 2002). Subsequent mapping and complementation

tests showed that cpoEG1 is an allele of cpo. Behavioral and electrophysiological analysis showed

that cpoEG1 and other cpo alleles differ from canonical members of the bang-sensitive (BS)

paralytic class of Drosophila. The cpo mutations are pleiotropic: seizure-sensitivity is only one of

numerous neurological abnormalities.

Seizure-sensitivity is associated with members of the BS paralytic class of behavioral

mutants including sda (Pavlidis and Tanouye 1995; Kuebler and Tanouye 2000). BS mutants

display a unique behavioral response to mechanical shock, such as a brief vortex. When

subjected to such a mechanical stimulus, BS flies display bouts of hyperactivity, marked by wing

flapping, leg shaking, and abdominal contractions. After a few seconds, this hyperactive episode

gives way to a period of temporary paralysis, in which the fly lies completely motionless for a

time of 30 s to a few minutes depending on genotype (Benzer 1971; Ganetzky and Wu 1982;

Pavlidis et al. 1994). Mutants of the bang-sensitive class include bang-sensitive (bas),

bangsenseless (bss), easily shocked (eas), slamdance (sda), and technical knockout (tko). The eas

gene encodes an ethanolamine kinase, sda encodes an aminopeptidase N, and tko enocodes a

mitochondrial protein (Pavlidis et al. 1994; Zhang et al. 2002; Royden et al. 1987).

Heterozygotes of sda appear to be a useful tool for detecting new seizure-sensitive

mutants. Seizure threshold measured electrophysiologically is 21.0 ± 0.6 V ECS for sda/+ flies,

in-between the threshold for sda homozygotes (6.2 ± 0.8 V ECS) and CS wild type flies (30.1 ±

3.8 V ECS) (J. Tan, personal communication; Kuebler et al. 2001). Following mechanical

TANOUYE--12

stimulation, most sda/+ flies (>98%) exhibit normal behavior, but a few exhibit BS paralysis

(Zhang et al. 2002). Our interpretation from this is that the sda/+ genetic background is

sensitized for seizures indicated especially by the few flies that display BS paralysis. We infer

further that mutations increasing the percentage of flies paralyzed by mechanical stimulation

would indicate new seizure-sensitive mutants. The cpoEG1 mutation was isolated based on this

phenotype: a strain with the apparent genotype cpoEG1/+ sda/+ displayed 33% BS paralysis

following mechanical stimulation. The cpoEG1 mutants were analyzed for BS behavior

independent of the sda mutation. As heterozygotes, cpoEG1/+ flies show no paralysis following

mechanical stimulation. The behavior of cpoEG1 homozygotes could not be tested directly since

cpoEG1 causes recessive lethality.

Molecular and genetic basis of cpoEG1 mutation: The cpoEG1 mutation was mapped by both

molecular and genetic methods. Molecularly, plasmid rescue was used to isolate genomic DNA

flanking the insertion site of the P-element responsible for cpoEG1. This flanking DNA was then

sequenced and compared to the information available in the Drosophila genome database using

the Berkeley Drosophila Genome Project Blast program. This comparison identified the location

of the cpoEG1 insertion within the cpo gene in the 90D1-6 region of the third chromosome (Fig.

1). By sequencing the flanking genomic DNA back towards the P-element, the exact location of

the insertion was identified. The P-element responsible for the cpoEG1 mutation is inserted in an

intron 38-bp upstream of the transcription start site, between nucleotides 12297 and 12298 of

genomic scaffold AE003720 (release 3), corresponding to nucleotides 415 and 416 of the Cpo

61.1 cDNA described in Bellen et al. (1992b).

The location of cpoEG1 is situated between binding sites for several transcription factors

and the transcription start site and appears to be a hot-spot for P-element insertion. At least 10

TANOUYE--13

cpo P-element alleles have been mapped to the same 100-bp region of 90D, especially between

nucleotides 12297 and 12298 where cpoEG1 is inserted. Interestingly, six other cpo alleles share

the exact same insertion site as cpoEG1: alleles cpocp1, cpocp2, cpol2, cpol3, cpol6, and cpov2. The

different insertions produce different phenotypes apparently dependent on size, orientation, and

type (Bellen et al. 1992a,b). The cpocp1 and cpocp2 mutations are hypomorphic 17-kb P[lArB]

insertions that cause adult behavioral defects. The cpov2 mutation is a 10-kb P[lacZ, w+]

insertion that produces no discernible phenotype and is inserted in the opposite orientation

relative to the other alleles. The cpoEG1 mutation appears identical to the recessive lethal

mutations cpol2, cpol3, and cpol6. All are caused by 10-kb P[lacZ, w+] insertions at the exact

same site and all result in homozygous lethality.

Complementation analysis and deficiency and duplication mapping also confirms that the

cpoEG1 mutation is a new allele of cpo. The cpoEG1 mutation fails to complement lethality of cpol2

and cpol∆cp11. The cpo deletion Df(3R)P-14 fails to complement the lethality of cpoEG1.

Conversely, the cpo duplication Tp(3;Y)L58 complements cpoEG1. Furthermore, cpoEG1

phenotypes are reverted to wild-type by precise excision of the P-element, as seen in cpo∆125

flies.

Sequence analysis of the cpo gene: Analysis of the cpo gene sequence reveals three putative

ORFs which encode proteins containing a nuclear localization sequence, an OPA repeat, and a

conserved RNA-recognition motif (RRM) (Bellen et al. 1992b). Between residues 1-193 of Cpo

61.1 protein, cpo possesses a putative bipartite nuclear localization signal suggesting a role for

cpo in the nucleus. This assertion is corroborated by the results of antibody staining, which

shows that Cpo protein is localized to the nucleus (Bellen et al. 1992b). Cpo protein also

contains an OPA repeat between amino acids 194-296, implying a neural role for cpo that is

TANOUYE--14

supported by the behavioral, electrophysiological, and expression phenotypes of cpo (Bellen et

al. 1992b). OPA repeats were first discovered in the neurogenic gene Notch, which is important

for differentiation of the PNS (Wharton et al. 1985). They consist of glutamine dense regions of

CAG and CAA repeats and although their importance is not fully understood, they commonly

appear in neural specific proteins such as Notch. Similar long stretches of glutamine residues are

also common in neural specific genes such as Huntingtin, where they frequently show unstable

expansion to pathological lengths, leading to neurodegenerative disorders (Reddy et al. 1999).

Interestingly, cpo has been linked to the trinucleotide repeat disease spinocerebellar ataxia type 1

(SCA1). Overexpression of cpo enhances a SCA1-induced neurodegeneration phenotype in a

Drosophila model of the disease (Fernandez-Funez et al. 2000).

Cpo protein also contains a single RRM in the 61.1 and 61.2 cDNAs that shows

significant homology (>65% identical residues) to RRM domains in the hermes gene of M.

musculus, G. gallus, and X. laevis; the C. elegans gene, mec-8, and the human gene, RBP-MS

(Gerber et al. 1999; Lundquist et al. 1996; Shimamoto et al. 1996). RRM domains consist of 80-

100 amino acids and are usually present in one to four copies in proteins that bind pre-mRNA,

poly(A) RNA, heterogeneous nuclear RNA (hnRNA), and small nuclear RNA (snRNA). An

individual RRM domain contains two conserved sequences called RNP1 and RNP2, which are

necessary for binding to RNA, and the overall secondary structure β1α1β2β3α2β4, where the

RNP1 and RNP2 sequences correspond to β1 and β3, respectively. Specificity of binding is

conferred by the amino acids in the loop connecting β2 and β3 and by the residues at the termini

of the RRM (Burd and Dreyfuss 1994). Of the genes with homology to the RRM domain of cpo,

hermes and RBP-MS contain a single RRM domain as does cpo, while mec-8 contains two RRM

domains. The hermes protein shows nuclear and cytopolasmic localization and is proposed to

TANOUYE--15

play a role in heart development, possibly by regulating translation or mRNA stability (Gerber et

al. 2002). The mec-8 protein is nuclearly localized and mutants show embryonic lethality and

adult chemosensory and mechanosensory neuronal defects associated with impaired body muscle

attachments, resulting from defective alternative splicing (Lundquist and Herman 1994;

Lundquist et al. 1996). The RBP-MS gene was originally identified in the search for the gene

responsible for the premature aging disease Werner syndrome, which has since been identified

and it is not associated with RBP-MS. At this time, no expression data or function is known for

RBP-MS, but computer simulations support the idea that RBP-MS can bind to RNA

(Sahasrabudhe et al. 1998). Of these genes, mec-8 seems to align most closely with cpo in

expression and phenotype. Both exhibit nuclear localization and both are associated with nervous

system developmental defects. In addition, cpo and mec-8 both possess alanine and glutamine

(AQ) rich regions that are also common in other neural specific proteins with RRM domains,

such as embryonic lethal abnormal vision (elav) and musashi (Lundquist et al. 1996; Robinow et

al. 1986; Nakamura et al. 1994). It should be noted however that the homology of cpo to hermes,

mec-8, and RBP-MS is limited to the RRM domains of these proteins. Regardless, the striking

similarity between the RRM domains of cpo and these genes indicates that they may bind similar

targets and may act in similar pathways. When taken as a whole, the sequence, localization, and

phenotype of cpo seem to indicate an important role for cpo in regulating nervous system

specific transcripts required for proper nervous system function, possibly by mediation of

alternative splicing or RNA export out of the nucleus.

The cpo BS paralytic behavior: Mutants of cpo have been shown to display a number of

behavioral abnormalities including sluggishness, abnormal phototaxis, geotaxis, flight, ether

recovery, and mating vigor (Bellen et al. 1992a; Hall 1994). Here, we show that cpo mutants also

TANOUYE--16

show BS paralytic behavior with viable heteroallelic combinations. We examined especially the

viable genotypes cpoEG1/cpocp1, cpoEG1/cpocp2, cpoEG1/cpov3, cpocp1/cpocp2, cpocp1/cpol2, and

cpocp2/cpol2. We confirmed cpoEG1/cpocp1 and cpoEG1/cpocp2 behavioral abnormalities of

sluggishness, abnormal phototaxis, geotaxis, flight, ether recovery, and mating vigor (data not

shown). Furthermore, we confirmed that cpov3 complements cpo behavioral abnormalities (data

not shown). These are consistent with the observations of Bellen et al. (1992a). The heteroallelic

combinations cpoEG1/cpocp1 and cpoEG1/cpocp2 show BS paralysis in 32% and 18% of flies,

respectively (Fig. 2). In addition, other viable combinations of the cpo alleles tested showed

some degree of paralysis following mechanical stimulation, except for combinations involving

cpov3 (Fig. 2). The ability of the cpov3 allele to complement the paralysis phenotype of cpo

mutants correlates with previous behavioral analysis (Bellen et al. 1992a).

The BS paralysis seen in cpo flies shares some similarities and differences with members

of the BS paralytic class of behavioral mutants. The paralytic phenotype of cpo flies shows

incomplete penetrance, unlike canonical members of the BS paralytic class, such as eas, bss, and

sda, in which 100% of flies paralyze following mechanical stimulation. Paralysis in cpo flies

usually lasts about 25-45 s, during which time the flies lay completely motionless with

occasional slight leg movement. This recovery time is similar to the time required for recovery in

sda, which ranges from 30-60 s, but it is much briefer than the recovery period observed in eas

and bss, which ranges from 60-300 s for both (Zhang et al. 2002). Unlike BS paralytics, which

experience a hyperactive phase during recovery, cpo mutants do not display hyperactivity as they

recover, but instead just right themselves to a standing position and resume normal behavior.

Upon recovery, cpo flies do not exhibit a well-defined refractory period like BS mutants.

Following BS paralysis, cpo mutants do not always re-paralyze, even when tested a day later,

TANOUYE--17

probably owing to the incomplete penetrance of the BS phenotype. Conversely, cpo mutants

that did not paralyze after vortexing, sometimes paralyze when tested later. The incomplete

penetrance of the paralysis phenotype coupled with the potential of all cpo flies to paralyze

suggests that cpo flies have a seizure susceptibility that is close to the threshold for manifestation

of the BS phenotype and that they consequently receive adequate stimulus to paralyze some of

the time, while other times they do not.

cpo flies have increased seizure susceptibility: All mutants showing BS paralytic behavioral

phenotypes, including bss, eas, and sda, have been found to have low seizure thresholds in

electrophysiology experiments. We examined seizure thresholds for cpo mutations in

heteroallelic combinations to examine correlates with the BS behavioral defect. The seizure

threshold here is defined as the minimum voltage required to elicit aberrant high-frequency DLM

motoneuron activity by administration of an electroconvulsive shock (ECS) to the brain of the

fly. However, it should be noted that previous work has shown that seizures are not limited to

the DLMs, but rather involve at least seven different muscle groups and greater than 30 thoracic

motoneurons. A seizure, which appears as intense, high frequency muscle activity, is followed

by a brief period of synaptic failure through the GF pathway during which time brain stimulation

fails to elicit DLM muscle potentials.

The cpoEG1/cpocp1 and cpoEG1/cpocp2 mutants exhibit significant reductions in seizure

threshold, with buzzes of 11.1 ± 3.7 V ECS (n=10) and 13.3 ± 4.8 V ECS (n=7), respectively,

sufficient to elicit seizures (Fig. 3 and Table 1). These values are about two to five times higher

than the other BS mutants, but still approximately two times lower than wild-type, placing cpo

flies in the unique position of being almost exactly intermediate between the known BS mutants

and wild-type with regards to seizure susceptibility. BS mutants have seizure thresholds that

TANOUYE--18

range from 3.2 ± 0.6 V (bss) to 6.2 ± 0.8 V (sda). Wild-type strains do not show seizure activity

until given high-frequency stimuli ranging from 25.5 ± 3.7 V (Berlin) to 39.3 ± 6.6 V (Oregon-

R) (Kuebler et al. 2001). Precise excision of cpoEG1 in cpo∆125 flies reverts the seizure threshold

to a wild-type level of 29.0 ± 4.5 V ECS (n=10). This intermediacy in seizure threshold

correlates with the BS paralytic behavior of cpo mutants, which shows only ~30% penetrance

compared with the 100% penetrance seen in the known BS mutants.

The seizures in cpo flies appear qualitatively similar to those observed in other BS

mutants with a few quantitative differences. Seizures in cpo flies exhibit the three phases that

are characteristic of Drosophila seizures: initial seizure, synaptic failure, and recovery seizure.

These three phases of seizure in cpo mutants differ quantitatively from those seen in other

genotypes as would be expected since each of these characteristics is genotype dependent. The

maximum response frequency during the initial seizure is reduced in cpo flies compared to other

BS mutants. In cpo flies, the maximum response frequency during the seizure usually ranges

between 20-40 Hz, whereas in other BS mutants the frequency can often approach 100 Hz. This

frequency reduction scales with the impaired following frequency of the DLMs in cpo flies,

which probably limits the attainable muscle firing frequency during seizure. The recovery period

following seizure in cpo flies is consistent with the durations seen in other BS mutants.

cpoEG1/cpocp1 and cpoEG1/cpocp2 flies show recovery times of 83.2 ± 23.8 s (n=5) and 98.6 ± 15.0

s (n=7), respectively, which is longer than the 48.9 ± 5.4 s recovery for eas and shorter than the

136 ± 6 s recovery for bss (J. Tan, personal communication). These recovery periods are

decidedly longer than the 29.9 ± 1.6 s recovery for wild-type Canton-S flies (J. Tan, personal

communication) and the 34.4 ± 7.2 s (n=5) and 39.1 ± 5.5 s (n=10) recovery times for cpoEG1/+

and cpo∆125/cpo∆125 flies, respectively. Also similar to other BS mutants, cpo flies always exhibit

TANOUYE--19

recovery seizures following synaptic failure. Finally, the decreased seizure threshold of cpo

mutants is not accompanied by a change in GF response threshold, a phenomenon also observed

in BS mutants (Fig. 3).

cpo acts as an enhancer of seizure mutation: The cpoEG1/+ mutation was identified based on

genetic interaction with the BS paralytic mutation sda. We examined some general features of

this interaction. In the behavioral screen that identified cpoEG1, this allele was found to function

as a dominant enhancer of the sda/+ BS paralytic phenotype. That is, about 33% of cpoEG1/+

sda/+ double heterozygotes showed BS paralysis (n=425), a substantially greater number than

sda/+ and cpoEG1/+ parentals, about 1% (n=257) and 0% (n=71), respectively. We examined the

possibility that other cpo alleles also act as enhancers. The double heterozygote cpol2/+ sda/+

showed about 44% BS paralysis (n=119). The double heterozygote cpocp1/+ sda/+ showed about

75% BS paralysis (n=93). We examined the possibility that cpoEG1 can enhance other BS

mutations by testing for interaction with eas. The double heterozygote eas/+; cpoEG1/+ showed

about 7% BS paralysis (n=149), greater than for the eas/+ parental that shows 0% BS paralysis

(n=103).

Interaction between cpo and sda is also observed in seizure threshold measured

electrophysiologically. We have shown previously that seizure threshold for sda/+ heterozygotes

is 21.0 ± 0.6 V ECS (J. Tan, personal communication). The cpoEG1 allele acts as a dominant

enhancer of seizure susceptibility: the cpoEG1/+ sda/+ double heterozygote has a seizure

threshold of 14.4 ± 3.1 V ECS (n=10). The cpocp1 allele also acts as a dominant enhancer of

seizure susceptibility: the cpocp1/+ sda/+ double heterozygote has a seizure threshold of 11.8 ±

1.6 V ECS (n=9). Excision of the P-element in cpoEG1 eliminates the sda enhancement

phenotype restoring the seizure threshold to 20.3 ± 1.1 V ECS (n=10) in cpo∆125/+ sda/+ flies.

TANOUYE--20

cpo flies exhibit synaptic defects in the GF system: Mutants of cpo show alterations in

GF-TTM response, but the basis for this defect is not known. In wild-type, this response is via a

monosynaptic pathway and has a characteristically short latency that is stable at high frequencies

of stimulation. In cpo mutants, this short latency response is replaced by a longer latency GF-

TTM response that cannot follow even moderate frequencies of stimulation. This appears to be

due to an alteration in the GF-TTM neurocircuit in the mutant. Possibilities for such a

neurocircuit alteration include, for example: a) an action potential conduction abnormality in the

GF, b) a synaptic transmission defect between the GF and the TTM motoneuron, c) an action

potential conduction abnormality in the TTM motoneuron, d) a synaptic transmission defect at

the TTM neuromuscular junction (nmj), or e) some other, more complex neurocircuit alteration.

The abnormality in the GF-TTM pathway does not appear to be due to the TTM motoneuron or

the TTM nmj. This is indicated by direct electrical stimulation of the TTM motoneuron showing

that the cpo mutant response is similar to wild-type in latency and following frequency. The

latency of the TTM response following direct motoneuron stimulation for cpoEG1/cpocp1 is about

0.4 ms, which is similar to the CS wild-type latency of 0.66 ± 0.05 ms (Tanouye and Wyman

1980). The following frequencies of the TTM response following direct motoneuron stimulation

for cpoEG1/cpocp1 and CS are both greater than 100 Hz. The defect in the GF-TTM pathway is

probably not due to an action potential conduction abnormality of the GF. This is inferred from

an examination of the GF-DLM response in cpo mutants which is normal in latency and although

measurably impaired in following frequency, is markedly less impaired than the GF-TTM

response (Fig. 4 and Table 1). From this we infer that the latency abnormality of the GF-TTM

response is not due to the GF, which is common to both pathways. The latency abnormality and

at least a portion of the following frequency defect must occur after the GF pathways to the TTM

TANOUYE--21

and DLM diverge. The implication from these observations is that the defect for the GF-TTM

response occurs distal to the GF and proximal to the TTM motoneuron, that is, most likely the

synapse connecting the GF with the TTM motoneuron. Examination of GF anatomy in

cpoEG1/cpocp1 flies reveals no gross morphological abnormalities. In cpo flies, the GF appears to

make the proper lateral bend in the mesothoracic neuromere to contact the TTMn (data not

shown).

The GF-TTM synapse has been shown previously to be a bi-functional synapse with a

component that transmits electrically via gap junction and a component that transmits via

chemical transmitter (Blagburn et al. 1999). It is difficult from these experiments to determine

whether it is the electrical or chemical component that carries the cpo mutant defect. However, in

the GF-DLM pathway, there is a clearer separation of central synapses that transmit electrically

(i.e. the synapse between the GF and the PSI neuron) and chemically (i.e. the synapse between

the PSI and the DLM motoneuron). The cpo mutant shows a following frequency defect in the

GF-DLM pathway due to some labile site along the transmission pathway. We identified the

probable location of this labile site. The defect in the GF-DLM pathway does not appear to be

due to the DLM motoneuron or the DLM nmj. This is indicated by direct electrical stimulation of

the DLM motoneuron showing that the cpo mutant response is similar to wild-type in latency

and following frequency. The latency of the DLM response following direct motoneuron

stimulation for cpoEG1/cpocp1 is about 0.6 ms, which is similar to the CS wild-type latency of 0.83

± 0.06 ms (Tanouye and Wyman 1980). The following frequencies of the DLM response

following direct motoneuron stimulation for cpoEG1/cpocp1 and CS are both greater than 100 Hz.

The defect in the GF-DLM pathway does not appear to be due to GF action potential conduction,

the synapse between the GF and the PSI neuron, or PSI action potential conduction. This is

TANOUYE--22

inferred from comparison of the GF-DLM4 response with the GF-DLM5 response. DLM4 and

DLM5 are innervated by different motoneurons that receive independent synaptic connections

from a single PSI interneuron (King and Wyman 1980; Tanouye and Wyman 1980). That is, the

GF pathway to DLM4 diverges from the pathway to DLM5 at the PSI to DLM motoneuron

synapse (Fig. 4). We assumed that if the cpo mutant labile site occurs after pathway divergence,

transmission to the two DLM fibers will fail and recover independently. Conversely, we assumed

that if the labile site is a circuit element common to the two muscle fibers, that is, prior to

pathway divergence, transmission to the two DLM fibers would not fail or recover

independently. From this, we propose that the defect in the GF-DLM pathway is distal to the PSI

since the GF-DLM4 response and the GF-DLM5 response fail independently. That is, in

cpoEG1/cpocp2 mutants responses in both the DLM4 pathway and DLM5 pathway fail at about 14

± 4.8 Hz. During the period of stimulation when failures are occurring, a trace-by-trace

comparison reveals that usually, DLM4 and DLM5 responses fail together. However,

occasionally, an individual stimulus will drive a DLM4 response, but a failure in DLM5; another

individual stimulus might occasionally show the opposite, a DLM4 failure coupled with a DLM5

response (Fig. 5). These occasional stimuli indicate that DLM4 and DLM5 responses are capable

of failing independently. A trace-by-trace analysis of the recovery period shows that the

responses also recover independently. As control, we compared failure of GF-DLM5 response

with the GF-DLM6 response. DLM5 and DLM6 are innervated by a single motoneuron, usually

called motoneuron DLM5/6 (Harcombe and Wyman 1977; Tanouye and Wyman 1980; King and

Wyman 1980). Unlike other DLM pathways, the GF-DLM5 pathway does not diverge from the

GF-DLM6 pathway until the nmj. In cpoEG1/cpocp2 mutants responses in both the DLM5 pathway

and DLM6 pathway fail at about 14 ± 4.8 Hz. However, during the period of stimulation when

TANOUYE--23

failures are occurring, a trace-by trace comparison reveals that responses in the two DLM fibers

never fail independently. That is, every time a DLM5 response is seen, a response is always also

seen in DLM6. Every time there is a failure of the DLM5 response, there is also a failure of the

DLM6 response (Fig. 5). A trace-by-trace analysis of the recovery period shows that the

responses also do not recover independently. Our interpretation is that the labile site is the

synapse between the PSI and the DLM5/6 motoneuron, a circuit element that is common in the

pathway to the two muscle fibers. From these combined results, we infer that the labile site in the

GF-DLM pathway lies distal to the PSI and proximal to the DLM motoneuron, that is, most

likely the synapse between the PSI and the DLM motoneuron.

In sum, the GF neurocircuit apparently carries an alteration in the bi-functional synapse

connecting the GF with the TTM motoneuron that causes an increase in transmission latency and

a severe lability with transmission failure rapidly occurring with repeated stimulation. The GF

neurocircuit apparently also carries a moderate alteration in the synapse connecting the PSI with

the DLM motoneuron that causes a small change in following frequency without a change in

transmission latency.

Interestingly, cpo flies still retain the ability to jump when exposed to a light-off stimulus,

despite having a dysfunctional GF to TTM motoneuron connection. The TTM is the primary

jump muscle in the fly and is driven by the GF in response to a light-off stimulus. For a wild-

type fly, a light-off stimulus elicits an escape jump. However, some mutants with defective

TTM pathways, such as bendless (ben), are unable to jump in response to visual stimuli. In ben

flies, the GF fails to make the terminal bend to connect to the TTM motoneuron (Thomas and

Wyman 1982). The TTM in ben flies exhibits a long latency response of ~2.3 ms and a following

frequency of less than 1 Hz (Thomas and Wyman 1984; Oh et al. 1994). Although the cpo

TANOUYE--24

electrophysiological phenotype resembles ben in its TTM following frequency and latency

defects, the nature of the GF to TTM motoneuron synaptic defects in cpo flies must not be severe

enough to totally inhibit GF-driven jump behavior.

TANOUYE--25

DISCUSSION

Discovery of a new cpo allele: Several observations show that the cpoEG1 mutation is a new

recessive lethal allele of cpo. Genetically, the lethal cpo alleles l2 and l∆cp11 fail to complement

the recessive lethality of cpoEG1, as well as a deficiency with cpo deleted. However, the lethality

of cpoEG1 is rescued by replacement of the cpo gene region using a duplication line.

Behaviorally, cpoEG1 mutants show defects, such as overall sluggishness and lethargy, consistent

with previously characterized cpo mutants when put in heteroallelic combinations with viable

cpo mutants. The cpoEG1/cpocp1 and cpoEG1/cpocp2 flies also show BS paralysis that is shared by

other heteroallelic combinations without cpoEG1, such as cpocp1/cpocp2 and cpocp1/cpol2.

Electrophysiologically, cpoEG1 mutants manifest seizure susceptibility increases and giant fiber

synaptic defects when put in heteroallelic combination with cpocp1 and cpocp2. These

abnormalities are not seen in cpoEG1, cpocp1, and cpocp2 heterozygotes. Molecularly, comparison

to the Drosophila genome database of the genomic DNA flanking the cpoEG1 insertion uniquely

identifies the location of cpoEG1 as being at 90D in an intron of cpo at a site shared by several

other previously characterized alleles of cpo.

P-element insertions in cpo show complex genetic interactions: Of the numerous P-element

alleles of cpo, at least seven (EG1, cp1, cp2, l2, l3, l6, and v2) are inserted at exactly the same

site in an intronic region of cpo but with differing phenotypic consequences, thought to be due to

differences in P-element type, size, and orientation. The existence of multiple independent alleles

resulting from insertion of a transposable element in the exact same location is not a novel

phenomenon. Several examples are known, such as at the white locus, the singed locus, and the

ovo locus (O’Hare and Rubin 1983; Roiha et al. 1988; Dej et al. 1998). In addition, P-elements

TANOUYE--26

do not insert randomly, but show preference for euchromatic sites, the 5’-ends of genes, and GC

rich 8-bp target sequences that provide appropriate DNA secondary structure (Liao et al. 2000).

The seven P-element insertions between nucleotides 1229712298 meet each of these criteria:

they are inserted in euchromatin in the 5’ region of cpo next to an 8-bp target sequence of

GTTCAGGC, which closely approximates the sequence GTCCGGAC shown to be preferred by

P-elements (Liao et al. 2000).

P-element insertions in cpo exhibit complex genetic interactions. Most interestingly, the

P-elements inserted between 1229712298 show different phenotypes based on their type and

size. Previously, Bellen et al. noted that 17-kb P[lArB] insertions (cpocp1 and cpocp2) at this site

yield viable flies with adult behavioral defects (1992b). In contrast, flies with 10-kb P[lacZ, w+]

insertions in the same location (cpol2, cpol3, and cpol6) behave as recessive lethals (Bellen et al.

1992b). Bellen et al. also documented that the cpocp1 and cpocp2 alleles partially complement the

lethal cpol2, cpol3, and cpol6 alleles producing viable heteroallelic flies with behavioral defects

(1992a). Differences in phenotype due to the type of transposable element have also been

documented at the Notch locus, where different types of transposon insertions within a 3-bp span

result in different eye and wing phenotypes (Kidd and Young 1986). This implies that the

phenotypic differences between the P[lArB] and P[lacZ, w+] insertions in cpo may reflect the

unique properties of the P-elements themselves according to mechanisms we do not fully

understand yet. Interestingly, an oppositely-oriented 10-kb P[lacZ, w+] insertion 8-bp

downstream at 1230512306 (cpov3) is not lethal but produces viable adults with behavioral

defects similar to the P[lArB] insertions. Surprisingly, this insertion fully complements other

alleles of cpo (Bellen et al. 1992a,b), including the BS paralytic behavior associated with cpoEG1.

Bellen et al. hypothesized that this intragenic complementation may result from disrupted

TANOUYE--27

somatic pairing of the chromosomes in heterozygous flies leading to complex transvection-like

phenomena (1992a). Clearly, the genetic interactions of P-elements at the cpo locus show an

uncommon degree of complexity depending on the nature of the individual P-element alleles.

Of the alleles examined in this study, the cpoEG1 allele appears most similar to cpol2 (and

presumably to cpol3 and cpol6 which were unavailable for this study). Both cpoEG1 and cpol2

exhibit homozygous lethality due to insertions of the same P[lacZ, w+] element in the same

location at 1229712298. Both also yield viable progeny with bang-sensitive paralytic defects in

heteroallelic combinations with cpocp1 and cpocp2. Therefore, the cpoEG1 mutation and the alleles

examined in this study apparently form the allelic series: cpol∆cp11 > cpoEG1 ≥ cpol2 > cpocp1 ≥

cpocp2 (see Fig. 2).

cpo mutants display complex neurological deficits resembling human pathologies: The

neurological phenotypes of cpo are complex, perhaps more complex than any other behavioral

mutant described for Drosophila. Previous descriptions have noted a number of behavioral

phenotypes including sluggishness, abnormal phototaxis, geotaxis, flight ability, ether recovery,

and mating vigor (Bellen et al. 1992a; Hall 1994). In this study, we describe in detail additional

abnormalities: BS paralytic behavior, seizure-sensitivity, and synaptic transmission defects in the

GF circuit. The BS paralytic behavior and seizure-sensitivity phenotypes of cpo invite

comparisons with other BS mutants. Unlike cpo mutants, the canonical BS mutants, such as sda,

eas, and bss, usually show completely normal behavior: walking, flying, eating, mating, and

grooming activities are all normal. However, in response to mechanical stimulation, the

canonical BS mutants all show 100% paralysis unlike cpo mutants that show only ~30%

paralysis. Thus, the canonical BS mutants show far fewer overall abnormalities than cpo, but the

TANOUYE--28

paralytic defect itself is far more extreme. In addition, although canonical BS mutants show far

fewer neurological syndromes and no GF synaptic defects, they are much more sensitive to

seizures than cpo flies. The seizure threshold for cpo flies is 11-14 V ECS, whereas seizure

thresholds for canonical BS mutants are 3-7 V ECS.

The GF system phenotypes of cpo invite comparisons with other GF system mutants. The

canonical GF system mutants are bendless (ben) and passover (pas). Unlike cpo mutants, the

canonical GF system mutants usually show relatively normal behavior. The pas mutant shows a

weak leg-shaking behavioral defect under ether anesthesia and ben shows a photochoice

behavioral phenotype in choosing visible over UV light, as well as some lethargy. However, both

ben and pas show an extreme GF-system behavioral defect: they cannot mount an escape jump

response to a lights-off visual stimulus. Interestingly, cpo mutants do show escape jump

behavior. GF system synaptic defects also appear more extreme for canonical mutants than for

cpo. While cpo DLMs only have following frequency deficits, pas flies are incapable of any GF-

driven DLM responses. Similar to cpo mutants, pas and ben flies have abnormal TTM responses

marked by long latencies and following frequencies below 1 Hz. However, the TTM latency

defect in ben flies is more severe than cpo flies with a latency of 2.3 ms (Thomas and Wyman

1984; Oh et al. 1994). In addition, the ben GFs fail to bend to contact the TTMn in the

mesothoracic neuromeres, whereas, cpo GFs appear to bend normally. Interestingly, mutants of

Shak-B2, an allele of pas, show an extremely high seizure threshold at 94.7 ± 10.2 V ECS

(Kuebler et al. 2001). In addition, the Shak-B2 mutation is a potent suppressor of seizures. Both

of these characteristics set apart Shak-B2 flies as distinct from cpo mutants, which have lowered

seizure thresholds and behave as enhancers of seizure. Thus, the canonical GF system mutants

TANOUYE--29

show far fewer overall abnormalities than cpo, but the GF system-specific defects are more

extreme.

Although the complex neurological phenotype of cpo mutants makes it difficult to assign

them to a particular mutant class, it also makes them a more realistic model of neurological

disorders in humans and mice which tend to be more pleiotrophic. In humans, epilepsy is often

one of a set of symptoms found in people with diseases such as cerebral palsy,

neurofibromatosis, autism, tuberous sclerosis, and Landau-Kleffner syndrome. In each of these

human diseases, seizures are one of a number of other neurological disorders comprising the

disease (Frazin 2001). Numerous mouse models of epilepsy also exhibit additional neurological

conditions. Some examples include lethargic and quaking mice. The lethargic mouse exhibits

absence epilepsy accompanied by ataxia, hypoactivity, paroxysmal dyskinesis, and reduced

conduction velocity and prolonged distal latency in peripheral motor nerves (Herring et al. 1981;

Khan and Jinnah 2002). The quaking mouse exhibits tonic-clonic seizures accompanied by

generalized tremors and hypomyelination defects (Hogan and Greenfield 1984). Interestingly,

the deficits in quaking mice result from a defective RNA-binding protein that regulates nuclear

export of myelin basic protein mRNA (Larocque et al. 2002). Thus, the defects in cpo mutants

seem to approximate pathologies common in more complex organisms.

A role for cpo in regulating nervous system function: Several possibilities exist for how cpo

regulates proper nervous system function and seizure susceptibility. Because of its localization to

the nucleus, the interaction of cpo with RNA may involve participation in splicing or export of

transcripts out of the nucleus. Possibly cpo regulates proper nervous system function by altering

the balance of transcripts involved with neuronal excitation and inhibition via one of these

TANOUYE--30

processes. Several animal models with defects in nuclear export of transcripts and splicing

display neuronal excitability defects. Some examples include the previously mentioned quaking

mice, which exhibit defects resulting from a mutation affecting the RNA-binding protein QKI,

which regulates nuclear export of myelin basic protein (MBP) mRNA (Larocque et al. 2002;

Hogan and Greenfield 1984). Another example is seen in Nova-1 mice, which display

progressive motor dysfunction, marked by action-induced tremor and overt motor weakness,

culminating in death 7-10 days after birth (Jensen et al. 2000). These defects in Nova-1 mice

result from deletion of the RNA-binding protein, Nova-1, which regulates alternative splicing of

neural specific pre-mRNAs, such as the inhibitory GABAA receptor γ2 pre-mRNA (Dredge and

Darnell 2003). The NOVA family of RNA-binding proteins were first identified as the target

antigens in the human disease paraneoplastic opsoclonus myoclonus ataxia, a neurological

disorder characterized by loss of inhibitory control of motor neurons in the spinal cord and

brainstem (Musunuru and Darnell 2001). The examples of cpo, quaking, and Nova-1 show that

mutation of RNA-binding proteins can have serious consequences for nervous system function

and behavior.

Although the exact mechanism underlying the seizure susceptibility of cpo flies is

unknown, some possible explanations for the altered seizure threshold in cpo mutants seem

unlikely. Because of the unchanged GF threshold of cpo flies and their overall sluggish

demeanor, increased overall neuronal excitability as an explanation for the seizure sensitivity of

cpo mutants appears as an untenable hypothesis. One explanation for a decreased seizure

threshold could be that the neurons in cpo mutants are hyperexcitable with a lowered stimulation

threshold, which would allow for abnormal supernumerary recruitment of neurons upon

administration of an electrical buzz, facilitating the temporal and spatial summation known to

TANOUYE--31

occur in seizures. At least in the case of the GF interneuron, a decreased neuronal stimulation

threshold is not observed in cpo flies. However, this does not exclude the possibility that other

unexamined neurons critical for seizure genesis in the cpo nervous system are hyperexcitable

with decreased thresholds for stimulation. It should also be noted that seizures are not GF-driven

since they can never be elicited at the GF threshold voltage level. Thus, recruitment of other

unidentified neurons is required for seizure manifestation. In addition, cpo flies do not seem to

be good candidates for exhibiting increased temporal summation as is characteristic of seizures.

Their severely decreased following frequencies would be expected to hamper the ability of their

nervous system to temporally summate neuronal responses because they occur with lesser

frequency. Because increased excitatory character does not appear responsible for the increased

seizure susceptibility of cpo flies, maybe they exhibit unidentified deficits in inhibition, which

could hinder their nervous system’s ability to resist seizure following insult.

We thank Hugo Bellen for supplying alleles of cpo and for his insight and advice. We thank Rod

Murphey for providing the A307 enhancer trap line. We thank Pejmun Haghighi for performing

some crucial pilot experiments. We also thank fellow lab members for their guidance and wise

counsel, especially Daria Hekmat-Scafe, Jeff Tan, Juan Song, and Sang-Ohk Shim. This work

was supported by a National Institutes of Health (NIH) research grant and an Epilepsy

Foundation grant to M.T.

TANOUYE--32

LITERATURE CITED

Allen, M.J., J.A. Drummond and K.G. Moffat, 1998 Development of the giant fiber neuron of

Drosophila melanogaster. J. Comp. Neurol. 397: 519-531.

Ambros, V., 2001 MicroRNAs: tiny regulators with great potential. Cell 107: 823-826.

Bellen, H.J., S. Kooyer, D. D’Evelyn and J. Pearlman, 1992 The Drosophila couch potato

protein is expressed in nuclei of peripheral neuronal precursors and shows homology to RNA-

binding proteins. Genes Dev. 6: 2125-2136.

Bellen, H.J., H. Vaessin, E. Bier, A. Kolodkin, D. D’Evelyn et al., 1992 The Drosophila couch

potato gene: an essential gene required for normal adult behavior. Genetics 131: 365-375.

Benzer, S., 1971 From the gene to behavior. J. Am. Med. Assoc. 218: 1015-1022.

Blagburn, J.M., H. Alexopoulos, J.A. Davies, and J.P. Bacon, 1999 Null mutation in shaking-B

eliminates electrical, but not chemical, synapses in the Drosophila giant fiber system: a structural

study. J. Comp. Neurol. 404: 449-458.

Burd, C.G. and G. Dreyfuss, 1994 Conserved structure and diversity of functions of RNA-

binding proteins. Science 265: 614-621.

TANOUYE--33

Dredge, B.K. and R.B. Darnell, 2003 Nova Regulates GABAA Receptor γ2 alternative splicing

via a distal downstream UCAU-rich intronic splicing enhancer. Mol. Cell Bio. 23: 4687-4700.

Fernandez-Funez, P., M.L. Nino-Rosales, B. de Gouyan, W. She, J.M. Luchak et al., 2000

Identification of genes that modify ataxin-1-induced neurodegeneration. Nature 408: 101-106.

Frazin, N., 2001 Seizures and Epilepsy: Hope Through Research. Department of Health and

Human Services, National Institutes of Health, National Institute of Neurological Disorders and

Stroke, Bethesda, MD, NIH Publication No. 00-156.

Ganetzky, B. and C.-F. Wu, 1982 Indirect suppression involving behavioral mutants with altered

nerve excitability in Drosophila melanogaster. Genetics 100: 597-614.

Gerber, W.V., S.A. Vokes, N.R. Zearfoss and P.A. Krieg, 2002 A role for the RNA-binding

protein, hermes, in the regulation of heart development. Dev. Biol. 247:116-26.

Gerber, W.V., T.A. Yatskievych, P.B. Antin, K.M. Correia, R.A. Conlon et al., 1999 The RNA-

binding protein gene, hermes, is expressed at high levels in the developing heart. Mech. Dev. 80:

77-86.

Hall, J.C., 1994 The mating of a fly. Science 264: 1702-1714.

TANOUYE--34

Harcombe, E.S. and R.J. Wyman, 1977 Output pattern generation by Drosophila flight

motoneurons. J. Neurophys. 40: 1066-1077.

Herring, J.M., H.C. Dung, J.H. Yoo and J. Yu, 1981 Chronological studies of peripheral motor

nerve conduction in ‘lethargic’ mice. Electromyogr. Clin. Neurophysiol. 21: 121-134.

Hogan, E.L. and S. Greenfield, 1984 Animal models of genetic disorders and myelin. Myelin

489-534.

Ikeda, K., J.H. Koenig and T. Tsuruhara, 1980 Organization of identified axons innervating the

dorsal longitudinal flight muscle of Drosophila melanogaster. J. Neurocytol. 9: 799-823.

Jensen, K.B., K. Musunuru, H.A. Lewis, S.K. Burley and R.B. Darnell, 2000 The tetranucleotide

UCAY directs the specific recognition of RNA by the Nova K-homology 3 domain. Proc. Natl.

Acad. Sci. 97: 5470-5475.

Jensen, K. B., B. K. Dredge, G. Stefani, R. Zhong, R. J. Buckanovich et al., 2000 Nova-1

regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25:

359-371.

Khan, Z. and H.A. Jinnah, 2002 Paroxysmal dyskinesias in the lethargic mouse mutant. J.

Neurosci. 22: 8193-8200.

TANOUYE--35

Kidd, S. and M.W. Young, 1986 Transposon-dependent mutant phenotypes at the Notch locus of

Drosophila. Nature 323: 89-91.

Kiger, A.A., S. Gigliotti, S. and M.T. Fuller, 1999 Developmental genetics of the essential

Drosophila nucleoporin nup154: allelic differences due to an outward-directed promoter in the P-

element 3’ end. Genetics 153: 799-812.

King, D.G. and R.J. Wyman, 1980 Anatomy of the giant fibre pathway in Drosophila. I. Three

thoracic components of the pathway. J. Neurocytol. 9: 753-770.

Kuebler, D. and M.A. Tanouye, 2000 Modifications of seizure susceptibility in Drosophila. J.

Neurophysiol. 83: 998-1009.

Kuebler, D., H. Zhang, X. Ren and M.A. Tanouye, 2001 Genetic suppression of seizure-

susceptibility in Drosophila. J. Neurophysiol. 86: 1211-1225.

Larocque, D. J. Pilotte, T. Chen, F. Cloutier, B. Massie et al., 2002 Nuclear retention of MBP

mRNAs in the quaking viable mice. Neuron 36: 815-829.

Liao, G., E.J. Rehm and G.M. Rubin, 2000 Insertion site preferences of the P transposable

element in Drosophila melanogaster. Proc. Natl. Acad. Sci. 97: 3347-3351.

TANOUYE--36

Liu, W., J. Seto, G. Donovan and M. Toth, 2002 Jerky, a protein deficient in a mouse epilepsy

model, is associated with translationally inactive mRNA in neurons. J. Neurosci. 22: 176-182.

Lundquist, E.A. and R.K. Herman, 1994 The mec-8 gene of Caenorhabditis elegans affects

muscle and sensory neuron function and interacts with three other genes: unc-52, smu-1 and

smu-2. Genetics 138: 83-101.

Lundquist, E.A., R.K. Herman, T.M. Rogalski, G.P. Mullen, D.G. Moerman et al., 1996 The

mec-8 gene of C. elegans encodes a protein with two RNA recognition motifs and regulates

alternative slicing of unc-52 transcripts. Development 122: 1601-1610.

Musunuru, K. and R. B. Darnell, 2001 Paraneoplastic neurologic disease antigens: RNA-binding

proteins and signaling proteins in neuronal degeneration. Annu. Rev. Neurosci. 24: 239-262.

Nakamura, M., H. Okano, J. Blendy and C. Montell, 1994 Musashi, a neural RNA-binding

protein required for Drosophila adult external sensory organ development. Neuron 13: 67-81.

Oh, C.E., R. McMahon, S. Benzer and M.A. Tanouye, 1994 bendless, a Drosophila gene

affecting neuronal connectivity, encodes a ubiquitin-conjugating enzyme homolog. J. Neurosci.

14: 3166-3179.

O’Hare, K. and G.M. Rubin, 1983 Structures of P transposable elements and their sites of

insertion and excision in the Drosophila melanogaster genome. Cell 34: 25-35.

TANOUYE--37

Pavlidis, P., M. Ramaswami and M.A. Tanouye, 1994 The Drosophila easily shocked gene: a

mutation in a phospholipids pathway causes seizure, neuronal failure, and paralysis. Cell 79: 23-

33.

Pavlidis, P. and M.A. Tanouye, 1995 Seizures and failures in the giant fiber pathway of

Drosophila bang-sensitive paralytic mutants. J. Neurosci. 15: 5810-5819.

Perrone-Bizzozero, N. and F. Bolognani, 2002 Role of HuD and other RNA-binding proteins in

neural development and plasticity. J. Neurosci. Res. 68: 121-126.

Phelan, P., L.A. Stebbings, R.A. Baines, J.P. Bacon, J.A. Davies et al., 1996 Mutations in

shaking-B prevent electrical synapse formation in the Drosophila giant fiber system. J. Neurosci.

16: 1101-1113.

Reddy, P.H., M. Williams and D.A. Tagle, 1999 Recent advances in understanding the

pathogenesis of Huntington’s disease. Trends Neurosci. 22: 248-255.

Robinow, S., A.R. Campos, K.M. Yao and K. White, 1988 The elav gene product of Drosophila,

required in neurons, has three RNP consensus motifs. Science 242: 1570-1572.

Roiha, H., G.M. Rubin and K. O’Hare, 1988 P element insertions and rearrangements at the

singed locus of Drosophila melanogaster. Genetics 119: 75-83.

TANOUYE--38

Royden, C., V. Pirrotta and L. Jan, 1987 The tko locus, site of a behavioral mutation in D.

melanogaster, codes for a protein homologous to prokaryotic ribosomal protein S12. Cell 51:

165-173.

Sahasrabudhe, P.V., R. Tejero, S. Kitao, Y. Furuichi and G.T. Montelione, 1998 Homology

modeling of an RNP domain from a human RNA-binding protein: homology-constrained energy

optimization provides a criterion for distinguishing potential sequence alignments. PROTEINS

33: 558-566.

Schweers, B.A., K.J. Walters and M. Stern, 2002 The Drosophila melanogaster translational

repressor pumilio regulates neuronal excitability. Genetics 161: 1177-1185.

Shimamoto, A., S. Kitao, K. Ichikawa, N. Suzuki, Y. Yamabe et al., 1996 A unique human gene

that spans over 230 kb in the human chromosome 8p11-12 and codes multiple family proteins

sharing RNA-binding motifs. Proc. Natl. Acad. Sci. 93: 10913-10917.

Tanouye, M.A. and R.J. Wyman, 1980 Motor outputs of giant nerve fiber in Drosophila. J.

Neurophysiol. 44: 405-421.

Thomas, J.B. and R.J. Wyman, 1982 A mutation in Drosophila alters normal connectivity

between two identified neurons. Nature 298: 650-51.

TANOUYE--39

Thomas, J.B. and R.J. Wyman, 1984 Mutations altering synaptic connectivity between identified

neurons in Drosophila. J. Neurosci. 4: 530-538.

Trimarchi, J.R. and R.K. Murphey, 1997 The shaking-B2 mutation disrupts electrical synapses in

a flight circuit in adult Drosophila. J. Neurosci. 17: 4700-4710.

Wharton, K.A., B. Yedvobnick, V.G. Finnerty and S. Artavanis-Tsakonas, 1985 opa: a novel

family of transcribed repeats shared by the Notch locus and other developmentally regulated loci

in D. melanogaster. Cell 40: 55-62.

Wilson, C., R. Pearson, H. Bellen, C. O’Kane, U. Grossniklaus et al., 1989 P-element mediated

enhancer detection: an efficient method for isolating and characterizing developmentally

regulated genes in Drosophila. Genes Dev. 3: 1301-1313.

Wreden, C., A.C. Verotti, J.A. Schisa, M.E. Lieberfarb and S. Strickland, 1997 Nanos and

pumilio establish embryonic polarity in Drosophila by promoting posterior deadenylation of

hunchback mRNA. Development 124: 3015-3023.

Wu, J.I., R.B. Reed, P.J. Grabowski and K. Artzt, 2002 Function of quaking in myelination:

regulation of alternative splicing. Proc. Natl. Acad. Sci. 99: 4233-4238.

TANOUYE--40

Zhang, H., J. Tan, E. Reynolds, D. Kuebler, S. Faulhaber et al., 2002 The Drosophila slamdance

gene: a mutation in an aminopeptidase can cause seizure, paralysis and neuronal failure. Genetics

162: 1283-1299.

Figure 1. The cpo locus at 90D on chromosome III. The cpo locus at 90D1-6 is large

and complex, spanning >100 kb and encoding three different messages: cpo 61.1 (3.4

kb), cpo 61.2 (2.5 kb), and cpo 17 (3.0 kb). For simplicity, only the transcript

corresponding to cDNA 61.1 is shown above; the mutations described here apparently

only affect this transcript (Bellen et al. 1992b). The exons are represented as numbered

boxes. The black filled boxes correspond to untranslated exons, while the crosshatched

boxes correspond to protein-coding exons. The relationship of cpo 61.1 to the

corresponding nucleotide numbers in genomic scaffold AE003720 (release 3) is indicated

below the splicing diagram. All of the alleles examined in this study are P-element

insertions in the promoter region of transcript 61.1 just 5’ to exon 1. Interestingly, the cpo

alleles EG1, l2, cp1, and cp2 are all inserted at the same site between nucleotides 12297

and 12298 on scaffold AE003720. The v3 allele is a P-element insertion 8-nt 3’ of the

other alleles. All of these insertions are positioned between enhancer-like sequences and

1 2 3 4 5 6 7 8 9

12335 84022

AE003720

10 kb

TAA GTTCAGGC GATTTGGATTCGGATCGGGCTTCAGATTCA

EG1, l2, cp1, cp2 v3

5’ 3’ v v v v

the transcription start site for cpo 61.1 at 12335 (the transcription start site is indicated as

a large bold A in the expanded portion). This region has been shown to contain most of

the key regulatory sequences for cpo expression (Bellen et al. 1992b).

Figure 2. Bang-sensitive paralysis in cpo mutants. Various heteroallelic combinations

were created and tested for bang-sensitive paralysis. Paralysis is greatest with the

cpoEG1/cpocp1 combination in which 32% of flies paralyze (n = 299). Flies with the

genotype cpoEG1/cpocp2 show the second highest degree of bang-sensitivity with 18% of

flies paralyzing (n = 210). This bang-sensitive paralysis defect is also seen in viable cpo

mutant combinations independent of cpoEG1. Viable mutant combinations of cpocp1/cpocp2,

cpocp1/cpol2, and cpocp2/cpol2 show paralysis in 16% (n = 281), 12% (n = 65), and 7% (n =

55) of flies, respectively. Interestingly, the cpov3 allele complements the bang-sensitive

paralysis associated with the cpoEG1 mutation as no cpoEG1/cpov3 flies paralyze (n = 56).

The apparent allelic series is: cpoEG1 ≥ cpol2 > cpocp1 ≥ cpocp2.

0%

10%

20%

30%

40%Pa

raly

zed

flies

EG1 EG1 cp1 cp1 cp2 EG1cp1 cp2 l2 l2cp2 v3

cpo alleles

A B

C

cpoEG1/cpocp1

(8 V ECS)

cpoEG1/+(8 V ECS)

cpoEG1/+(32 V ECS)

D

E

0

10

20

30

40

EG1 EG1cp1 cp2

EG1+

cp1+

cp2+

cpo alleles

++

Seiz

ure t

hres

hold

(V)

∆125∆125

0

1

2

3

4

cpo alleles

Gia

nt fi

ber t

hres

hold

(V)

EG1 EG1cp1 cp2

EG1+

cp1+

cp2+

++

∆125∆125

Figure 3. cpo mutants exhibit increased seizure susceptibility without a concomitant

increase in single neuron excitability. (A) A representative seizure as recorded from the

DLM following a high-frequency brain stimulus of 8 V ECS (depicted above as a cross-

hatched box) in a cpoEG1/cpocp1 fly. The DLM shows aberrant high-frequency firing

approaching 50 Hz during the seizure phase. These high-frequency responses then give

way to synaptic failure (not depicted). (Calibrations: 10 mV, 200 ms) (B) A cpoEG1/+ fly

shows only a few spikes following an identical 8 V high-frequency stimulus to the brain,

since this voltage is below its threshold for seizure. (C) However, seizures are elicited in

cpoEG1/+ flies following administration of 32 V ECS. (D) Comparison of seizure

thresholds for various cpo genotypes shows increased seizure susceptibility for cpo

mutants (n ≥ 6 for each genotype). (E) Comparison of the firing thresholds of the giant

fiber in control flies and cpo mutants reveals no significant differences (n ≥ 6 for each

genotype).

Figure 4. Schematic of the GF neural circuit in Drosophila and transmission defects

in the GF-TTM pathway of cpo adults. (A) The GF is a large interneuron that drives

the escape jump in Drosophila in response to visual stimuli. The GF has a cell body in

the brain and projects its axon down the cervical connective to the thoracic ganglion

where it makes two major synaptic connections. One connection is with the

tergotrochanteral motoneuron (TTMn), which in turn drives the tergotrochanteral muscle

(TTM) that enables jumping. The second connection is with the peripherally synapsing

interneuron (PSI), which contacts the five dorsal longitudinal motoneurons (DLMns).

These five DLMns drive the six dorsal longitudinal muscle (DLM) fibers that are

responsible for wing depression during flight. Each DLMn innervates a single DLM fiber

TTM

DLM4

DLM5

DLM6

GF

TTMn

PSI

DLMn4

DLMn5

(0.8 ms)

(1.2 ms)

stim

e

e

BRAIN THORACIC GANGLIA

DLM

TTM

DLM

TTM 1 2

3

A

B C

except for DLMn 5, which drives both DLM fibers 5 and 6. For simplicity, DLMn1-3 and

DLM fibers 1-3 are not included. Transmission through the monosynaptic GF-TTM

pathway is fast, eliciting a response in the TTM in approximately 0.8 ms. The disynaptic

GF-DLM pathway produces a DLM response approximately 1.2 ms following brain

stimulation. In addition to producing responses with very short latencies, both pathways

can follow stimuli at high frequencies. The GF-TTM pathway can follow stimulation

exceeding 200 Hz, while the GF-DLM pathway exhibits following frequencies in excess

of 100 Hz (Tanouye and Wyman 1980; Ikeda et al. 1980). The small “e” designations in

the figure denote electrical synapses. All other synapses are chemical. The GF-TTMn

synapse has been shown to have both electrical and chemical components (Blagburn et

al. 1999). (B) Response to brain stimulation in a control fly (cpoEG1/+). The DLM and

TTM always fire together when the brain is stimulated at voltages above the GF threshold

and always differ in latency by ~0.4 ms (Tanouye and Wyman 1980). (Calibration: 10

mV, 1 ms) (C) Response to brain stimulation in a cpo fly (cpoEG1/cpocp1). Shown are

responses to three consecutive 0.2 s pulses given at 0.5 Hz. The DLM latency never

deviates while the TTM latency progressively increases before the muscle eventually

fails. This indicates that the DLM response is capable of following at this frequency (0.5

Hz), but the TTM response is not. (Calibration: 10 mV, 1 ms)

Figure 5. Transmission defects in the GF-DLM pathway of cpo adults. (A) DLM4

and 5 responses to brain stimulation in a cpo fly (cpoEG1/cpocp1). Shown are responses to

three consecutive 0.2 s pulses administered near the following frequency threshold of 22

± 9.2 Hz in cpoEG1/cpocp1 mutants. The response of DLM4 is invariant, while the DLM5

response shifts in latency and then fails independent of DLM4. Independent failure

between DLM4 and 5 implicates a defect distal to the PSI as the likely labile site in the

GF-DLM pathway. (B) DLM5 and 6 responses to brain stimulation in the same cpo fly

(cpoEG1/cpocp1). Three consecutive 0.2 s pulses administered near the following frequency

threshold do not produce independent failure between DLM5 and 6, which are innervated

by the same motoneuron, DLMn5. Instead both show identical shifts in latency before

eventually failing together. This synchronous firing and failing between DLM5 and 6

tends to rule out the DLM nmj as the labile site in the GF-DLM circuit. Thus, the labile

site in the GF-DLM pathway appears to be synapses between the PSI and DLM

motoneurons. (Calibration: 20 mV, 1 ms)

DLM4

DLM51

2

3

1 2

3

A B

TABLE 1. Performance of giant fiber system in cpo mutants and control fliesa

Genotype Seizure

threshold

(V)

DLM

latency

(ms)

DLM

following

frequency (Hz)

TTM

latency

(ms)

TTM

following

frequency (Hz)

+/+ 30.1 ± 3.8 1.25 ± 0.10 137 ± 14.7 0.81 ± 0.07 > 100

cpoD125/ cpoD125 29.0 ± 4.5 1.18 ± 0.08 128 ± 16.3 0.72 ± 0.10 191 ± 33.2

cpoEG1/+ 28.4 ± 4.3 1.35 ± 0.12 124 ± 31.3 0.86 ± 0.10 216 ± 44.3

cpocp1/+ 26.6 ± 7.4 1.31 ± 0.07 135 ± 30.6 0.89 ± 0.09 194 ± 40.3

cpocp2/+ 34.6 ± 6.7 1.39 ± 0.12 138 ± 16.1 0.94 ± 0.15 185 ± 32.5

cpoEG1/ cpocp1 11.1 ± 3.7 1.48 ± 0.09 22 ± 9.2 1.36 ± 0.05 < 1

cpoEG1/ cpocp2 13.3 ± 4.8 1.45 ± 0.05 14 ± 4.8 1.46 ± 0.24 < 1

a For each genotype, n ≥ 6.