drosophilacontactin, a homolog of vertebrate contactin, is ... · solute/solvent exchange and the...

4931

IntroductionThe evolution of a unique set of intercellular junctions inmulticellular organisms allows their regulation of thesolute/solvent exchange and the preservation of themicroenvironment of epithelial and excitable cells, thuspreventing paracellular diffusion. Invertebrates and vertebratesevolved septate or tight junctions, respectively, to perform thisfunction. In Drosophila, apicolateral SJs between epithelialcells act as functional analogs to the vertebrate tight junctions(Willott et al., 1993; Kirkpatrick and Peifer, 1995). They arecharacterized by regular arrays of electron-dense transversestructures or septa that span the intermembrane space and forma physical barrier to diffusion (Auld et al., 1995; Baumgartneret al., 1996). Besides serving as a paracellular barrier todiffusion, SJs play additional roles in the maintenance ofepithelial polarity and cell adhesion in Drosophila (Woods etal., 1996) (S.B. and M.B., unpublished). In Drosophila nervoussystem, SJs are formed by the perineurial glial cells thatensheath the nerve fibers (Bellen et al., 1998). In vertebrates,SJs are encountered at the axo-glial interface in the paranodalregion of myelinated nerve fibers, acting as ionic barriers andmolecular fences to maintain distinct molecular domains at the

nodes of Ranvier (Bhat et al., 2001; Boyle et al., 2001; Rios etal., 2003) (for a review, see Bhat, 2003).

Several molecular components of the vertebrate axo-glialSJs have been identified, which include NCP1, contactin andNF-155 as the major cell-adhesion molecules (CAM) (Giraultand Peles, 2002). F3/F11/contactin is a GPI-anchored CAMthat contains immunoglobulin domains linked to fibronectintype III (FNIII) repeats (Gennarini et al., 1989; Brümmendorfand Rathjen, 1996). In vertebrates, contactin is predominantlyexpressed by neurons and has been implicated in the controlof axonal growth and fasciculation through heterophilicinteractions with multiple ligands (Berglund et al., 1999; Falket al., 2002), including the L1-type molecules, L1-CAM,NrCAM and neurofascin (Brümmendorf and Rathjen, 1996).

A major role of contactin in myelinated fibers is to organizeaxonal subdomains at the nodes of Ranvier. The nodal regionis highly enriched in voltage-gated Na+ channels, therebyallowing the rapid saltatory conduction of the action potential.At either end of the node, in the paranodal region, a series ofseptate-like junctions anchors the myelin terminal loops to theaxolemma. Contactin is an essential axonal component of theparanodal SJs, where it forms a cis-complex with NCP1(Menegoz et al., 1997; Peles et al., 1997). Deficiency in either

Septate junctions (SJs) in epithelial and neuronal cells playan important role in the formation and maintenance ofcharge and size selective barriers. They form the basis forthe ensheathment of nerve fibers in Drosophilaand forthe attachment of myelin loops to axonal surface invertebrates. The cell-adhesion molecules NRX IV/Caspr/Paranodin (NCP1), contactin and Neurofascin-155 (NF-155) are all present at the vertebrate axo-glial SJs.Mutational analyses have shown that vertebrate NCP1and its Drosophila homolog, Neurexin IV (NRX IV) arerequired for the formation of SJs. In this study, we reportthe genetic, molecular and biochemical characterization ofthe Drosophila homolog of vertebrate contactin, CONT.

Ultrastructural and dye-exclusion analyses of Contmutantembryos show that CONT is required for organizationof SJs and paracellular barrier function. We show thatCONT, Neuroglian (NRG) (Drosophilahomolog of NF-155)and NRX IV are interdependent for their SJ localizationand these proteins form a tripartite complex. Hence, ourdata provide evidence that the organization of SJs isdependent on the interactions between these highlyconserved cell-adhesion molecules.

Key words: Septate Junctions, F3/Contactin, Neurexin IV,Neuroglian, Axo-glial interactions

Summary

Drosophila contactin, a homolog of vertebrate contactin, is requiredfor septate junction organization and paracellular barrier functionCatherine Faivre-Sarrailh 1,*,†, Swati Banerjee 2,*, Jingjun Li 2, Michael Hortsch 3, Monique Laval 1 andManzoor A. Bhat 2,†

1Neurobiologie des Interactions Cellulaires et Neurophysiopathologie, UMR 6184 CNRS, Institut Jean-Roche,Boulevard Pierre Dramard, 13916 Marseille Cedex 20, France2Department of Cell and Molecular Physiology, Neuroscience Center and Curriculum in Neurobiology, University of North CarolinaSchool of Medicine, Chapel Hill, NC 27599-7545, USA3Department of Cell and Developmental Biology, University of Michigan, Medical School, Ann Arbor, MI 48109-0616, USA*These authors contributed equally to this work†Authors for correspondence (e-mail: [email protected]; [email protected])

Accepted 26 July 2004

Development 131, 4931-4942Published by The Company of Biologists 2004doi:10.1242/dev.01372

Research article

4932

NCP1 or contactin results in a loss of SJs and an aberrantorganization of the paranodal region, which causes a severereduction in nerve conduction velocity (Bhat et al., 2001; Boyleet al., 2001). The glial ligand NF-155 was shown to form aternary complex with NCP1 and contactin at the axon-glialinterface of the paranodes (Charles et al., 2002).

Nerve ensheathment in Drosophila and myelination invertebrates share important common features, includingprocess extension around axons and formation of SJs, whichisolate the nerve fibers from the extracellular fluid (Bellen etal., 1998; Einheber and Salzer, 2000). NRX IV (NRX –FlyBase), the fly homolog of NCP1, plays a crucial role in theformation of SJs in perineurial glial cells in the peripheralnervous system (PNS) and is required for the integrity of theblood-nerve barrier and the proper conduction of nerveimpulses (Baumgartner et al., 1996). NF-155 belongs to theL1-type family which in Drosophilais encoded by a singlegene, nrg (Bieber et al., 1989; Hortsch, 2000). Recent studieshave suggested the role of NRG along with other componentssuch as gliotactin and Na+K+ATPase in the formation of SJs(Genova and Fehon, 2003; Schulte et al., 2003). In order tobetter understand the formation and function of SJs and toinvestigate the parallels that exist between Drosophila andvertebrate SJs, additional components of SJs need to beidentified. The physiological interaction between vertebrateNCP1 and contactin suggested that a similar molecularcomplex might exist at the invertebrate SJs. In the presentstudy, we report the characterization of the Drosophilahomolog of vertebrate contactin referred here as DrosophilaContactin (CONT), which co-localizes with NRX IV and NRGat epithelial SJs and in perineurial glial cells of the PNS. Ourbiochemical data indicate that they form a tripartite complex.Ultrastructural and dye-exclusion analyses demonstrate thatCONT plays an important role in the organization of SJs andmaintenance of a functional paracellular barrier. Our studiesthus provide evidence that the paranodal SJs of myelinatedfibers in vertebrates may share their evolutionary origin withinvertebrate SJs, thus making them amenable to comparablegenetic and molecular analysis.

Materials and methodsDrosophila stocksThe P element strain KG9756 was obtained from Hugo Bellen. nrxIV4304allele has been described previously (Baumgartner et al., 1996).nrg1 flies were obtained from L. Garcia-Alonso. The deficiency stockDf(3R)XM3 was obtained from the Bloomington Stock Center.

Cloning of contTotal RNA from II and III instar larvae was extracted using TRIzol(Invitrogen) and cDNA synthesis was carried out with the SuperScriptsystem (Invitrogen) according to the manufacturer’s instructions. Thefull-length cDNA of cont was cloned in two steps using PCRamplification with Expand High Fidelity PCR system (Roche). First,the 5′half of contcDNA (2163 bp) was amplified starting at position580 of the FlyBase transcript sequence, using the 5′GCCTTTAGTCT-GCTGCGAGA3′sense primer and the 5′TCATAGACAGCACTCG-GAGCT3′ antisense primer. This fragment was inserted into theNotI-XbaI cloning sites of pP{CaSpeR-hs}transformation vector(Thummel et al., 1988). Second, the 3′ half of the cDNA sequence(2359 bp) was amplified using the 5′CCGGAAGACACTTATGAAG-AGC3′ sense primer and the 5′CAAGAGAAGCACGGATGGAAT3′antisense primer. Subsequently, this fragment was inserted into XbaI-

digested pP{CaSpeR-hs}vector DNA, which contained the 5′ half ofthe cont cDNA. The complete sequence of the PCR amplified regionswas established by Genome Express (France). The full-length cDNAsof cont and nrx IV were subcloned into pCDNA3 (Invitrogen) formammalian cell expression experiments.

Generation of CONT antibodiesA recombinant protein was generated using the pQE30 vector(Qiagen), which carried a his-tag fused to Ig5-6 domains and the hingeregion of CONT (corresponding to amino acid residues 772-1138).After induction, the his-CONT fusion protein was purified underdenaturing conditions by affinity chromatography on Ni-agarosebeads and used for the immunization of rats. For the production ofpolyclonal antisera in guinea pigs, the cDNA coding for 172 aminoacids of CONT (residues 24-195) was fused to a his-tag in pET28a(+)(Novagen) and expressed in E. coliBL21DE3. The recombinantprotein was purified from a preparative SDS-PAGE gel and used forthe immunization of guinea pigs.

Generation of cont mutants and transgenic fliesThe P element KG9756 was mobilized to generate impreciseexcisions as previously described (Bhat et al., 1999). To generate agenomic rescue construct, a cosmid library was obtained from JohnTamkun (Tamkun et al., 1992). A 7 kb SpeI-SpeI fragment whichcontained the entire contgene was cloned in pP{CaSpeR-4}, and forheat-shock induced contexpression, contcDNA was cloned intopP{CaSpeR-hs}. The recombinant plasmids were used for germlinetransformation to obtain transgenic flies. For heat-shock experiment,4- to 10-hour old embryos from the parental genotype hs-cont/hs-cont; contex956/TM3,Sb,dfd-lacZwere heat-shocked at 37°C for 60minutes followed by recovery for 7 hours at room temperature, andprocessed for immunohistochemical analysis.

ImmunohistochemistryWild-type and mutant embryos from contex956, nrx IV4304 and nrg1

were collected and aged for 12-18 hours at 25°C. Embryos wereprocessed for immunostaining as previously described (Bhat et al.,1999). The following primary antibodies were used: guinea pig anti-CONT (1:2000) (this study), rat anti-CONT (1:500) (this study) andrabbit anti-NRX IV (1:2000) (Baumgartner et al., 1996). Monoclonalanti-NRG antibodies 1B7 and 3C1 have been described previously(Bieber et al., 1989; Hortsch et al., 1995). Secondary antibodiesused for immunofluorescence were obtained from JacksonImmunoResearch. Confocal images were captured on a BioRadRadiance 2000 Confocal Microscope and the image files wereprocessed using Photoshop Software.

Electron microscopy and dye exclusion assaycontex956 and nrg1 mutant embryos were identified against a GFP-expressing balancer chromosome. Mutant and wild-type embryosaged 19-21 hours at 20°C were hand-dechorionated, perforated witha tungsten needle and fixed with 2.5% glutaraldehyde in 50 mMcacodylate buffer (pH 7.2) for 2 hours, post-fixed in 1% osmiumtetraoxide for 1 hour, en bloc stained with uranyl acetate, dehydratedand embedded in Spurr. Ultrathin sections were contrasted with uranylacetate and examined on a Philips CM10 electron microscope. For thedye exclusion assay, rhodamine-labeled 10-kDa dextran (MolecularProbes) was injected into the body cavity of stage 16 embryos asdescribed by Lamb et al. (Lamb et al., 1998).

Immunoprecipitation and western blot analysisEmbryos (18 hours) were homogenized in 10 mM Tris buffer (pH7.5), which contained 0.32 M sucrose and protease inhibitors (1 mMPMSF, 5 µg/ml α-2-macroglobulin, 1 µg/ml leupeptin and 5 µg/mlpepstatin). The homogenate was centrifuged for 10 minutes at 1500g. The supernatant was centrifuged at 100,000 g for 1 hour and themicrosomal fraction was solubilized for 30 minutes in 50 mM Tris

Development 131 (20) Research article

4933Contactin in septate junction formation

buffer (pH 7.5), 1% NP-40. After preclearing for 2 hours at 4°C withprotein A-Sepharose, the supernatant was immunoprecipitatedovernight at 4°C with protein A Sepharose, which had been coatedwith either anti-NRX IV antibody (3 µl), with rabbit-anti-mouseimmunoglobulins and 1B7 or 3C1 ascites fluid (5 µl) or with guineapig anti-CONT (3 µl). For the rat anti-CONT immune serum (5 µl),

anti-rat agarose beads were used instead. The beads were washedtwice with 50 mM Tris buffer (pH 7.5), 150 mM NaCl, 1% NP-40,twice with 50 mM Tris buffer, 150 mM NaCl, and twice with 50 mMTris buffer. Immunoprecipitates were analyzed by immunoblottingusing anti-CONT, anti-NRX IV or anti-NRG (3C1) antibodies in astandard western blotting procedure. Control experiments with

Fig. 1.CONT represents the single Drosophilahomolog of the vertebrate contactin family. CONT isencoded by the transcriptional unit CG1084(FlyBase), which was predicted from the Drosophilagenome sequence. (A) The translation of contcDNAreveals an ORF of 1390 amino acids. The signalpeptide and the GPI anchor signal are indicated inbold. The C-lectin domain is underlined. Thepredicted N-glycosylation sites are marked in boldand are underlined. These sequence data are availablefrom GenBank under Accession Number AY229991.(B) The modular protein domain structure for theCONT protein is shown in comparison withvertebrate contactin. Except for the N-terminal C-lectin domain in CONT, both proteins display asimilar domain organization. (C) The phylogenetictree obtained after aligning the protein sequencesencoding rat contactin, TAG-1, NB-2, NB-3, BIG-1and BIG-2 with the DrosophilaCONT sequence. Forthis phylogenetic tree analysis, the CONT C-lectindomain was not considered. (D) Immunoblots of lipidrafts and microsomes that were prepared from 18-hour-old embryos. (Left panel) A single protein bandwith an apparent molecular weight of ~180 kDa canbe detected in both fractions when probed with theguinea-pig anti-CONT antiserum, which is directedagainst the N-terminal C-lectin domain. As a control,Fas1 is highly concentrated in the lipid raft fraction.(Middle panel) The microsomes were incubated withPI-PLC in the presence or absence of ZnCl2 followedby high-speed centrifugation. Solubilized pellet (5 µl)(P) and 25 µl of supernatant (S) were analyzed. Asshown in the middle panel, a significant proportion ofCONT was released in the supernatant after PI-PLCtreatment. This release of CONT from themicrosomal pellet was completely inhibited by thepresence of ZnCl2. The asterisk shows a degradationband that resulted from incubation at 37°C. As acontrol, the major fraction of Fas1 was cleaved by PI-PLC and recovered in the supernatant, this releasewas also inhibited by the presence of ZnCl2. (Rightpanel) N-glycosidase-F treatment of the microsomalNP-40 extracts reduces the size of CONT to ~155kDa, close to the size predicted from the cDNAsequence (158 kDa).

4934

uncoated protein A-Sepharose or with agarose beads coated with anti-CONT pre-immune serum, yielded negative results.

The lipid rafts from embryos (18 hours) were prepared as lowdensity Triton X-100-insoluble complexes as described previously(Faivre-Sarrailh et al., 2000). Phosphatidylinositol-phospholipase C(PI-PLC) treatment was carried out as described by Gennarini et al.(Gennarini et al., 1989). Briefly, 100 µl aliquotes of microsomes from18-hour-old embryos were first incubated for 2 hours at 37°C toeliminate spontaneously released proteins and then were treatedthreefold with 0.2 unit PI-PLC (GlycoSystems, Oxford) for 40minutes. After ultracentrifugation at 100,000 g, pellets wereresuspended in 100 µl and supernatants were analyzed byimmunoblotting with anti-Fasciclin 1 (Fas1) (Hortsch and Goodman,1990) and anti-CONT antibodies. The N-glycosylation pattern ofCONT was examined using N-glycosidase-F (Roche). The NP-40extracts and lipid raft fractions were incubated for 3 hours in 0.2%SDS and 1% β-mercaptoethanol with N-glycosidase-F (20 units/ml).

Transient transfection of N2a cellsN2a cells were grown in DMEM (Invitrogen) containing 10% FCS,as well as penicillin (50 U/ml) and streptomycin (50 µg/ml). Transienttransfections with pCDNA3-nrx IVor pCDNA3-contwere carried outusing Lipofectamin Plus (Invitrogen). After 48 hours, cells were fixedwith 4% PFA in PBS, permeabilized with 0.1% Triton X-100 in PBSand processed for immunostaining. Double-immunostaining wasperformed with anti-CONT and anti-BiP mab (StressGen, Tebu) as anER marker. In some experiments, living cells were immunostainedfor CONT and then fixed, permeabilized and processed forimmunostaining for NRX IV.

Results

Structural comparison between CONT and itsmammalian homologsThe vertebrate contactin subfamily of GPI-anchored Ig-CAMscomprises TAG-1/axonin-1, and several other related proteins,BIG-1, BIG-2, NB-2/FAR-2 and NB-3 (Furley et al., 1990;Yoshihara et al., 1995; Ogawa et al., 1996; Plagge et al., 2001).A Blast search of the Drosophila genome using the humancontactin sequence identified a single Drosophila gene,CG1084 (FlyBase), with high sequence homology to contactinfamily members, which was named cont. We amplified the contcDNA by RT-PCR from larval mRNA and sequenced threeindependent clones. This revealed an open reading frameof 1390 amino acids residues (Fig. 1A). Northern blothybridization using a contcDNA probe revealed a single bandof ~4.3-4.5 kb (data not shown). Further RT-PCR analysis gaveno indication that contundergoes alternative splicing. Theprimary protein structure of CONT encompasses a N-terminalsignal peptide, a C-lectin domain, six Ig domains, four FNIIIrepeats and a consensus sequence for GPI-anchor addition(Fig. 1A). Except for the presence of the C-lectin domain atthe N terminus, the modular domain organization of CONTis similar to vertebrate contactin (Fig. 1B). A phylogeneticanalysis indicates that CONT is the Drosophilarepresentativeof the vertebrate contactin family (Fig. 1C).


Fig. 2.CONT is expressed in ectodermalepithelia and glial cells of the PNS inDrosophilaembryos. (A-D) A confocalsection of a whole-mount stage 16 wild-type embryo triple stained with anti-CONT(A, blue), anti-NRX IV (B, red) and anti-NRG (C, green). CONT is expressed in allthe ectodermally derived epithelial cells,including epidermis, salivary glands,trachea, hindgut and peripheral glial cells.The focus is on the midline of the CNS andthe exiting axon tracts and parts of theepidermis. The merged image of the threepanels is shown in D. Scale bar: 50 µm forA-D. (E-H) Part of the CNS midline andperipheral glial cells at a highermagnification shows that CONT (E, blue)and NRG (G, green) are not expressed inmidline glial cells where NRX IV isstrongly expressed (F, red, see arrowpointing to the midline glial cells). Theroots of the glial cells, which ensheathaxonal commissures in the CNS, express allthree proteins (E-H, arrowheads). In theperipheral nerves, the expression pattern ofall three proteins overlap (asterisks). (I-L) A region of the epidermal epithelial cellsat a higher magnification demonstrates thatCONT (I, blue), NRX IV (J, red) and NRG(green) are co-expressed at SJs (L, mergedcolor white). NRG expression extends morebasolaterally (arrow in K and L), whereasCONT and NRX IV are restricted to SJ

domains. The arrowheads in I-L indicate overlapping expression along the peripheral nerve. (M-P) Part of the hindgut at a higher magnificationalso shows that CONT (M, blue), NRX IV (N, red) and NRG (O, green) are concentrated at SJs, but that NRG extends more basolaterally(arrowheads in O and P). Scale bar: 16 µm for E-P.


CONT is a GPI-anchored membrane glycoproteinTo determine the relative molecular mass of the CONT protein,we generated polyclonal antibodies in rat and guinea pigagainst two his-tagged recombinant proteins, which containedIg domains 5 and 6 with the hinge region or the N-terminalregion containing the C-lectin domain, respectively.Embryonic extracts from 18-hour-old Drosophilaembryoswere prepared to obtain microsomal fractions, which weresolubilized in NP-40, followed by western blot analysis. Bothantisera detected a major single band of ~180 kDa comparedwith a predicted size of 158 kDa (Fig. 1D). Rat and guinea pigpreimmune sera consistently did not detect this 180 kDaprotein band (not shown). As CONT sequence contains 10putative N-glycosylation sites (Fig. 1A), the larger thanexpected apparent size of CONT may be the result of anextensive glycosylation. To test this hypothesis, microsomalfractions were treated with N-glycosidase F. As shown in Fig.1D, deglycosylation of the 180 kDa band results in a ~155 kDaband, corresponding to CONT protein core. CONT, whichcontains a GPI-anchor motif is recovered in the detergentinsoluble lipid raft fraction like the GPI-anchored cell adhesionmolecule Fas1 (Hortsch and Goodman, 1990) (Fig. 1D). Inaddition, CONT can be released from embryonic microsomalfraction by PI-PLC treatment. Only a fraction of CONT wassensitive to PI-PLC cleavage, whereas almost all Fas1 from thesame microsomal fraction was cleaved by PI-PLC (Fig. 1D).These data show that CONT is a GPI-anchored membraneassociated glycoprotein.

CONT is expressed in epithelial cells and glial cellsof peripheral nervesTo determine the expression pattern of the CONT protein, 0-to 16-hour-old embryos were immunostained with anti-CONTantibodies. Both guinea pig and rat anti-CONT antibodiesrevealed that CONT is expressed in ectodermally derivedepithelial cells from stage 12. All these tissues, such asepidermis, hindgut, foregut, salivary glands and trachea, havebeen shown to contain pleated SJs (Tepass and Hartenstein,1994; Baumgartner et al., 1996). To establish the subcellularlocalization of CONT more precisely and to compare itsdistribution with that of NRX IV, a known SJ specific protein,and NRG, a homolog of the vertebrate axo-glial SJ componentNF-155, co-immunolocalization studies of wild-type embryos

were carried out using guinea pig anti-CONT (Fig. 2A, blue),anti-NRX IV (Fig. 2B, red) and anti-NRG (Fig. 2C, green).This triple labeling showed that CONT expression overlapswith that of NRX IV and NRG in most epithelial tissues inwhich these molecules are co-expressed (Fig. 2D, merge).Furthermore, the onset of CONT and NRX IV expressiondetected by immunostaining is identical and, like NRX IV,CONT does not have any maternal contribution (data notshown). NRX IV is expressed in perineurial glial cells, whichinsulate peripheral nerves, and in the midline glial cells thatensheath anterior and posterior commissures. CONTcolocalizes with NRX IV in perineurial glial cells of peripheralnerves (Fig. 2E,F, asterisks), whereas it shows a distributionclearly distinct from NRX IV in the midline glial cells (Fig.2F,H, arrows). As NRG is strongly expressed in the peripheralnerves (Fig. 2G, asterisk), regions of overlap between the threemarkers are shown in the merged image (Fig. 2H, asterisk). Inthe midline, some of the glial cells express CONT, NRX IVand NRG, as indicated by intense white color (Fig. 2H,arrowhead pointing on the midline).

The expression pattern of CONT is similar to those of otherseptate junction markers such as coracle, which is expressedby ectodermally derived epithelial cells and along peripheralnerves although it is not present in midline glial cells (Fehonet al., 1994; Baumgartner et al., 1996; Ward et al., 1998).Unlike NRX IV, CONT is not expressed in midline glial cells,indicating that NRX IV may have additional partners in themidline glial cells.

CONT is a component of epithelial SJsIn Drosophila, epithelial tissues of the epidermis and hindgutcontain SJs along the apicolateral domain below the zonulaadherens or adherens junctions. To determine whether CONTprecisely localizes to SJs in the epidermis and the hindgut,confocal microscopy images of these tissues, which focus onthe epithelial cells, were captured at high magnification. Asshown in Fig. 2I-L, CONT, NRX IV and NRG display almostcomplete colocalization at the SJs of epidermal cells (asindicated by the merged white color in Fig. 2L). Although,NRG is clearly enriched at SJs, it exhibits a broaderdistribution and is also expressed along the basolateralmembrane (Fig. 2K,L, white arrows). In addition, all threeproteins colocalize along the peripheral nerves where SJs

Fig. 3.Genomic structure of the contlocus and generation ofcontmutants. (A) Based on the FlyBase genomic sequenceinformation, the contgene spans ~5.7 kb. Comparison of thegenomic (FlyBase) and cDNA (Accession Number AY229991)sequences revealed that the contlocus is composed of eightexons (black bars) with intronic sequences ranging from 53 to amaximum of 350 nucleotides. (B) Genomic map of ~17 kbregion that includes CG11739, contand tube. The P element(KG9756) is inserted in the first intron of CG11739. contiswithin ~100 bp downstream of CG11739, followed by tubewithin 300 bp. These loci are unusually close to each other. Achromosomal deficiency Df(3R)XM3that uncovers this regiondeletes contand the neighboring loci. One of the impreciseexcisions from KG9756 mobilization removes ~5 kb of thegenomic region resulting in the loss of CG11739and cont. A 7kb SpeI (Sp) genomic construct rescues the lethality of contex956

to adulthood.

4936

have been identified (Fig. 2I-L, arrowheads). Similarly, wedetermined the distribution of CONT in hindgut epithelialcells, which are more columnar than epidermal epithelialcells. As shown in Fig. 2M-P, CONT, NRX IV and NRGcolocalize at SJs, and here NRG also shows an additionalbasolateral localization (Fig. 2O,P, arrowheads). Thus, theimmunohistochemical analysis shows that CONT, NRX IV andNRG are co-expressed at SJs.

Genomic structure of cont and generation of contmutantsTo determine the in vivo function of CONT, we initiated agenetic analysis of the contlocus. Based on the genomicsequence information, the cont gene maps to 82A6-B1 andspans ~5.7 kb with eight exons (Fig. 3A). A deficiencychromosome Df(3R)XM3,ru1th1st1kniri–1cu1ppe1/TM3,Sb1

(082A03-06;082B) that uncovered contlocus, was obtainedfrom the DrosophilaStock Center and examined by Southernblot analysis to determine whether the cont locus was deletedand also by immunohistochemical analysis using anti-CONTantibodies to determine whether the deficiency homozygousembryos were lacking the CONT protein. Southern blotanalysis using a region of the cont cDNA as a probe showedhalf-signal intensity in Df(3R)XM3 when compared withwild-type signals confirming the deletion of the contgene in Df(3R)XM3 chromosome (data not shown).Immunohistochemistry using anti-CONT antibodies further

established that Df(3R)XM3/Df(3R)XM3 homozygous embryosdid not produce any CONT protein.

As there are no chemically or P element-induced mutationsin contgene, loss-of-function mutants had to be generated. Toinitiate the mutational analysis in the contgene, we identifieda viable P element KG9756 (y1; ry506 P{y+mDint2 w+BR.E.BR=SUPor-P}) that had inserted in the neighboring gene, CG11739(Fig. 3B). This gene encodes a mitochondrial tricarboxylate-carrier activity and is located in the 5′ end of the contlocus.The P-element insertion site is ~2.5 kb from the predicted 5′end of cont(Fig. 3B) and ~3.2 kb from its ATG start codon.The transcription start site (predicted by FlyBase) of the contlocus is just 90 bp from the 3′ end of CG11739. Standard Pelement mobilization procedures were followed (Bhat etal., 1999) to obtain imprecise excisions. We screenedapproximately 3000 individual chromosomes and obtained 13lethal lines over Df(3R)XM3 deficiency, 11 of which showedcomplete loss of CONT. By carrying out Southern blotanalysis, we narrowed down the breakpoints in one of theexcision lines (contex956) that started from the P insertion siteand deleted ~5 kb towards the cont locus. This excision causesembryonic lethality. To rescue the lethality of the contex956

excision, we generated transgenic lines using a 7 kb SpeI-SpeIgenomic fragment, which breaks in the middle of CG11739(deleting its promoter region and the first 144 amino acids outof a total of 321 amino acids) and has intact cont locus (Fig.3B). This transgene fully rescues the lethality of homozygous


Fig. 4.NRX IV, NRG and CONT areinterdependent for their localizationat the SJs. (A-D) This region of thewild-type epidermis at stage 16shows the SJ localization of NRX IV(A, blue), CONT (B, red) and NRG(C, green), and the merged image(D). (E-H) Epidermis from a nrxIV4304/nrx IV4304embryo at stage 16with a loss of NRX IV protein (E,blue), a diffuse localization of CONTaround the cell cortex (F, red) and auniform basolateral localization ofNRG (G, green). White arrowheadsindicate the basolateral distributionof NRG (compare G with C). CONTis also seen in intracellular vesicles,as indicated by red arrowheads in Fand H. (I-L) This part of theepidermis from a nrg1/Y embryo atstage 16 shows the loss of NRGstaining (I, blue). White arrowheadsindicate the basolateral distributionof both NRX IV (J, red) and CONT(K, green). Compare the mergedimage L with D. (M-P) Part of theepidermal epithelial layer fromhomozygous contex956mutantembryo at stage 16, showing total

loss of CONT (M, blue) and mislocalization of NRX IV (N, red) and NRG (O, green) along the basolateral area, as indicated with arrowheads(N-P). Merged image in P. (Q-V) Epidermis from hs-cont/hs-cont;contex956/contex956homozygous embryos at stage 16 heat-shocked to inducethe expression of CONT (Q and T, blue), show that NRX IV (R, green) or NRG (U, green) localization at SJs has been restored (comparearrowheads in R with N or in U with O). Merged images are shown in S and V. (W-Z) Epidermis from contex956/contex956embryo rescued bySpeI genomic fragment at stage 16 shows normal expression and localization of CONT (W), and restoration of NRX IV (X) and NRG (Y) toSJs. A merged image of these proteins is shown in Z. Arrowheads indicate localization of these proteins at SJs. Scale bar: 16 µm.


contex956excisions. The rescued adults are fully viable, fertileand are indistinguishable from those of the wild-type flies,and have been maintained as a stable stock. Therefore, thelack of CG11739 gene product is not associated with a lethalphenotype. Two additional genes in Drosophila, CG5254andCG6782, which also encode a mitochondrial tricarboxylate-carrier activity, might substitute for CG11739function. Ourresults indicate that the lethality incontex956is due to the lossof CONT, and that this excision represents a null allele ofcont.

Interdependence of CONT, NRX IV and NRG for theirSJ localizationVertebrate NCP1, contactin and NF-155 co-localize at theparanodal SJs (Bhat et al., 2001) and each of these proteins arefound to be mislocalized in the mutant backgrounds of oneanother (Bhat et al., 2001; Boyle et al., 2001). In order tofurther investigate the analogy between the paranodal andinvertebrate SJs, we examined whether CONT, NRX IV andNRG are mutually dependent on each other for their SJlocalization. We first analyzed whether the loss of NRX IVwould result in the mislocalization of CONT and NRG, andfound that nrx IV-null mutant embryos exhibit a diffusedistribution of CONT along the basolateral cell membrane asopposed to its sharp localization at the SJs, as seen in the wild-type embryos (compare white arrowheads in Fig. 4B with Fig.4F). In addition, we observed that CONT immunoreactivity isoften associated with intracellular vesicles (Fig. 4F,H, redarrowheads), suggesting that CONT may not be either

efficiently transported or stabilized at the cell surface in nrx IVmutants. In addition, NRG, which is present at high levels atthe SJs in the wild-type embryos (Fig. 4C) is mislocalized innrx IV mutant embryos and shows a more basolaterallocalization (arrowhead in Fig. 4G). These results indicate thatNRX IV is required for proper SJ localization of CONT andNRG.

Similarly, we carried out triple immunostaining of nrg1-nullmutants for NRX IV and CONT localization (Fig. 4I-L). Inwild-type embryos, NRG is enriched at SJs (see Fig. 4C, green)with a lower level of expression along the basolateralmembrane (Fig. 4C, arrowheads). In epithelial cells of nrgmutant embryos, the distribution of NRX IV and CONTbecomes basolateral (compare arrowheads in Fig. 4J with 4A,and arrowheads in Fig. 4K with 4B) indicating that NRX IVand CONT are dependent on NRG for their SJ localization.

Next, we analyzed Cont-null mutant embryos for SJlocalization of NRX IV and NRG. As shown in Fig. 4M-P,with the loss of CONT (Fig. 4M), NRX IV and NRG aremislocalized to the basolateral membrane (comparearrowheads in Fig. 4N with 4A, and arrowheads in Fig. 4O with4C). Taken together, the immunohistochemical analyses of nrxIV, nrg and cont-null mutants demonstrate that these proteinsare mutually dependent on each other for their localization toSJs.

CONT expression restores NRX IV and NRGlocalization to SJsAs shown in the preceding section, the loss of CONT results

Fig. 5.Organization of SJs isaltered in contmutants.Ultrastructural analysis of theepidermal SJs in controlheterozygous cont/GFP embryos(A,D), homozygous cont(B,E) andnrg1/Y mutant embryos (C) atstage 15. Adherens junctions at theapical side are indicated withasterisks. In control cont/GFPembryos, SJ strands (arrows) areobserved at the level of aconvoluted intercellular junction inthe apicolateral region (A).Alignments of a small stretch ofsepta (arrows) are occasionallyseen in cont(B) and nrg(C) mutants, and are often verybasal to adherens junctions in thesemutant embryos. High-magnification views of SJ strandsin control (D) and contmutant(E) embryos show that mutant SJstrands are narrower comparedwith control SJs. Intramembranousstructures display a scallopedappearance in the heterozygous(arrowheads in D) but not in thecontmutant, whereas spacingbetween septa is normal in contmutant. Scale bar: 200 nm for A-C;100 nm for D,E.

4938

in the mislocalization of NRX IV and NRG to the basolateralmembrane. To further demonstrate that the mislocalizationphenotype observed in contmutants is due to the loss of CONTonly, and not due to any other gene expression disrupted by theP element excision, 4- to 10-hour-old embryos obtained fromhs-cont/hs-cont; contex956/TM3,Sb,dfd-lacZparental genotypewere heat-shocked at 37°C for 60 minutes to induce CONT.After 7 hours incubation at room temperature, the embryoswere processed for immunostaining using antibodies againstCONT, NRX IV or NRG. hs-cont/hs-cont; contex956/contex956

homozygous embryos were identified by the absence of β-galactosidase. As shown in Fig. 4Q-S, induction of CONTexpression (4Q, blue) restores the localization of NRX IV toSJs (Fig. 4R, compare arrowheads in 4R with 4A). Similarly,localization of NRG was analyzed in these embryos. As shownin Fig. 4T-V, CONT expression results in the enrichment ofNRG at the SJs (compare arrowheads in Fig. 4U with 4C). Inaddition, the SJ localization of NRX IV and NRG was restoredin homozygous contex956embryos by expression of wild-typeCONT from the SpeI-SpeI genomic rescue fragment (Fig. 4W-Z). Taken together, the rescue experiments demonstrate thatCONT is required for the localization of NRX IV and NRG atepithelial SJs, and further strengthen our conclusion that the

mislocalization phenotype of NRX IV and NRG is solely dueto the loss of CONT in cont-null embryos.

CONT is required for SJ organizationTo demonstrate the role of CONT in SJ organization,ultrastructural analysis of contmutant embryos was carried outin the epidermis (Fig. 5). In wild-type animals, the pleated SJsare characterized by rows of septa running in the apical halfof the lateral membranes, below the adherens junctions.Ultrastructural analysis revealed a complete loss of transversesepta in nrx IVmutants (Baumgartner et al., 1996). By contrast,strands of septa are encountered in 92% of cont embryos atstage 15 (n=13) (Fig. 5B). However, the wild-type pattern ofSJs, which show long stretches of ladder-like structure, was notseen in contmutants and only small clusters of septa wereobserved occasionally. A quantitative analysis was performedby selecting intercellular junctions that showed strands of septain the epidermis of conthomozygous and cont/GFP embryos.As exemplified in Fig. 5A in control cont/GFP embryos, septaalignments are mainly found below adherens junctions wherethe intercellular membranes are very convoluted because ofinterdigitations of the two opposing cells. These interdigitatingmembranes with SJs have been previously reported (Noirot-Thimothée and Noirot, 1980). In cont/GFP embryos, the meannumber of septa in an average SJ is 44.7±1.9 (five embryos, 16intercellular junctions) whereas in contmutant embryos,intercellular junctions showing such large SJ strands are neverfound. Whenever any septa are present, they are often morebasal in their position (Fig. 5B, arrow), and the mean numberof septa is significantly reduced 27.1±3 (six embryos,23 intercellular junctions scored). At higher magnification,electron dense intramembranous structures on both sides of thejunction display a scalloped appearance in cont/GFP embryos(Fig. 5D, arrowheads). These intramembranous particles arenot distinctly visible in cont mutant embryos, suggesting thatCONT may be involved in the formation and/or organizationof these electron-dense structures (Fig. 5E). Interestingly, theregular spacing between septa (~20-22 nm) does not seem tobe affected in contmutants (Fig. 5D,E).

Similarly, we carried out the ultrastructural analysis of nrgmutant embryos to determine whether NRG is required for theformation of SJs. Our analysis revealed that occasionallyclusters of septa are formed, often basal in their position, in79% of nrg1 embryos (n=24) at stage 15 (Fig. 5C). Theseobservations are consistent with the recent study of Genova andFehon (Genova and Fehon, 2003) that reports a reducednumber of septa in nrgmutants (see discussion). In conclusion,our results indicate that CONT and NRG are not required forthe formation of intermembrane septa, but that they may playa role in organizing the junctional strands of septa in theapicolateral domain to form an effective transepithelial barrier.

CONT is required for epithelial barrier formationNext, we examined whether CONT plays a role in thetransepithelial barrier formation using the method establishedby Lamb et al. (Lamb et al., 1998). This method relies on theability of the salivary gland epithelia to exclude rhodamine-dextran (~10 kDa) after its injection into the body cavity of liveembryos during late embryogenesis. After the dye injection,confocal sections were acquired on live embryos at timeintervals ranging from 10 to 50 minutes. In control


Fig. 6.The paracellular barrier is compromised in contmutantembryos. (A) cont/GFPheterozygous late stage embryo injectedwith rhodamine-labeled dextran into the body cavity reveals an intactparacellular barrier as the dye fails to penetrate into the lumen of thesalivary glands 20 minutes after injection (arrow). (B) contmutantembryos injected with the dye into the body cavity revealsbreakdown of the paracellular barrier as the dye penetrates into thelumen of the salivary glands within 18 minutes (arrow). (C) contmutant embryos injected with the dye into the body cavity revealsbreakdown of the paracellular barrier in the tracheal lumen(arrowhead). The tracheal tube is convoluted in the contmutantembryo. The salivary gland filled with the dye is indicated by anasterisk. Scale bar: 20 µm for A,B; 60 µm for C.


heterozygous cont/GFP embryos, the dye remained excludedfrom the salivary gland lumen after 50 minutes of injection(n=11) (Fig. 6A, arrow). In contmutants, diffusion of the dyeinto the lumen of salivary glands was observed within 20minutes of the injection (n=12). Similar kinetics of dyediffusion into salivary gland lumen have been observedfor gliotactin and megatrachea mutants, which displaydisorganization or absence of septal clusters (Behr et al., 2003;Schulte et al., 2003). None of the cont mutants excluded thedye from their lumen (Fig. 6B, arrow). The dye also enteredfreely in the tracheal lumen of the contmutant embryos(Fig. 6C, arrowhead) in addition to the lumen of the salivaryglands (Fig. 6C, asterisk). Thus, the dye exclusion data, incombination with the ultrastructural analysis, demonstrate thatCONT is required for the organization and function of the SJs.

CONT, NRX IV and NRG form a biochemical complexAnalyses of cont, nrx IVand nrgmutants showed that thesegenes display a common alteration of SJ phenotype and thusare required for the formation and/or organization of SJs. Inaddition, the immunohistochemical analysis of these mutantsshowed that CONT, NRX IV and NRG are dependent on eachother for SJ localization. The phenotypic similarities raised theinteresting issue of whether these proteins are part of amacromolecular protein complex that exists at SJs, and thusbecome dependent on each other for their localization. Todetermine whether these three proteins form a biochemicalcomplex, microsomal NP-40 extracts were prepared fromDrosophila embryos and used for co-immunoprecipitationexperiments. CONT was efficiently co-immunoprecipitatedwith NRX IV using either anti-NRX IV or anti-CONTantibodies (Fig. 7A,B). CONT and NRX IV were not co-

precipitated by monoclonal anti-NRG antibodies,owing to weak ability to immunoprecipitate NRGcomplexes. However, by probing western blotswith the 3C1 anti-NRG mAb, NRG was detectedin anti-CONT immunoprecipitates (Fig. 7C).Only the lower molecular weight NRG167

isoform, which is expressed in epithelial cells,was co-immunoprecipitated with CONT. Bycontrast, the neuronal NRG180 isoform couldonly be detected in the total NP-40 lysate (Fig.7C, arrowheads). These results demonstrate thatCONT, NRX IV and NRG are part of a proteincomplex and that the molecular interactionsbetween these proteins may underlie theorganization of the SJs.

NRX IV is required for the cell surfaceexpression of CONTThe biochemical and immunohistochemical datashowed that CONT is part of a protein complexthat includes NRX IV and that CONT ismislocalized in nrx IVmutants. Furthermore, inthese mutants, CONT protein is not expressedproperly on the plasma membrane and is seen inintracellular vesicles in the epithelial cells (redarrowheads in Fig. 4F,H). This raised thepossibility that NRX IV might be involved in thecell surface targeting or stabilization of CONT.As Drosophila S2 cells constitutively express

NRX IV and CONT, we addressed this question usingneuroblastoma N2a cells as a heterologous expression system.In transfected N2a cells, NRX IV is efficiently expressed at thecell surface (Fig. 8A). By contrast, in cells expressing CONT,the CONT protein appears to remain localized intracellularlyand double-staining with the ER marker BiP indicates thatCONT is retained in the ER (Fig. 8B-D). Immunofluorescencestaining under permeabilizing conditions of N2a cells, whichwere co-transfected with CONT and NRX IV, revealed thatCONT is transported to and co-localized with NRX IV at theplasma membrane (Fig. 8E,F). Similar results were obtainedwith intact living cells (Fig. 8G,H). Thus, these results indicatethat NRX IV mediates the cell-surface targeting of CONT.Next, we co-immunoprecipitated CONT with NRX IV fromco-transfected COS cell lysates (Fig. 7D), as a further evidencethat these proteins interact in cis. Such a cis-interaction hasbeen reported for their vertebrate counterparts contactin andNCP1 (Peles et al., 1997).

In conclusion, the phenotypic and biochemical studiesdescribed here demonstrate that CONT plays a crucial role inSJ formation and function. Furthermore, our results provideevidence that the molecular architecture of SJs has beenpreserved during evolution making these junctions amenableto further genetic and molecular analysis.

DiscussionIn the present study, we show that the contactin gene familyplays an evolutionarily conserved function in the organizationof SJs. We cloned Drosophila contactin and showed that itlocalizes to SJs and is required for paracellular barrier function.CONT is essential for the localization of NRX IV and NRG at

Fig. 7.CONT, NRX IV and NRG form a biochemical complex. Co-immunoprecipitation experiments reveal a tripartite complex between CONT, NRXIV and NRG. NP-40 embryonic lysates were immunoprecipitated with anti-NRX IV,anti-CONT, anti-NRG (1B7) antibodies. Controls were performed with anti-CONTpre-immune serum (PI). Immunoblots were probed with anti-NRX IV (A), rat anti-CONT (B) or anti-NRG 3C1 (C) antibodies. Molecular weight standards in kDa areindicated on the left. NRX IV is co-immunoprecipitated with CONT andreciprocally CONT is co-precipitated with anti-NRX IV antibodies. It was notpossible to detect CONT in the anti-NRG immunoprecipitate. By contrast, NRG167

(asterisk) was detected in the immunoprecipitate with anti-CONT antibodies. Adoublet of both 167 and 180 kDa NRG isoforms is detected in the NP-40 lysate(arrowheads). (D) COS cells were co-transfected with NRX IV and CONT. NP-40lysate was immunoprecipitated with anti-NRX IV antibody. CONT is detected in theanti-NRX IV immunoprecipitate.

4940

SJs and these proteins form a tripartite complex. Our studiesare inline with the vertebrate studies where homologous cell-adhesion molecules, NCP1 and contactin are required toestablish paranodal SJs in complex with NF-155 (Girault andPeles, 2002; Bhat, 2003). In addition, NCP molecules interactwith scaffolding proteins of the FERM (4.1, Ezrin, Radixin,Moesin) family, 4.1B and coracle in vertebrate and invertebratespecies, respectively (Fehon et al., 1994; Ward et al., 1998;Gollan et al., 2002; Denisenko-Nehrbass et al., 2003).Therefore, the molecular composition of DrosophilaSJs andvertebrate axo-glial SJs is highly conserved.

Conserved heterophilic binding activities ofcontactin and NCP moleculesA single representative of the contactin gene family wasidentified in the Drosophilagenome, whereas six genes havebeen identified to date in vertebrates. A phylogenetic analysisindicates that CONT is not a specific ortholog of any oneof the vertebrate contactin-type proteins. As CONT is acomponent of SJs, it appears to be the functional counterpartof vertebrate contactin, which is a component of paranodal SJs.In vertebrates, contactin interacts with NCP1/caspr in cis at theparanodal SJs (Peles et al., 1997), whereas a contactin-relatedprotein TAG-1 has been identified as a glial component ofthe juxta-paranodes (Traka et al., 2002) and interacts withNCP2/caspr2 (Poliak et al., 1999; Traka et al., 2003). Thebinding partners for other NCP members are still not known,which may include other members of the contactin family. TheDrosophilagenome encodes only one contactin which interactswith the only member of the DrosophilaNCP family, NRX IV.Therefore, it seems that heterophilic binding between contactinand NCP molecules has occurred early during evolution andhas been conserved following gene duplication in both genefamilies.

Targeting of the contactin complex to thecell membraneIn vertebrates, efficient transport of NCP1 from theendoplasmic reticulum to the surface of transfectedcells requires association with the GPI-linkedcontactin (Faivre-Sarrailh et al., 2000; Bonnon etal., 2003). NCP1 accumulates intracellularly andfails to be recruited to paranodes in the nerves ofcontactin-deficient mice demonstrating thatcontactin is essential for axonal sorting of NCP1 invivo (Boyle et al., 2001). It came as a surprise, thatin Drosophila, a different mode of operationappears to control the membrane expression of thecontactin-NCP complex and, conversely, NRX IVis required for the distribution of CONT at the cellsurface. In nrx IV mutant embryos, CONT is notefficiently expressed at the plasma membrane, butrather appears to accumulate in vesicular organellesin the cytoplasm of epithelial cells. In transfectedN2a cells, CONT remains associated with the ERand is only efficiently transported to the cell surfaceupon co-transfection with NRX IV. Such amechanism of co-targeting would allow thecontrolled sorting of CONT to the cell surface,where it may essentially be present in a cis-complex with NRX IV.

Role of the CONT, NRX IV, NRG complex in theorganization of SJsCONT, NRX IV and NRG are interdependent for theirrestricted distribution at the apicolateral membrane, but themolecular arrangement of this ternary complex is stillunknown. It has previously been shown that NRX IV does notmediate homophilic adhesion (Baumgartner et al., 1996). AsNRX IV is required for transport of CONT to the cell surface,we can assume that the two molecules interact with each otherin a cis configuration, within the same plane of the membrane.In the vertebrate paranodal junctions, a ternary complexof NCP1/contactin interacting with NF-155 is crucial formediating the axo-glial heterotypic contact. A different contextis encountered in Drosophila, in which SJs occur via thehomotypic adhesion of two epithelial or glial cells. NRG is apotent homophilic adhesion molecule (Hortsch et al., 1995). Itis currently unknown whether the CONT/NRX IV complexinteracts with NRG in a cis- or in a trans-manner.

We and others have shown that NRG is a component of theDrosophila SJs in epithelial cells and is involved in theapicolateral restricted distribution of NRX IV and CONT. Theultrastructural analysis reveals that small strands of septa canbe formed in the absence of NRG. This is in agreement withthe studies of Genova and Fehon (2003), which indicated thatmutation in nrg disrupts the paracellular barrier in theembryonic salivary gland, and induce alteration of the SJs.Similarly, small strands of septa are occasionally formed in thecont mutant, although the organization of these septa in theapical membrane is severely impaired. The transverse septa,which are characteristic of the pleated SJs, are missing in nrxIV mutants (Baumgartner et al., 1996) and, therefore, NRX IVis crucial for the assembly of SJ strands. This activity may relyon its interaction with the scaffolding protein coracle, which isalso strictly required for septa formation (Lamb et al., 1998).


Fig. 8.Cell-surface expression of CONT depends on NRX IV. Neuroblastoma N2acells were transfected with NRX IV or CONT, or co-transfected with bothconstructs. (A) NRX IV is efficiently transported to the cell surface in the absenceof CONT. (B-D) When transfected alone, CONT is not expressed at the plasmamembrane. Double-immunostaining of CONT (B, red) and the ER marker BiP(C, green). The merged image (D) shows that CONT is retained in the ER(arrowheads). (E-H) Co-transfection of CONT (E) and NRX IV (F) in N2a cellsresults in expression of CONT protein at the plasma membrane. (G,H) Cell-surfaceexpression of CONT in N2a cells co-transfected with CONT and NRX IV. Cellswere fixed, permeabilized with Triton X-100 and processed forimmunofluorescence staining in A-F. Immunostaining for CONT was carried outon living cells in G and then cells were fixed, permeabilized and processed forNRX IV immunostaining (H). Scale bar: 10 µm.


As NRX IV does not display homophilic binding (Baumgartneret al., 1996), its role in septa formation may also rely onbinding with a still unidentified adhesion molecule. Molecularinteractions between NRX IV, CONT and NRG are likely tobe involved in the organization and lateral positioning of thejunctional strands. Therefore, the molecular requirement forsepta formation in Drosophilais somewhat similar to what hasbeen reported for the vertebrate paranodal SJs. In the mouse,disruption of contactin and NCP1 genes both result in thedisappearance of intermembranous septa and disorganizationof paranodal junctions (Bhat et al., 2001; Boyle et al., 2001).The loss-of-function analysis of the glial NF-155 should revealwhether NF-155 is required for the formation of paranodal SJs.

Distinct roles for the multiple septate junctionmoleculesInvertebrate SJs display similar molecular composition andmorphology to the vertebrate paranodal junctions, but alsodisplay functional analogy with the vertebrate tight junctionsby forming a diffusion barrier. A remarkable differencebetween the septate and tight junctions resides in theirultrastructural morphology. SJs are characterized by rows ofintermembrane septa, whereas tight junctions have membrane-kissing points resulting from the sealing of claudin strands(Tepass and Hartenstein, 1994; Morita et al., 1999). Recentstudies report the identification of two claudins, megatrachea(Behr et al., 2003) and sinuous (Wu et al., 2004), ascomponents of the DrosophilaSJs that are essential for thebarrier function. This is an indication that the two types ofjunctions display some molecular similarities in addition totheir functional analogy. The question of whether the vertebrateparanodal junctions also contain claudins is still unresolved.

In addition, an increasing number of adhesion proteins havebeen recently reported to be essential for the organization ofinvertebrate SJs and formation of the paracellular diffusionbarrier, including the Ig-CAM lachesin, and the cholinesterase-like molecule gliotactin (Genova and Fehon, 2003; Schulte etal., 2003; Llimargas et al., 2004). Strikingly, all thesecomponents are interdependent for their distribution at SJs [e.g.NRX IV is mislocalized to the basolateral membrane inmegatrachea, sinuous, gliotactin, or lachesinmutant embryos(Behr et al., 2003; Schulte et al., 2003; Llimargas et al., 2004;Wu et al., 2004)]. A lack of intermembrane septa has beenobserved in lachesin(Llimargas et al., 2004) and megatrachea(Behr et al., 2003) mutants, whereas sinuousmutant embryosdisplay a phenotype similar to the contmutant, showing somestrands of septa that are disorganized (Wu et al., 2004). Aunique function has been proposed for gliotactin that onlycolocalizes with other SJ markers at the tricellular junctions.Ultrastructural analysis indicated that septa are present in thegliotactin mutant but the rows of septa are not tightly arrayed,and gliotactin may serve as an anchor at the tricellular cornersand induce apical compaction of the SJ strands (Schulte et al.,2003). Now, the question that arises is what is molecularinterplay between all these SJ markers? The future challengeswould be to molecularly dissect the structural elementsforming the intermembrane septa, and finding out how thedistinct SJ components determine elongation of the strands andcompaction of the parallel rows in the apical half of epithelialcell membrane, that is central to establishing an effectivediffusion barrier.

This work was supported by the Association pour la Recherche surla Sclérose en Plaques, the Mizutani Foundation for Glycosciences,the Fondation pour la Recherche Médicale (C.F.-S.), Howard TeminCareer Development Award from the National Cancer Institute, KO1-CA 78437 (M.A.B.), Hirschl Foundation Career Development Award(M.A.B.), NIH grants GM63074 (M.A.B.) and HD 29388 (M.H.), andNSF grant IBN-0132819 (M.H.). We thank Afshan Ismat for SpeIgenomic construct, and André Le Bivic, Michel Piovant, Luis Garcia-Alonso and members of the Bhat laboratory for helpful discussions.

ReferencesAuld, V. J., Fetter, R. D., Broadie, K. and Goodman, C. S. (1995).

Gliotactin, a novel transmembrane protein on peripheral glia, is required toform the blood-nerve barrier in Drosophila. Cell81, 757-767.

Baumgartner, S., Littleton, J. T., Broadie, K., Bhat, M. A., Harcke, R.,Lengyel, J. A., Chiquet Ehrismann, R., Prokop, A. and Bellen, H. J.(1996). A Drosophilaneurexin is required for septate junction and blood-nerve barrier formation and function. Cell 13, 1059-1068.

Behr, M., Riedel, D. and Schuh, R. (2003). The claudin-like megatrachea isessential in septate junctions for the epithelial barrier function inDrosophila. Dev. Cell5, 611-620.

Bellen, H. J., Lu, Y., Beckstead, R. and Bhat, M. A. (1998). Neurexin IV,Caspr and paranodin-novel members of the neurexin family, encounters ofaxons and glia. Trends Neurosci. 10, 444-449.

Berglund, E. O., Murai, K., Fredette, B., Sekerkova, G., Marturano, B.,Weber, L., Mugnaini, E. and Ranscht, B. (1999). Ataxia and abnormalcerebellar microorganization in mice with ablated contactin geneexpression. Neuron24, 739-750.

Bhat, M. A. (2003). Molecular organization of axo-glial junctions. Curr. Opin.Neurobiol. 13, 552-559.

Bhat, M. A., Izaddoost, S., Lu, Y., Cho, K. O., Choi, K. W. and Bellen, H.J. (1999). Discs Lost, a novel multi-PDZ domain protein, establishes andmaintains epithelial polarity. Cell96, 833-845.

Bhat, M. A., Rios, J. C., Lu, Y., Garcia-Fresco, G. P., Ching, W., Martin,M. S., Li, J., Einheber, S., Chesler, M., Rosenbluth, J. et al. (2001). Axon-glia interactions and the domain organization of myelinated axons requireneurexin IV/caspr/paranodin. Neuron30, 369-383.

Bieber, A. J., Snow, P. M., Hortsch, M., Patel, N. H., Jacobs, J. R.,Traquina, Z. R., Schilling, J. and Goodman, C. S. (1989). Drosophilaneuroglian, a member of the immunoglobulin superfamily with extensivehomology to the vertebrate neural adhesion molecule L1. Cell 59, 447-460.

Bonnon, C., Goutebroze, L., Denisenko-Nehrbass, N., Girault, J. A. andFaivre-Sarrailh, C. (2003). The paranodal complex of F3/contactin andcaspr/paranodin traffics to the cell surface via a non-conventional pathway.J. Biol. Chem. 278, 48339-48347.

Boyle, M. E., Berglund, E. O., Murai, K. K., Weber, L., Peles, E. andRanscht, B. (2001). Contactin orchestrates assembly of the septate-likejunctions at the paranode in myelinated peripheral nerve. Neuron30, 385-397.

Brümmendorf, T. and Rathjen, F. (1996). Structure/function relationships ofaxon-associated adhesion receptors of the immunoglobulin superfamily.Curr. Opin. Neurobiol. 6, 584-592.

Charles, P., Tait, S., Faivre-Sarrailh, C., Barbin, G., Gunn-Moore, F.,Denisenko-Nehrbass, N., Guennoc, A. M., Girault, J. A., Brophy, P. J.and Lubetzki, C. (2002). Neurofascin is a glial receptor for theparanodin/Caspr-contactin axonal complex at the axoglial junction. Curr.Biol. 12, 217-220.

Denisenko-Nehrbass, N., Oguievetskaia, K., Goutebroze, L., Galvez, T.,Yamakawa, H., Ohara, O., Carnaud, M. and Girault, J. A. (2003).Protein 4.1B associates with both Caspr/paranodin and Caspr2 at paranodesand juxtaparanodes of myelinated fibres. Eur. J. Neurosci. 17, 411-416.

Einheber, S. and Salzer, J. L. (2000). A glial investment of axons defrayed.Neuron28, 627-628.

Faivre-Sarrailh, C., Gauthier, F., Denisenko-Nehrbass, N., le Bivic, A.,Rougon, G. and Girault, J. A. (2000). The GPI-anchored adhesionmolecule F3/contactin is required for surface transport of paranodin/caspr.J. Cell Biol. 149, 491-502.

Falk, J., Bonnon, C., Girault, J. A. and Faivre-Sarrailh, C. (2002).F3/contactin, a neuronal cell adhesion molecule implicated in axogenesisand myelination. Biol. Cell. 94, 327-334.

Fehon, R. G., Dawson, I. A. and Artavanis-Tsakonas, S. (1994). ADrosophilahomologue of membrane-skeleton protein 4.1 is associated with

4942

septate junctions and is encoded by the coracle gene. Development120, 545-557.

Furley, A. J., Morton, S. B., Manalo, D., Karagogeos, D., Dodd, J. andJessell, T. M. (1990). The axonal glycoprotein TAG-1 is an immunoglobulinsuperfamily member with neurite outgrowth promoting activity. Cell 61,157-170.

Gennarini, G., Cibelli, G., Rougon, G., Mattei, M. and Goridis, C. (1989).The mouse neuronal cell surface protein F3, a phosphatidylinositol-anchored member of the immunoglobulin superfamily related to the chickencontactin. J. Cell Biol. 109, 775-788.

Genova, J. L. and Fehon, R. G. (2003). Neuroglian, gliotactin, and theNa+/K+ ATPase are essential for septate junction function in Drosophila. J.Cell Biol. 161, 979-989.

Girault, J. A. and Peles, E. (2002). Development of nodes of Ranvier. Curr.Opin. Neurobiol. 12, 476-485.

Gollan, L., Sabanay, H., Poliak, S., Berglund, E. O., Ranscht, B. andPeles, E. (2002). Retention of a cell adhesion complex at the paranodaljunction requires the cytoplasmic region of Caspr. J. Cell Biol. 157, 1247-1256.

Hortsch, M. (2000). Structural and functional evolution of the L1 family, arefour adhesion molecules better than one? Mol. Cell. Neurosci. 15, 1-10.

Hortsch, M. and Goodman, C. S. (1990). DrosophilaFasciclin I, a neuralcell adhesion molecule, has a phosphatidylinositol lipid memebrane anchorthat is developmentally regulated. J. Biol. Chem. 265, 15104-15109.

Hortsch, M., Wang, Y. M., Marikar, Y. and Bieber, A. J. (1995). Thecytoplasmic domain of the Drosophilacell adhesion molecule neuroglian isnot essential for its homophilic adhesive properties in S2 cells. J. Biol.Chem. 270, 18809-18817.

Kirkpatrick, C. and Peifer, M. (1995). Not just glue, cell-cell junctions ascellular signaling centers. Curr. Opin. Genet. Dev. 5, 56-65.

Lamb, R. S., Ward, R. E., Schweizer, L. and Fehon, R. G. (1998).Drosophila coracle, a member of the protein 4.1 superfamily, has essentialstructural functions in septate junctions and developmental functions inembryonic and adult epithelial cells. Mol. Biol. Cell9, 3505-3519.

Llimargas, M., Strigini, M., Katidou, M., Karagogeos, D. and Casanova,J. (2004). Lachesin is a component of a septate junction-based mechanismthat controls tube size and epithelial integrity in the Drosophila trachealsystem. Development, 131, 181-190.

Menegoz, M., Gaspar, P., le Bert, M., Galvez, T., Burgaya, F., Palfrey, C.,Ezan, P., Arnos, F. and Girault, J. A. (1997). Paranodin, a glycoprotein ofneuronal paranodal membranes. Neuron19, 319-331.

Morita, K., Furuse, M., Fujimoto, K. and Tsukita, S. (1999). Claudinmultigene family encoding four-transmembrane domain protein componentsof tight junction strands. Proc. Natl. Acad. Sci. USA 96, 511-516.

Noirot-Thimothé, C. and Noirot, C. (1980). Septate and scalariformjunctions in arthropods. Int. J. Cytol. 63, 97-140.

Ogawa, J., Kaneko, H., Masuda, T., Nagata, S., Hosoya, H. and Wattman,K. (1996). Novel neural adhesion molecules in the Contactin/F3 subgroupof the immunoglobulin superfamily, isolation and characterization ofcDNAs from rat brain. Neurosci. Lett. 218, 173-176.

Peles, E., Nativ, M., Lustig, M., Grumet, M., Schilling, J., Martinez, R.,Plowman, G. D. and Schlessinger, J. (1997). Identification of a novelcontactin-associated transmembrane receptor with multiple domainsimplicated in protein-protein interactions. EMBO J. 16, 978-988.

Plagge, A., Sendtner-Voelderndorff, L., Sirim, P., Freigang, J., Rader, C.,Sonderegger, P. and Brümmendorf, T. (2001). The contactin-relatedprotein FAR-2 defines Purkinje cell clusters and labels subpopulations ofclimbing fibers in the developing cerebellum. Mol. Cell. Neurosci. 18, 91-107.

Poliak, S., Gollan, L., Martinez, R., Custer, A., Einheber, S., Salzer, J. L.,Trimmer, J. S., Shrager, P. and Peles, E. (1999). Caspr2, a new memberof the neurexin superfamily, is localized at the juxtaparanodes of myelinatedaxons and associates with K+ channels. Neuron24, 1037-1047.

Rios, J. C., Rubin, M., St Martin, M., Downey, R. T., Einheber, S.,Rosenbluth, J., Levinson, S. R., Bhat, M. A. and Salzer, J. L. (2003).Paranodal interactions regulate expression of sodium channel subtypes andprovide a diffusion barrier for the node of Ranvier. J. Neurosci.23, 7001-7011.

Schulte, J., Tepass, U. and Auld, V. J. (2003). Gliotactin, a novel marker oftricellular junctions, is necessary for septate junction development inDrosophila. J. Cell Biol.161, 991-1000.

Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M., Pattatucci, A. M.,Kaufmann, T. C. and Kennison, J. A. (1992). brahma, a regulator ofDrosophilahomeotic genes structurally related to the yeast transcriptionalactivator SNF2/SWI2. Cell68, 561-572.

Tepass, U. and Hartenstein, V. (1994). The development of cellular junctionsin the Drosophila embryo. Dev. Biol.161, 563-596.

Thummel, C. S., Boulet, A. M. and Lipshitz, H. D. (1988). Vectors forDrosophila P-element-mediated transformation and tissue culturetransfection. Gene74, 445-456.

Traka, M., Dupree, J. L., Popko, B. and Karagogeos, D. (2002). Theneuronal adhesion protein TAG-1 is expressed by Schwann cells andoligodendrocytes and is localized to the juxtaparanodal region of myelinatedfibers. J. Neurosci. 22, 3016-3024.

Traka, M., Goutebroze, L., Denisenko, N., Bessa, M., Nifli, A., Havaki, S.,Iwakura, Y., Fukamauchi, F., Watanabe, K., Soliven, B. et al. (2003).Association of TAG-1 with Caspr2 is essential for the molecularorganization of juxtaparanodal regions of myelinated fibers. J. Cell Biol.162, 1161-1172.

Ward, R. E., Lamb, R. S. and Fehon, R. G. (1998). A conserved functionaldomain of Drosophila coracleis required for localization at the septatejunction and has membrane-organizing activity.J. Cell Biol. 140, 1463-1473.

Willott, E., Balda, M. S., Fanning, A. S., Jameson, B., van Itallie, C. andAnderson, J. M. (1993). The tight junction protein ZO-1 is homologous tothe Drosophila discs-large tumor suppressor protein of septate junctions.Proc. Natl. Acad. Sci. USA 90, 7834-7838.

Woods, D. F., Hough, C., Peel, D., Callaini, G. and Bryant, P. J. (1996).Dlg protein is required for junction structure, cell polarity, and proliferationcontrol in Drosophilaepithelia. J. Cell Biol. 134, 1469-1482.

Wu, V. M., Schulte, J., Hirschi, A., Tepass, U. and Beitel, G. J. (2004).Sinuous is a Drosophilaclaudin required for septate junction organizationand epithelial tube size control. J. Cell Biol.164, 313-323.

Yoshihara, Y., Kawasaki, M., Tamada, A., Nagata, S., Kagamiyama, H.and Mori, K. (1995). Overlapping and differential expression of BIG-2,BIG-1, TAG-1, and F3, four members of an axon-associated cell adhesionmolecule subgroup of the immunoglobulin superfamily. J. Neurobiol.28,51-69.


drosophilacontactin, a homolog of vertebrate contactin, is ... · solute/solvent exchange and the...

Documents