ebna3c-mediated regulat ion of aurora kinase b...
TRANSCRIPT
1
EBNA3C-mediated regulation of Aurora Kinase B contributes to EBV-1
induced B-cell proliferation through modulation of the activities of Rb and 2
apoptotic Caspases 3
4
Hem Chandra Jhaa, Jie Lua, Abhik Sahaa, Qiliang Caia, Shuvomoy Banerjeea, Mahadesh 5
A. J. Prasada, Erle S. Robertsona* 6
7
Short Title: EBNA3C regulates Aurora Kinase B 8
9
Department of Microbiology and Tumor Virology Program, 10
Abramson Cancer Center, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, 11
PA-19104, USAa 12
13
14
* Corresponding author 15 Mail address: 3610 Hamilton Walk, 201E Johnson Pavilion, Philadelphia, PA 19104 16
Phone: 1-215-746-0114/0116 17
Fax: 1-215-898-9557 18
Email: [email protected] 19
20
Keywords: oncogenesis; apoptosis; nuclear blebbing; AK-B; ubiquitination; cell proliferation; 21
Caspase 3; Caspase 9 22
23
24
JVI Accepts, published online ahead of print on 28 August 2013J. Virol. doi:10.1128/JVI.02379-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
2
ABSTRACT 25
Epstein-Barr virus (EBV) is an oncogenic gammaherpesvirus implicated in several 26
human malignancies including Burkitt's (BL), post-transplant lymphoproliferative disease 27
(PTLD), nasopharyngeal carcinoma (NPC), and AIDS-associated lymphomas. Epstein-Barr 28
nuclear antigen 3C (EBNA3C) one of the essential EBV latent antigens can induce mammalian 29
cell cycle progression through its interaction with cell cycle regulators. Aurora Kinase B (AK-B) 30
is important for cell division and deregulation of AK-B is associated with aneuploidy, 31
incomplete mitotic exit and cell death. Our present study shows that EBNA3C contributes to up-32
regulation of AK-B transcript levels by enhancing the activity of its promoter. Further, EBNA3C 33
also increased the stability of the AK-B protein, and the presence of EBNA3C leads to reduced 34
ubiquitination of AK-B. Importantly, EBNA3C in association with wild-type AK-B but not with 35
its kinase-dead mutant led to enhanced cell proliferation and AK-B knockdown can induce 36
nuclear blebbing and cell death. This phenomena was rescued in the presence of EBNA3C. 37
Knockdown of AK-B resulted in activation of Caspase 3 and Caspase 9, along with PARP1 38
cleavage which is known to be an important contributor to apoptotic signaling. Importantly, 39
EBNA3C failed to stabilize the kinase-dead mutant of AK-B compared to wild-type AK-B 40
which suggests a role for the kinase domain in AK-B stabilization, and downstream 41
phosphorylation of the cell cycle regulator Rb. This study demonstrates the functional relevance 42
of AK-B kinase activity in EBNA3C-regulated B-cell proliferation and apoptosis. 43
44
45
46
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
3
INTRODUCTION: 47
Epstein-Barr virus (EBV) was the first DNA tumor virus shown to be linked with human 48
malignancy (17). It infects approximately 95% of the adult population (24). EBV is an oncogenic 49
human gammaherpesvirus associated with several cancers including Burkitt’s lymphoma (BL), 50
post transplant lymphoproliferative disease (PTLDs), nasopharyngeal carcinoma (NPC), and 51
HIV-associated lymphomas (78). In vitro EBV infection of primary human B- cells leads to 52
indefinitely proliferating lymphoblastoid cell lines (LCLs). In primary B-cell infection, the first 53
viral proteins expressed are Epstein-Barr nuclear antigens: EBNA1, -2, -3A,-3B, -3C, and –LP 54
(75). Three latent membrane proteins are also expressed following primary B-cell infection (65). 55
Expression of these latent transcripts results in up-regulation of various cellular genes important 56
for transitioning resting B-cells into the cell cycle (65). One of these nuclear antigens, EBNA3C 57
has cell cycle regulatory functions (34, 35, 37), and earlier studies have shown that EBV affects 58
expression of regulatory genes in particular Cyclin A, p27, cdc2, Cyclin E, and Cyclin D1 in 59
infected B-cells (26, 35, 37, 59). 60
The Aurora kinase (AK) family is a group of serine/threonine kinases that are crucial 61
controllers of mitosis. They plays key roles in accurate segregation of genomic material from 62
parent to daughter cells (30). Furthermore, AK members are engaged in multiple aspects of 63
mitosis and cell division, mitotic spindle formation, including centrosome duplication, activation 64
of mitotic checkpoint, chromosome alignment, and cytokinesis (10). Errors in the critical steps of 65
these processes eventually lead to early exit from mitosis, aneuploidy and cell death (79). 66
Notably, in earlier studies it was shown that Aurora Kinase B (AK-B) interacted specifically 67
with p53 and Mdm2 (52, 56, 63). Similarly, our studies and others have established that 68
EBNA3C can regulate the activities of the tumor suppressor p53, and the oncoprotein Mdm2 69
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
4
through its N-terminal domain (61). This provides new insights into the functional relevance of 70
the AK-B and EBNA3C interaction, as well as raised new questions regarding whether binding 71
of AK-B to EBNA3C is direct or mediated through p53 or Mdm2. Furthermore, transcription 72
factors known to bind to cis-elements upstream of the AK-B promoters were also previously 73
demonstrated to be significantly associated with EBNA3C (32, 82), and thus this prompted us to 74
investigate their cooperative role with EBNA3C in regulating AK-B expression. 75
AK-B is a mitotic protein kinase which targets tumor suppressors for phosphorylation 76
during the cell cycle progression (47). Our previous studies demonstrated that EBNA3C can 77
target many tumor suppressors thereby disrupting multiple cell cycle checkpoints in the course of 78
viral oncogenesis (37). The retinoblastoma protein (Rb) is an important tumor suppressor 79
previously shown to be targeted by AK-B during the mammalian cell cycle (47). In addition, the 80
kinase activity of AK-B was also found to be crucial for phosphorylation of many other cell 81
cycle substrates (25). Therefore, it is important to determine whether the active kinase domain of 82
AK-B is essential for functional regulation of the cell cycle through interaction with EBNA3C in 83
EBV-mediated cell transformation. EBNA3C may also promote stabilization of AK-B, which 84
can aggressively trigger viral-induced oncogenesis. 85
AK-B is localized to the chromosomes in prophase and on the inner centromere during 86
prometaphase and metaphase (79). In prometaphase, AK-B is accountable for localization and 87
stabilization of centromeric proteins, with peak activity during metaphase and telophase (63). In 88
addition, AK-B activity is also necessary for the proper execution of anaphase and cytokinesis in 89
mammals (56). Therefore, AK-B plays an important role in cell division thus ensuring the 90
accuracy of chromosome segregation (52). Cytokinesis is one of the critical steps in cell division 91
regulated directly or indirectly by a number of viral promoters (51). Earlier, Parker et al showed 92
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
5
that over-expression of EBNA3C can lead to multi-nucleation instead of progressing through the 93
final stage of cell division (53). Aberrant expression of AK-B perturbs checkpoint functions, 94
especially in mitosis, and leads to genetic instability which triggers progression through the cell 95
cycle, and tumor development (71). In addition, over-expression of a AK-B kinase-dead mutant 96
(K/R) causes multiple defects in the mitotic machinery, such as loss of kinetochore attachments 97
to microtubules and premature exit from mitosis without anaphase or cytokinesis (46). Notably, 98
abnormal expression of EBNA3C causes similar or related defects. Moreover, knockdown of 99
AK-B triggers cleavage of Caspase 3, 9 and PARP1 which leads to induction of apoptosis or cell 100
death pathway (77). These apoptosis signals can induce morphological changes in AK-B 101
knockdown cells would be further to explored. The mechanism by which EBNA3C and AK-B 102
regulate the oncogenic process and deregulate apoptosis activated in AK-B knockdown cells will 103
be examined in this study. 104
105
106
107
108
109
110
111
112
113
114
115
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
6
MATERIALS & METHODS: 116
Ethics Statement: University of Pennsylvania CFAR Immunology Core was provided 117
peripheral blood mononuclear cells (PBMCs) from de-identified human. The CFAR 118
Immunology Core maintains an IRB approved protocol in which Declaration of Helsinki 119
protocols were strictly followed. Every donor gave written and informed consent at CFAR 120
Immunology Core (9). 121
Cell cultures, plasmids, antibodies and transfection: 122
pCDNA3/myc/6xHis-Aurora Kinase B wild-type, kinase inactive KR mutant (K106), GFP-Aurora 123
Kinase B wild type, kinase inactive (K106) GFP-Aurora Kinase B were kind gift from Erich A. 124
Nigg (Max-Planck Institute of Biochemistry, Germany). Aurora Kinase B promoter-driven 125
luciferase plasmids pGL3B-AK-B-FL (-1879), pGL3B-AK-B (-337), pGL3B-AK-B (-74) were 126
provided by Yukio Okano (Gifu University School of Medicine, Tsukasamachi, Japan). The 127
lymphoblastoid cell lines (LCL1 and 2), BL41-B95.8, MutuI, MutuIII, BJAB stably expressing 128
EBNA3C clones (BJAB7 and BJAB10) and DG75, BJAB, BL41 were cultured as described 129
earlier (59). pEGFP-EBNA3C full length EBNA3C (residues 1–992), full length EBNA3C-130
dsRed (residues 1-992) and full length flag-tagged EBNA3C (residues 1–992, 1–365, 366–620, 131
621–992) and GST-tagged EBNA3C construct (residues 90-365, 366-581, 582-792, 900-992, 90-132
129, 130-159, 160-190) in pGEX2TK vector have been previously mentioned (34, 61). GST-133
AK-B was kindly provided by Wheatley et al (74). Rabbit polyclonal antibodies reactive to AK-134
B (H-75), Ubiquitin (FL-76), mouse monoclonal for PARP1 (F-2), GFP (F56-BA1), Caspase 3 135
and 9 were purchased from Santa Cruz (Santa Cruz, CA). Mouse monoclonal for GAPDH was 136
obtained from US Biological Corp. (Swampscott, MA). Myc epitope (9E10), flag epitope (M2), 137
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
7
EBNA3C (A10) were described earlier (58). Adherent cells and B cells were transfected as 138
described earlier (8, 60) . 139
RNA interference: 140
Short-hairpin oligonucleotides for EBNA3C, control sh-RNA and p53 were described earlier (7, 141
59). The sequence for AK-B-shRNA sense strand 5’-CGAGACCTATCGCCGCATC and anti 142
sense strand is GCTCTGGATAGCGGCGTAG-3’ (27). These sequences were used for cloning 143
into pGIPZ vector (Open Biosystems, Inc. Huntsville, AL). Cloned double-strand DNA was re-144
confirmed by automatic DNA sequencing. 145
Immunoprecipitation and Western Blotting: 146
Cells were collected, washed with 1XPBS, and lysed in RIPA buffer (10mM Tris, pH7.5, 147
150mM sodium chloride, 2mM EDTA, 1% NP40, protease inhibitor cocktail was added before 148
experiment). Cells in the form of pellet was separated by centrifugation at 15,000 RPM (15 149
minute, 4°C), and the supernatant was transferred to a new microcentrifuge tube. The cell lysates 150
were precleared by rotating with normal rabbit/mouse serum with 1:1 combination of Protein 151
A/G Sepharose beads (2 hr, 4°C). The beads were pelleted, and the supernatant collected. The 152
specific protein was bound by rotating with lysates with 1.5 μg of a suitable specific antibody 153
overnight in a rotating chamber in 4°C. 30 μl of Protein A/G Sepharose beads were combined in 154
a 1:1 ratio and was used to capture the immune complexes and pelleted. The pellets were washed 155
5 times with added protease inhibitor cocktail in RIPA buffer. Western blot and densitometry 156
were performed essentially following as described earlier (60). 157
Infection of PBMCs with BAC GFP-EBV: 158
PBMCs from healthy blood donors were obtained as mentioned above in the ethics statement. As 159
described previously (60), 15 million PBMC's were incubated with EBV in 1.5 ml of RPMI 1640 160
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
8
with 10% FBS for 6-8 hr at 37°C. Further infected cells were pelleted for 5 min at 500xg. The 161
separated cells were mix with complete RPMI 1640 medium. GFP expression for EBV was 162
monitored by microscopy to determine the efficiency of infection. The mRNA and protein levels 163
of EBV infected cells was determined at 0, 2, 4 and 7 days post-infection. EBNA3C, AK-B and 164
GAPDH specific antibodies and primers were used. EBNA3C knockout mutant (BAC GFP-165
EBVΔE3C) was generated using wild-type BAC GFP-EBV constructs and a detailed description 166
was provided earlier (60). All infection procedures for ΔEBNA3C-EBV were similar as for wild-167
type EBV infection of PBMC’s. 168
Reporter assays: 169
Reporter assays were performed as reported earlier (9, 20). In brief, cells were transfected with 170
specific plasmids. Total transfected DNA was normalized with vector control. Additionally, 171
pCMV-βgal construct was also transfected to obtain a measure of transfection efficiency. Cell 172
harvesting and luciferase activity was performed as previously described (9). To measure beta 173
gal assay we used 380 μl cell lysate + 40 μl 10X beta-gal assay reagent (8.8mg/ml o-nitrophenyl-174
β-D-galactopyranoside + 10 mM MgCL2 + 0.45M beta-mercaptoethanol to 1X PBS). Solutions 175
were mixed and incubated at 37°C until color develops. Again reaction was stopped with 700 μl 176
1M Na2CO3 and the absorbance measured at 420 nm in a spectrophotometer. Further, we 177
calculated (RLU/beta-gal activity) to normalize the luciferase values after transfection. 178
Representative blots for GAPDH and EBNA3C after transfection were also shown by Western 179
blotting. 180
Stability assay: 181
HEK-293T cells were transfected with Myc-epitope AK-B with or without Flag-epitope 182
EBNA3C plasmids. Thirty-six hrs post-transfection, the cells were exposed to 40 µg/ml 183
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
9
cyclohexamide (CalBiochem, Gibbstown, NJ). For BJAB cells and LCL1 (sh-control and sh-184
EBNA3C), 25 million cells were incubated with 100 µg/ml cyclohexamide in normal serum 185
medium. Subsequently, proteins were prepared at specific times and immunoblotted with 186
specific antibodies. An Odyssey Imager (LiCor Inc., Lincoln, NE) was used to determine band 187
intensities. 188
Chromatin immunoprecipitation assay: 189
ChIP assays were carried out as described earlier (9). HEK-293T cells (10x106) were transfected 190
with EBNA3C or vector control in one set and BJAB as control and BJAB stable cell lines for 191
EBNA3C (BJAB-7) in the second set. The cells were cross-linked with formaldehyde. The 192
processed purified DNA was analyzed by real-time PCR with specific primers within the AK-B 193
promoter (FP= GAAGCAGAGAAAAAGAGAGAGAGA, RP= 194
ATGATCAGGTAGATCAGAGGGT) chosen within the upstream region of AK-B gene. 195
In vivo ubiquitination assay: 196
25 million cells of BJAB, BJAB-7, BJAB-10, LCL1 (sh-Control and sh-EBNA3C), were 197
immunoprecipitated with 2μg anti-AK-B antibody and Western blotted with anti-ubiqitination, 198
AK-B, EBNA3C and GAPDH antibodies. Cells were incubated for 12 hrs with 20 µM MG132 199
(Santa Cruz, Inc.) 200
Immunofluorescence: 201
IF experiments were carried out as described earlier (8). In brief, HEK-293T cells were plated on 202
coverslips and transfected with required plasmids using Lipofectamine 2000 (Invitrogen, 203
Carlsbad, CA). Thirty-six hrs post transfection, cells were fixed with 4% PFA for 25 mins at RT. 204
The B-cells BJAB, BJAB-7 and LCL1 were semi-air-dried and fixed in similar fashion. 205
Transiently expressed GFP-AK-B and Ds-Red-EBNA3C was detected using green and red 206
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
10
fluorescence channels. In BJAB and LCLs, the AK-B and EBNA3C proteins were detected using 207
their specific antibodies. The slides were examined using confocal microscopy (Olympus Inc., 208
Melville, NY) using the Fluoview FV300 software. 209
Colony formation assay: 210
10 million of HEK-293T and MEF cells were transfected and at 36 hrs post-transfection, 1x104 211
transfected cells were transferred to antibiotic (G418) selection media. The selection media was 212
changed every alternate day during the selection process. After two weeks, cells were fixed with 213
4% PFA and stained with 0.1% crystal violet. The number and intensity of the colonies in all 214
dishes was scanned by Li-Cor Odyssey and counted. 215
Cell cycle assay: 216
Cells were harvested using trypsinization, washed three times with PBS and fixed with a 1:1 217
ratio of methanol: acetone for 12 hrs at 4°C. Further, cells were incubated with 200 μg/ml of 218
RNase A and kept in the -20oC freezer for 3 hrs. The cells were stained with propidium iodide 219
(PI) 40 μg/ml (Sigma, St Louis, MO) in PBS for at least 1 hr at 4°C in the dark. Cells at different 220
cell cycle phases with appropriate controls were differentiated using the FACSCalibur (BD 221
Biosciences, San Joe, CA) and the results were assessed by the FlowJo software (Tree star, 222
Ashland, OR). 223
Cell Proliferation Assay: 224
HEK-293T & MEF cells were used for this experiment. Appropriate plasmids were transfected 225
and stained with CFSE dye after 36 hrs post-transfection. The cells were separated in two 226
groups, one group was fixed with 3% PFA and stored in the dark in a cold chamber. Another 227
group of cells were plated in two and three dishes for each set of transfection for MEF and HEK-228
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
11
293T cells, respectively (in MEF 24 & 48 hr, in HEK-293T- 24, 48 and 72 hrs time point). At 229
respective time points, the cells were washed with 5% FBS in 1X PBS and fixed with 3% PFA. 230
Further, the cells were washed 3x with cold PBS and suspended in 500μL 1X PBS. The cells 231
were then analyzed by flow cytometry with similar setting as described above. 232
Apoptosis assay: 233
Cells with sh-AK-B and sh-control plasmids were transfected in HEK-293T and BJAB cells with 234
Lentivirus packaging system. Thirty-six hrs post-transfection, cells were subjected to 20 μM 235
etoposide (MP Biomedicals) treatments for 12 hrs. Afterwards, the cells were harvested for the 236
PI staining. Etoposide treated cells were collected and fixed with 1:1 acetone, methanol for 2 hrs 237
at 4°C, washed with 1x PBS, and stained with PI (Sigma, St. Louis, MO) and 1 μg/ml RNase for 238
at least 1 hr in the dark at 4oC. The stained cells were subsequently analyzed by flow cytometry 239
as described above. LCLs and AK-B knockdown cells were subjected to further analysis for the 240
cleavage of PARP1, Caspase 3 and 9 antibody. 241
For apoptosis measurement, we used a mixture of ethidium bromide (EB): acrydine orange (AO) 242
dye (1:1). The mixture of dye contains 100 μg/ml AO and 100 μg/ml EB in 1XPBS. HEK-293T 243
cells transiently transfected with AK-B, EBNA3C and AK-B+EBNA3C, 36 hrs post-transfection 244
cells were treated with 12 hrs serum starvation with etoposide. The medium was aspirated and 245
washed with 1X PBS two times. Subsequently, the dye mix (EB: AO) was added for 5 minute 246
followed by two times PBS wash. The slides were monitored for green, red and orange colors 247
using the appropriate filters. Cells were observed and counted by fluorescence microscopy. All 248
assays were done in triplicate, counting a minimum of 400 total cells each to plot a graph for 249
apoptotic index. 250
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
12
To measure the nuclear blebbing in the process of cell death after AK-B knockdown, we 251
transfected AK-B shRNA with control as mentioned above. After 48 hrs post-transfection, cells 252
were washed with 1X PBS and stained with DAPI. The slides were examined by using confocal 253
microscopy as described above. 254
Purification of GST fusion proteins: 255
Escherichia coli BL21-DE3 cells were transformed (using heat shock method) with the 256
expression plasmid constructs for each EBNA3C-GST fusion protein and full length AK-B-GST 257
fusion protein. GST pull-down assays were performed as described earlier (28). 258
Quantitative real time PCR: 259
Trizol reagent was used for RNA extraction methods; further superscript II reverse transcription 260
kit (Invitrogen, Inc., Carlsbad, CA) was used for total RNA to cDNA. The primers using for real-261
time PCR were as follow: for Aurora B: 5’-GGAGAGCTTAAAATTGCAGATTTTG-3’ and 5’-262
TGCAGCTCTTCTGCAGCTCCT- 3’; for EBNA3C: 5’- AAGGGGAGCGTGTGTTGT-3’and 263
5’- GGCTCGTTTTTGACGTCGGC-3’; and for GAPDH: 5’- CTCCTCTGACTTCAACAGC 264
G-3’ and 5’-GC CAAATTCGTTGTCATACCAG-3’. The cDNA was amplified by using 10 μl 265
of Master Mix from the DyNAmo SYBR green quantitative real-time PCR kit, 1 μM of each 266
primer, and 1 μl of the cDNA product in a 10 μl total volume. Thirty cycles of 1 min at 94°C, 30 267
s at 56°C, and 40 s at 72°C were followed by 10 min at 72°C in Step One Plus™ Real-Time PCR 268
System (Applied Biosystem, Foster city, CA). A relative melting curve analysis was performed 269
on the samples analyzed. 270
In vitro kinase assay: 271
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
13
HEK-293T cells (15 million) were transfected with plasmids Myc-AK-B (15 μg), and increasing 272
amount of Flag-EBNA3C. Cells were lysed and protein complexes were immunoprecipitated 273
(IP) using Myc (for AK-B). Further IP complexes containing beads were washed with buffer A 274
(25 mM Tris [pH 7.5], 70 mM NaCl, 10 mM MgCl2, 1 mM EGTA, 1 mM DTT, added protease 275
and phosphatase inhibitors) and kept in 25 ml of kinase buffer B (buffer A plus 10 mM cold 276
ATP, and 0.2 mCi of [c-32P]-ATP/ml) incubated with bacterially purified GST-Rb (aa 792-928) 277
for 25 minute at 30°C water bath. 2X Laemmli buffer was added to stop the reaction and heating 278
to 95°C for 10 min. ATP-labeled proteins were separated by 12% SDS-PAGE gel. The signal 279
intensities were measured using the Image Quant software (GE Healthcare Biosciences, 280
Pittsburgh, PA). 281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
14
RESULTS: 296
EBV infection leads to elevated Aurora Kinase B expression: 297
Elevated expression of AK-B was shown to be associated with many human cancers (19). We 298
wanted to investigate if this was also true for EBV associated cancers. Further, we questioned 299
whether induced AK-B levels was linked to expression of the essential and highly potent EBV 300
essential antigen EBNA3C. First, we compared EBV-positive BL41/B95.8 Burkitt’s lymphoma 301
(BL) cells with the isogenic EBV-negative BL41 control cells. The results showed increased 302
expression levels of 3-5 fold for AK-B at the RNA and protein levels in EBV positive cells (Fig. 303
1A). Next, we monitored AK-B expression in type I latency compared to latency type III, namely 304
Mutu I and Mutu III BL cells, respectively. Interestingly, we found enhanced AK-B expression 305
in Mutu III compared to Mutu I cells, suggesting that the differential expression pattern of latent 306
antigens associated with the type III latency program may directly contribute to enhanced 307
expression of AK-B (Fig. 1B). Therefore one of the latent antigens expressed during latency III 308
may contribute to AK-B up-regulation. Similarly, we observed higher AK-B expression at both 309
the RNA and protein levels in EBV transformed LCLs with type III latency, when compared to 310
uninfected peripheral blood mononuclear cells (PBMCs) (Fig. 1C). 311
To determine whether the change in AK-B expression levels was initiated early in viral 312
infection or was only associated during latency we monitored AK-B expression both at the 313
transcript and protein levels in PBMCs in response to EBV infection over a period of seven days 314
using four different donors. The results clearly demonstrated that expression of AK-B was higher 315
at the RNA and protein levels by 2 days post-infection (Fig. 1D), which corresponded to 316
expression of EBNA3C, one of the essential latent antigens shown to regulate multiple viral and 317
cellular proteins involved in B-cell proliferation (Fig. 1D). This result strongly indicated that 318
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
15
EBV infection and probably the expression of EBNA3C led to an enhanced AK-B expression 319
and consequently a role in driving B-cell proliferation. 320
321
EBNA3C expression is associated with a substantial increase in AK-B expression: 322
To monitor the specific effect with EBNA3C in regulating AK-B expression during primary 323
infection, we next infected PBMCs with an EBNA3C knockout (KO) virus EBV BAC-GFP 324
ΔE3C. Strikingly, AK-B expression was rapidly down-regulated quite early by 2 days post-325
infection, but interestingly began to increase to a level which approximately matched the 326
uninfected control by 7 days post-infection (Fig. 1D). This indicated that AK-B expression was 327
likely regulated by a latent nuclear antigen EBNA3C during infection within this early period. 328
Furthermore, since AK-B is important in cytokinesis, even after infection with the EBNA3C KO 329
virus, one would expect a similar level of AK-B up-regulation which was clearly seen by 7 days 330
post-infection. This strongly suggested that other viral antigens expressed later may play an 331
important role during EBV infection (Fig. 1D). We also compared the AK-B expression levels 332
using an EBNA3C-sh knockdown LCL compared to an EBNA3C positive LCL sh-control cells. 333
The results demonstrated that the expression profile of AK-B at the mRNA and protein levels 334
were significantly down-regulated (Fig. 1E). This result strengthened our hypothesis that 335
EBNA3C expression was positively associated with AK-B in EBV infected cells irrespective of 336
whether or not it was early or during latent infection. To further corroborate this finding, we 337
extended our investigation using EBNA3C stable cell lines. As expected, our results using two 338
BJAB clones 7 and 10 which are EBNA3C-positive, showed significantly higher expression of 339
AK-B when compared to control EBNA3C-negative BJAB cells (Fig. 1F). Further to confirm 340
that the up-regulation of AK-B was only directed through EBNA3C or by other EBV essential 341
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
16
proteins like LMP1, EBNA2 and EBNALP, we monitored AK-B expression in P3HR1 and 342
Jijoye cells. It is well known that P3HR1 is truncated for EBNALP and null for EBNA2 and has 343
minimal expression of LMP1 compared to its parental Jijoye cell line, where these genes 344
expressed (49). Importantly, expression of EBNA3C was similar in both cell line which was 345
important to evaluate the AK-B levels. Interestingly, AK-B expression was found similar in both 346
cell lines and so reduced the possible influence of EBNALP, EBNA2 and LMP1 on regulation of 347
AK-B in EBV-induced oncogenesis (Fig. 1G). 348
349
Up-regulation of AK-B through EBNA3C is independent of p53 and Mdm2: 350
The above studies demonstrated an up-regulation of AK-B in EBV-infected primary cells and 351
EBNA3C positive cell lines. We also knew from previous studies that AK-B phosphorylation of 352
p53 regulates its degradation (31), and that EBNA3C can also regulate p53 (61). Therefore we 353
wanted to determine, if AK-B regulated by EBNA3C was dependent on p53 or Mdm2 at the 354
transcript and proteins levels. To rule out the influence of p53 and Mdm2 on the regulation of 355
AK-B by EBNA3C, we used three different cell lines: a p53 null cell line, Saos-2 (62), both p53 356
and Mdm2 knockout mouse embryonic fibroblast, MEF (p53-/- Mdm2-/-) (80), and HEK-293T 357
(69) positive for both p53 and Mdm2. HEK-293T cells are also functionally deregulated for p53 358
by both SV40 large T and adenovirus E1A antigens (69). We performed reporter assays in these 359
cells using the AK-B upstream regulatory regions identified from the AK-B promoter (70). 360
Promoter regulatory sequences from -1879, -337 and -74 to +1 cloned into a luciferase reporter 361
vector were transiently transfected in these cell lines in the presence of an EBNA3C expression 362
construct. Interestingly, similar results were obtained in all 3 cell lines suggesting that the 363
regulation of p53 and Mdm2 by EBNA3C is likely to be independent of its regulation of AK-B 364
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
17
transcription (Fig. 2A-D). To rule out differences in the cellular background for p53 null cells, 365
and examine AK-B expression in a more physiological background, similar luciferase reporter 366
assays were performed in EBV-transformed LCL1, LCL1-shcontrol, LCL1-shp53 and similar 367
results were obtained (Fig. 2E-G). To determine engagement of other possible transcription 368
factors regulating AK-B transcription, we used the three different constructs of the AK-B 369
promoter, including the wild-type -1879 along with other two small truncations -337 and -74. 370
The promoter region consisting of sequences within the -1879 and -74 region contains the ETS-1 371
binding site, whereas the -337 truncation lacks this site (70). The results from the luciferase 372
assays illustrated that the transcription activity of the AK-B promoter region increased in a dose-373
dependent fashion in the presence of an increasing level of EBNA3C in all three cell lines (Fig. 374
2B-D). The pattern of activity seen from each analysis suggests that EBNA3C-mediated 375
enhancement of the AK-B promoter activity was also independent of the ETS-1 binding site 376
within the AK-B promoter (Fig. 2B-C, compared with 2D). Similar responses were also seen 377
with LCL1 knockdown for p53 further confirming that p53 was not a major contributor to AK-B 378
induction by EBNA3C (Fig. 2E-G). To monitor the transfection efficiency in the above reporter 379
assays, cells were additionally transfected with a plasmid expressing beta-galactosidase under 380
control of the CMV promoter (Fig. 2B-D). Western blot analyses of dose dependent EBNA3C 381
expression and GAPDH as an internal control reflected that the measured AK-B transcriptional 382
activity was without any bias due to plasmid transfection or variation in protein concentration 383
(Fig. 2B-D). To further validate the results of the transcription assays, we performed chromatin-384
immunoprecipitation (ChIP) analysis using primers for the AK-B upstream region in both HEK-385
293T as well as BJAB cells (Fig. 2H-I). BJAB vector control cells and BJAB cells stably 386
expressing EBNA3C (BJ-7), and Flag-tagged EBNA3C or empty vector control were ectopically 387
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
18
expressed in the case of HEK-293T cells (Fig. 2H and 2I, respectively). An EBNA3C specific 388
monoclonal antibody (A10) was used with matching isotype IgG controls for 389
immunoprecipitation of the complex containing the AK-B promoter region associated with 390
EBNA3C. The 18S rRNA was used as the housekeeping gene for data normalization (Fig. 2H). 391
Immunoprecipitation was carried out using the flag specific mouse monoclonal M2 antibody 392
(Fig. 2I). The results showed that enrichment of the AK-B promoter region (-74 to +1) was 393
approximately 2-4 fold greater in the presence of EBNA3C (Fig. 2H-I), clearly demonstrating 394
that EBNA3C was associated with the AK-B upstream regulatory region within the -74 to +1 395
region most likely through its interaction within a complex containing another transcription 396
factor, as EBNA3C is not known to bind directly to DNA. 397
AK-B regulates the degradation of p53 through phosphorylation (72), and can 398
phosphorylate tumor suppressors which is regulated by EBNA3C (47). Therefore, we wanted to 399
evaluate if the kinase activity of AK-B can be regulated by the formation of a complex between 400
EBNA3C and AK-B. Further, we would like to monitor if the interaction between EBNA3C and 401
AK-B did not involve a role for p53 and Mdm2 previously shown to form a ternary complex 402
with EBNA3C (38). 403
We performed immunoprecipitation and pull-down assays in HEK-293T cells (Fig. 3A). 404
Co-immunoprecipitation using antibodies specific for the Flag and Myc epitopes resulted in 405
complexes that included both EBNA3C and AK-B (Fig. 3A), demonstrating a significant 406
association between EBNA3C and AK-B. To determine if it was part of a complex with p53, we 407
repeated these experiments in Saos-2 (p53-/-) cells. The results also showed a similar or slightly 408
stronger association between AK-B and EBNA3C (Fig. 3B). To further determine whether p53 409
and/or Mdm2 were involved in binding activities, we used a MEF cell-line double-knockout for 410
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
19
both p53 and Mdm2 (80). The results provided additional evidence that the interaction between 411
EBNA3C and AK-B was independent of both p53 and Mdm2 (Fig. 3C). To evaluate the 412
presence of an endogenous complex containing AK-B and EBNA3C in EBV positive cell lines, 413
we performed immunoprecipitation assays by using an AK-B specific antibody to extracts from 414
BJAB-7 and 10 (EBNA3C positive) compared to BJAB vector control (EBNA3C negative) cells, 415
and the reverse immunoprecipitation with A10 antibody for EBNA3C in these cells. 416
Interestingly, in both immunoprecipitation assays we found a significant association of AK-B 417
with EBNA3C compared to non-specific IgG and control BJAB cells (Fig. 3D). We wanted to 418
confirm this association in an EBV-transformed LCLs background, and performed 419
immunoprecipitation for AK-B and EBNA3C in LCL1 and 2 cells compared to BJAB. As 420
expected from earlier trends, the association of AK-B and EBNA3C was significantly higher in 421
EBV transformed LCLs (Fig. 3E). 422
To identify the specific region of EBNA3C which interacts with AK-B, we performed 423
immunoprecipitation and GST pull-down assays with three EBNA3C truncations combined with 424
AK-B (Fig. 3F-G). Our results demonstrated that the N-terminal 1-365 residues of EBNA3C 425
bound to AK-B. From these assays we identified the first 365 aa's of EBNA3C as the region 426
responsible for interaction with AK-B. To more precisely map the interacting domain HEK-293T 427
cells were transfected with the full length (1-992) and 3 regions (1-365, 366-620, 621-992) of 428
EBNA3C all tagged with Flag epitope and immunoprecipitated with the Flag specific antibody 429
M2. This was followed by Western blot analysis for Myc-AK-B to detect the co-430
immunoprecipitating EBNA3C region. The AK-B specific Myc tagged antigen showed an 431
association with the amino terminal 365 residues in these cells (Fig. 3G). Further, residue 90-365 432
showed stronger binding activity compared to the other regions in a GST pull-down assays with 433
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
20
other regions (Fig. 3H). To further narrow down the binding residues within the EBNA3C N-434
terminal region, we performed GST pull-down experiments including EBNA3C residues 90-325, 435
90-129, 130-159 and 160-190, previously reported to interact with other known cellular proteins 436
(34, 35, 37). While our results showed that the EBNA3C N-terminal residues 90-129 and 130-437
159 can form a stable complex with AK-B, the binding activity was somewhat lower with 438
residues 130-159 (Fig. 3I), indicating that the predominant binding region of EBNA3C which 439
associated with AK-B was located within the 90-129 residues (Fig. 3J). 440
The residues 90-160 of EBNA3C is responsible for interacting with AK-B with the 441
residues 90-129 showing stronger binding. To further support our data above, we performed co-442
localization studies using both ectopic as well as endogenous expression systems for AK-B and 443
EBNA3C. A significant (>50%) co-localization of these two proteins was seen (P<0.01), in 444
HEK-293T cells, when they were transiently co-expressed (Fig. 4A top panels). In parallel 445
experiments using one of the EBV-transformed LCL1, and a stably EBNA3C expressing BL cell 446
line, BJAB-7, a greater than 65% co-localization pattern (66-72%) was seen for AK-B and 447
EBNA3C (Fig. 4B). These results suggest that EBNA3C and AK-B were localized in similar 448
nuclear compartments in both EBNA3C-positive and EBV-infected B-cells (Fig. 4B). 449
Importantly, the co-localization pattern of EBNA3C with the kinase-dead mutant of AK-B (AK-450
B-K/R) was substantially reduced indicating that the K106R residue in AK-B was important for 451
the co-localization activity (Fig. 4A compared to 4B). The overall intensity of AK-B signals was 452
notably lower in BJAB control cells when compared to EBNA3C positive BJAB-7 cell line (Fig. 453
4B). This finding further corroborates our previous data that EBNA3C enhances AK-B 454
expression in B-lymphocyte and EBV-transformed LCLs. 455
EBNA3C stabilizes wild-type AK-B but not its kinase-dead mutant: 456
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
21
Increased transcriptional activity of the AK-B promoter in response to EBNA3C expression, co-457
localization of AK-B with EBNA3C as well as complex formation between AK-B and EBNA3C 458
in EBV-infected cells prompted us to investigate the changes in AK-B protein levels in four 459
different cell backgrounds, BJAB, HEK-293T, Saos-2 (p53-/-) and MEF (p53-/- Mdm2-/-). The 460
results portrayed a similar pattern of endogenous AK-B protein expression with increasing 461
concentrations of EBNA3C (data not shown). Therefore, EBNA3C may also play a role in AK-B 462
protein regulation along with its transcriptional regulation. To determine the protein stability of 463
AK-B in the absence and the presence of EBNA3C, we performed an experiment in HEK-293T 464
cells using cyclohexamide, which blocks protein synthesis (Fig. 5A). The results demonstrated 465
that in the absence of EBNA3C endogenous AK-B was dramatically degraded, whereas in the 466
presence of EBNA3C the rate of AK-B degradation was significantly reduced as much as 10 fold 467
(Fig. 5A). Furthermore, we used BJAB cells stably expressing EBNA3C and an EBV-468
transformed LCL1 with EBNA3C knockdown using a shRNA strategy and vector control (Fig. 469
5B and 5C). In all EBNA3C expressing cells, the stability of AK-B was significantly higher 470
compared to EBNA3C negative cells. Additionally, we checked the kinase-dead mutant AK-B-471
K/R for its stability compared to wild type AK-B in the presence of EBNA3C. Importantly, we 472
observed that EBNA3C was unable to stabilize the AK-BK/R mutant (Fig. 5D). To determine 473
whether the kinase domain effect was not cell line specific, we also evaluated the protein 474
stability in HEK-293T (Fig. 5D), as well as BJAB cells (data not shown) and observed a similar 475
degradation pattern. To further investigate the EBNA3C domain responsible for AK-B 476
interaction and regulation, we introduced a point mutation at residue 120 of EBNA3C to alanine, 477
the only lysine present in the 101-200 amino acids of EBNA3C (37). We hypothesized that this 478
residue K120 may be critical for regulating ubiquitination and subsequently degradation of 479
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
22
binding partners. We compared this K120A EBNA3C mutant to the wild-type EBNA3C in terms 480
of its ability to stabilize AK-B. Our results demonstrated that EBNA3C-K120A failed to stabilize 481
AK-B to the same extent as wild type EBNA3C (right panel of Fig. 5E), indicating the 482
importance of this particular lysine residue in regulating the stability of AK-B which was further 483
validated in BJAB cells (data not shown). Interestingly, reporter assays using the K120A 484
EBNA3C mutant compared to the wild-type protein, demonstrated that the K120 residue was 485
particularly important for up-regulation of AK-B transcription in addition to regulation of its 486
stability (data not shown). 487
488
AK-B ubiquitination is substantially reduced in the presence of EBNA3C: 489
A number of earlier studies have shown that EBNA3C regulates stability of multiple cellular 490
proteins through modulation of the ubiquitin-proteasome pathway (37, 59, 61). In addition, AK-491
B was also shown to be functionally deactivated or degraded through enhanced ubiquitination 492
(42, 48). To investigate whether EBNA3C can regulate AK-B stabilization through 493
ubiquitination, we performed ubiquitination assays using EBNA3C stable cell lines BJAB-7 and 494
BJAB-10 along with their negative counterpart BJAB control cell lines (Fig. 5F). The results 495
strongly supported our previous hypothesis showing a dramatic inhibition of AK-B 496
ubiquitination in presence of EBNA3C (Fig. 5F). To monitor this effect of EBNA3C in EBV 497
transformed LCLs, we used EBV LCLs with EBNA3C knockdown by shRNA compared to 498
control vector (Fig. 5G). Surprisingly, we found higher AK-B ubiquitination in the EBNA3C 499
knockdown LCLs compared to control vector (Fig. 5G). These results again demonstrated that 500
AK-B ubiquitination was reduced in EBNA3C expressing Burkitt's lymphoma cells as well as in 501
EBV-transformed LCLs. Additionally we performed ubiquitination assays in two independent 502
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
23
EBV-positive LCLs and the matched BL cells, Mutu I and Mutu III with type I and III latency 503
(data not shown). A similar trend was demonstrated showing less ubiquitination of AK-B in 504
Mutu III as compared to Mutu I as well as in LCLs as compared to DG75 cells. Therefore, our 505
results stressed a general model where EBNA3C can enhances the stability of AK-B most likely 506
through regulation of its ubiquitination activity. 507
508
EBNA3C enhanced Rb phosphorylation by AK-B kinase: 509
The above findings led us to hypothesize that EBNA3C mediated stabilization of AK-B is likely 510
to enhance cell cycle progression. Since, AK-B regulation is important for proper cell division 511
(56), the functional crosstalk between EBNA3C and AK-B strongly suggested an active role for 512
EBNA3C in regulating AK-B kinase activity during cell cycle. Earlier study by Nair et al, 513
suggested that AK-B phosphorylated Rb at S780 facilitates the G1-S phase transition of the cell 514
cycle (47). In addition, EBNA3C was also previously shown to be significantly involved in 515
regulating Rb phosphorylation and degradation, thereby enhancing G1-S phase transition (34). 516
Therefore, we wanted to verify whether EBNA3C in association with AK-B can enhance Rb 517
phosphorylation. We performed an in vitro kinase assay using the immunoprecipitated complex 518
of either GFP-tagged wild-type AK-B or its kinase-dead mutant in the presence and absence of 519
EBNA3C on bacterially purified GST-Rb fusion polypeptide containing residues 792-928. The 520
results showed that AK-B mediated phosphorylation of Rb was significantly enhanced (greater 521
than to 5-fold) with EBNA3C expression, whereas as expected the kinase-dead mutant AK-522
BK/R failed to phosphorylate Rb with EBNA3C expression (Fig. 6A compare lane 2 & 4 with 3 523
& 5). This data demonstrated that AK-B phosphorylation of Rb is enhanced in the presence of 524
EBNA3C and so may also result in increased cell proliferation due to Rb phosphorylation and its 525
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
24
degradation. We then performed colony formation assays to monitor the abolition of Rb tumor 526
suppressor activities in the presence of AK-B wild type compared to the kinase-dead mutant in 527
the presence of EBNA3C (Fig. 6B). As expected from kinase assay result above, we observed a 528
dramatic diminution of Rb's anti-proliferative effects in the presence of wild type AK-B and 529
EBNA3C (Fig. 6B). The increased colonies were clearly seen with AK-B and further enhanced 530
by AK-B and EBNA3C (Fig. 6B, lanes 4 & 7). Importantly, the kinase-dead mutant of AK-B 531
was unable to show similar activity as its wild type counterpart where the number of colonies 532
were similar to vector alone control or slightly better than Rb alone (Fig. 6B, lane 1-3). 533
534
EBNA3C co-expressed with AK-B significantly accelerated cell proliferation: 535
To determine if EBNA3C-mediated stabilization and enhanced kinase activity of AK-B is 536
important for oncogenesis through aberrant cell proliferation, we performed 2 separate assays as 537
a measure of cell proliferation. Colony formation assays (CFA) and CFSE (5-and -6-538
carboxyfluorescein diacetate succinimidyl ester) staining can be both used as indicators of cell 539
proliferation (Fig. 7). CFA were performed in MEF (p53-/- Mdm2-/-) and HEK-293T (p53+/+ 540
Mdm2+/+) cells using plasmids expressing EBNA3C, AK-B and the kinase-dead mutant of AK-541
B. The results of CFA indicated that the cumulative effects of both the AK-B and EBNA3C 542
oncoproteins were independent of p53 and Mdm2 expression. This reflected a co-operation 543
between AK-B and EBNA3C in driving cell proliferation as cells expressing both AK-B and 544
EBNA3C showed a significant increase in colony numbers compared to cells transfected with a 545
single plasmid expressing either AK-B or EBNA3C (Fig. 7A left panel). Interestingly, when 546
EBNA3C was expressed with mutant AK-BK/R, a similar effect in colony formation ability was 547
seen as with EBNA3C (Fig. 7 compare A and B). This result corroborates our previous findings 548
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
25
in which the mutant AK-B had no increase in protein stability, significantly less co-localization, 549
and little or no effect on Rb phosphorylation in the presence of EBNA3C. To determine whether 550
the binding region of EBNA3C is directly involved in AK-B mediated cell proliferation, we 551
further extended the colony formation experiments in the presence of wild-type AK-B in 552
combination with three major EBNA3C truncated polypeptides comprising the N-terminal region 553
(residues 1-365), middle part (residues 366-620) and the C-terminal region (residues 621-992) 554
along with full-length EBNA3C (Fig. 7E). Interestingly, the results demonstrated a dramatic 555
increase in the number of colonies in the presence of the N-terminal domain of EBNA3C when 556
compared to either the middle part or the C-terminal region when combined with wild-type AK-557
B expression (Fig. 7E). This supports our hypothesis that the interaction between EBNA3C and 558
AK-B particularly the amino terminal region of EBNA3C is important for EBV-induced cell 559
proliferation. 560
To further explore the functional relevance of the interaction of AK-B and EBNA3C, we 561
used CFSE staining which provides a reproducible, as well as a quantitative approach for the 562
determination of cell proliferation (45). The CFSE stained cells were analyzed by FACS and 563
quantitation was based on the relative staining intensity in subsequent cell generations. MEF and 564
HEK-293T cells were used in this experiment to determine their proliferation when plasmids 565
expressing either AK-B or its kinase-dead mutant was transfected in combination with EBNA3C 566
(Fig. 7C and D). The results demonstrated that the rate of cell proliferation was significantly 567
higher in the presence of EBNA3C when combined with wild-type AK-B but not with its kinase-568
dead mutant AK-B K/R (Fig. 7C and D). These results strongly suggest that cell proliferation 569
was strongly enhanced when AK-B and EBNA3C were co-expressed in the same cell 570
background. 571
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
26
AK-B knockdown LCLs led to cleavage of Caspase 3 and 9 dependent apoptosis 572
Apoptosis is an important determinant of cancer progression (41). However, the regulation of 573
apoptosis and cell proliferation requires a fine balance which controls cell survival leading to 574
tumor formation. To evaluate the effects of AK-B and EBNA3C on the oncogenic process 575
induced by EBV, we performed apoptosis assays by transiently transfecting HEK-293T cells 576
with different plasmids expressing EBNA3C, AK-B, and a combination of AK-B with EBNA3C. 577
In these experiments, a separate panel for vector control was also included that showed more 578
apoptosis than the AK-B wild type group. Moreover to show the specific effect of EBNA3C with 579
AK-B, we presented only AK-B, EBNA3C, and AK-B combined with EBNA3C. EBNA3C 580
when co-expressed with wild-type AK-B showed the maximum level of resistance to etoposide 581
induced apoptosis as compared to cells with expression of only EBNA3C or AK-B (Fig. 8A-B). 582
To specifically visualize the apoptotic cells and quantitatively distinguished them from necrotic 583
cells, we performed apoptosis assays using an Ethidium Bromide and Acridine Orange staining 584
strategy (29, 55) (Fig. 8A). Cells are classified into four different groups, including pre-585
apoptotic, late apoptotic, necrotic and live cells (29). The results clearly demonstrated that AK-B 586
transfected cells were more prone to apoptotic induction compared to cells with either EBNA3C 587
alone or in combination with AK-B as seen by a drop between 2-4 fold in apoptotic levels (Fig. 588
8A). Together, these results further strengthened our earlier findings that coupled expression of 589
EBNA3C and AK-B can lead to enhanced cell proliferation, which are perhaps mediated in part 590
through blocking of cellular apoptosis. To validate our findings, we monitored cell proliferation 591
after serum starvation and release at specific time intervals, which precisely allowed us to 592
determine the combinatorial effect of both EBNA3C and AK-B on cell proliferation at a specific 593
phase in the cell cycle. Similar combinations of plasmids were transiently transfected into HEK-594
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
27
293T cells. Nearly identical patterns were seen for the apoptotic induction assays above (Fig. 595
8B). We analyzed two types of cell populations, one arrested in the G0-G1 phase and the other in 596
the G2-M phases. We narrowed our analysis to focus on AK-B, EBNA3C, and EBNA3C plus 597
AK-B expressing cells during these two phases of the cell cycle and collected data at 12, 16 and 598
24 hrs. Our results revealed that cells were typically transitioning from G1 to S in 10-12 hrs and 599
entering into the mitotic phase (M) by 24 hrs (Fig. 8B). Overall, our results suggest that cells 600
arrested in the G1 phase due to serum starvation and released in normal serum were not able to 601
promote normal cell proliferation only in the presence of AK-B expression. However, EBNA3C 602
expression alone, or the combined expression of EBNA3C with AK-B can lead to active cell 603
proliferation (Fig. 8B). This result further enhanced the evidence that the oncogenic activity of 604
AK-B led to a further increase in EBNA3C expressing cells, and this activity may be further 605
extended to EBV transformed B-cells. 606
To monitor the effect of AK-B knockdown in cells, we generated AK-B knockdown 607
HEK-293T, BJAB and LCL1 cells using lentiviral construct expressing short hairpin which 608
specifically targets AK-B expression. We confirmed knockdown of AK-B by Western blotting 609
(Fig. 9A, data not shown for HEK-293T and BJAB). Further, we also used etoposide treatment 610
to evaluate apoptosis induction in AK-B knockdown cells, by determining PARP1 cleavage and 611
measuring the cell death population in subG1 phase (Fig. 9A). Expectedly, etoposide treatment 612
led to a significant enhancement in PARP1 cleavage and cell death either through apoptosis or 613
necrosis (11). Here we observed reduced signals for EBNA3C in AK-B knockdown cells, where 614
PARP1 cleavage was elevated (Fig. 9A). This result was partially supported by our prior 615
investigation where we found that EBV and more specifically EBNA3C showed strong 616
resistance towards PARP1 cleavage after induction of apoptosis (60). To obtain further insights 617
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
28
into activation of apoptosis signal after knockdown of AK-B we monitored the activation of 618
Caspase 3 and 9, by knocking down AK-B in cells (77). To date, no study has shown that AK-B 619
knockdown in B cells can activate the apoptotic pathway. This may be Caspase dependent or 620
independent through internal or external apoptosis signaling to cell death. In line with our 621
previous finding, we now revealed that knockdown of AK-B activated cleavage of Caspase 3 and 622
9 in EBV transformed LCLs (Fig. 9A). 623
624
Nuclear blebbing induced after AK-B knockdown was reduced on expression of EBNA3C: 625
Several reports demonstrated an induction of cell death after AK-B knockdown (52, 56, 71). 626
However, no previous study demonstrated the nuclear-morphological changes with knockdown 627
of AK-B. We now show changes in the nuclear-morphology of cells after AK-B knockdown, 628
which was followed by apoptosis and cell death. Although the precise role of this phenomenon in 629
the induction of apoptosis has not been fully elucidated, we now show that formation of nuclear 630
blebbing was significantly higher in cells with AK-B knockdown compare to vector control (Fig. 631
9B and C). In two separate experiments as seen by the two clones used, cells knocked down for 632
AK-B showed a significant 7-8 fold increase in blebbing compared to control cells (Fig. 9B and 633
C). To determine whether EBNA3C expression can reverse the sh-AK-B-mediated blebbing 634
effect, we transfected the EBNA3C expressing plasmid into both AK-B knockdown cells, clone 635
1 and 2 (Fig. 9D). The results nicely showed that the nuclear blebbing effect was significantly 636
diminished (approximately 50%) in the presence of EBNA3C (Fig. 9D). These results 637
convincingly showed that EBNA3C can regulate the apoptotic signaling pathway through 638
regulation of AK-B stability and Caspase 3 and 9 cleavage as seen by a reduction in the nuclear-639
blebbing phenotype. 640
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
29
DISCUSSION: 641
AK-B is a chromosome passenger protein, which appears in the nucleus during prophase and 642
localizes to the kinetochore in subsequent prometaphase and metaphase (33). It re-localizes to 643
the equatorial spindle during anaphase and telophase (68). Furthermore, during cytokinesis, AK-644
B appears on the contractile ring of the mid-body (13). While deregulation of AK-B has earlier 645
been shown to be associated with many human cancers, the functional role for AK-B in EBV-646
mediated human cancers has not been extensively explained. Recently, a study from our lab 647
showed that the Aurora kinase A (AK-A), the first member of the AK family, was functionally 648
regulated by the latency-associated nuclear antigen (LANA) in KSHV-associated viral 649
oncogenesis (9). However, a role for the other AK-B family members in gammaherpesvirus 650
infected cells remains to be unexplored. AK-B was shown to be critical for accurate cell division 651
(23), and may allow oncogenic viruses to drive proliferation of infected cell in an uncontrolled 652
manner. Thus, identifying the strategy by which AK-B responds to viral infection, and to identify 653
the specific viral antigen critical for B-cell proliferation will add to our understanding of the 654
overall mechanism. Previous studies have shown that the cell-cycle regulatory proteins p53, 655
Mdm2, and Rb are functionally linked to EBNA3C as well as AK-B (18, 31, 36, 38, 47, 61, 76). 656
We previously reported that EBNA3C attenuates both p53 and Rb-mediated functions by 657
blocking their interaction with specific cellular proteins or by enhancing their degradation which 658
contributes to B-cell proliferation (8, 57). It is feasible that the interaction of p53 and Mdm2 with 659
EBNA3C may act as a bridge between AK-B and EBNA3C, or EBNA3C may directly regulate 660
AK-B during progression of the cell cycle. Identification of other cell cycle checkpoint 661
regulators modulated through the AK-B/EBNA3C complex may provide additional clues to 662
further understand EBV-mediated B-cell transformation. 663
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
30
In this study, we showed that AK-B expression was enhanced in EBV positive cell lines 664
at both the protein and mRNA level. Further we observed the specific interaction between these 665
two proteins in EBV and EBNA3C positive cells. Experiments using primary B-cells infected 666
with EBV, showed similar patterns found in established LCLs, Burkitt’s lymphoma, and 667
epithelial cells. EBNA3C is one of four EBV nuclear proteins critical for the transformation of 668
B-lymphocytes in vitro (15, 67). To monitor the specific role of EBNA3C on EBV infection in 669
terms of AK-B expression, we used an EBNA3C deleted EBV virus to infect primary B-cells. 670
The results strongly supported our hypothesis that AK-B levels in the delta EBNA3C infected 671
cells was lower during the initial days of infection. This strongly suggested that regulation of 672
AK-B during early infection was likely to be dependent on EBNA3C expression. Further, the 673
levels of AK-B was also minimal in sh-EBNA3C stable LCL1 compared to controls reflecting a 674
similar phenomenon. The stable knockdown of EBNA3C and the delta EBNA3C-EBV virus 675
gave similar profiles for AK-B expression strongly supporting a direct association and its 676
regulation by EBNA3C. Furthermore, we also observed that lack of EBNA2 expression and 677
reduced expression of LMP1 did not change the endogenous expression of AK-B. These results 678
supported a possible co-regulatory activity between AK-B and EBNA3C as it relates to EBV-679
induced oncogenesis. 680
Several studies demonstrated a direct role for EBNA3C in binding and regulating a 681
number of critical cell-cycle proteins (34, 36, 37). A previous report by Zhao et al has also been 682
shown that the association of ETS-1 binding sites with EBNA3C is through the SPi1/SPiB 683
transcription factor for transcriptional regulation (81). Interestingly, our results showed that 684
EBNA3C can up-regulate AK-B transcription independently of the ETS-1 binding sites. 685
Furthermore, the up-regulation of AK-B in our reporter assays was also independent of both p53 686
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
31
and Mdm2 expression previously shown to be regulated by both EBNA3C and AK-B (38, 61, 687
76). The ChIP analyses further demonstrated that EBNA3C was strongly recruited to the AK-B 688
promoter, reinforcing a role for EBNA3C in regulating AK-B transcription. 689
The strong interaction between AK-B and EBNA3C supported our initial hypothesis 690
based on previous studies which suggested an interaction between EBNA3C and AK-B, with the 691
p53-Mdm2 complex. However, these results showed that this interaction is independent of p53 692
and Mdm2. Additionally, this independent interaction was corroborated in LCLs and Burkitt’s 693
lymphoma cells. Furthermore, we showed a significant level of co-localization of EBNA3C and 694
AK-B consistent with their association in similar nuclear compartments and further supports 695
their potential role in cell division. As expected, co-localization was minimal when AK-BKR 696
and EBNA3C were co-expressed, strongly demonstrating the importance of the kinase domain in 697
regulation of AK-B/EBNA3C-mediated EBV-induced cell proliferation. Moreover, the particular 698
domain of EBNA3C responsible for AK-B regulation was identified as the N-terminal of 699
EBNA3C previously shown to be important for regulation of p53, Cyclin A and Mdm2 activities 700
(34, 61). 701
The amino terminal region of EBNA3C is important for regulation of a number of 702
nuclear proteins, and the lysine at amino acid 120 is critical for regulation and possibly 703
ubiquitination of associated proteins (37). Importantly, amino acid 120 lies within residues 1-200 704
which was previously identified as the probable acceptor of the ubiquitination moiety (37). 705
Mutation of this lysine at amino acid 120 in our studies resulted in a loss of functional activity 706
when compared to wild type EBNA3C at the protein and transcriptional level, in both stability 707
and reporter assays. Therefore it is highly probable that additional factors contribute to the 708
activities of EBNA3C in terms of AK-B regulation. These proteins are clearly multi-functional 709
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
32
and have regulatory activities with other complexes that regulate cellular pathways important for 710
cell proliferation. Several experiments in which the level of endogenous AK-B was monitored 711
with EBNA3C showed similar results where AK-B was up-regulated by increasing levels of 712
EBNA3C independent of p53 and Mdm2. Furthermore, EBNA3C stabilized AK-B in epithelial 713
and B-cell lines, but was unable to stabilize AK-B if the kinase domain was non-functional. This 714
demonstrated that the kinase domain of AK-B is important for its regulation by viral antigens 715
like EBNA3C and likely other cellular proteins with a role in cell cycle control. 716
A number of studies have suggested that regulation of AK-B during mitosis is controlled 717
by the ubiquitin system (42, 44, 48, 66). Regulation of AK-B ubiquitination is also crucial for its 718
subsequent degradation at the end of mitosis (48, 56, 66). Thus monitoring the ubiquitination 719
status of AK-B in the presence of EBNA3C is likely crucial for enhanced activation and cell 720
proliferation in EBV transformed cells. We showed that EBNA3C expression resulted in reduced 721
ubiquitination of AK-B which supports earlier reports that EBNA3C may exploit a de-722
ubiquitination mechanism to stabilize substrates important for mediating viral oncogenesis (34, 723
58). AK-B is activated mainly after metaphase and its peak activity is during the period between 724
anaphase to telophase leading to cytokinesis (1). Importantly, EBNA3C enhanced AK-B at the 725
transcript and protein levels as well as stabilized this mitotic kinase, which contributed to the 726
proper execution of cell division. During this period, increased AK-B activity can regulate the 727
phosphorylation of cellular proteins thus providing a favorable environment for proper cell 728
division (14, 79). Regulation of AK-B by EBNA3C is important for determination of the path 729
leading to cytokinesis. It has already been established that EBNA3C can disrupt the activities of 730
major cellular tumor suppressors (36, 57, 60, 76). This may also be a strategy for regulating these 731
tumor suppressors through changes in their phosphorylation status by AK-B (47, 72). Our kinase 732
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
33
assay showed that Rb phosphorylation was greatly enhanced. Furthermore, our previous studies 733
showed that EBNA3C attenuated Rb levels through regulation of its phosphorylation and 734
subsequent ubiquitination (36). Here we now convincingly showed that phosphorylation of Rb 735
was significantly enhanced in the presence of both EBNA3C and AK-B. This enhanced Rb 736
phosphorylation will lead to its degradation which allows the viral infected cells to bypass the 737
G1 phase. Further, we also evaluated the reversal of Rb suppressive activity at the cellular level 738
and determined that the kinase-dead mutant of AK-B was unable to block the Rb tumor 739
suppressor activity. However, wild type AK-B and EBNA3C not only phosphorylated Rb, but 740
also accelerated cell proliferation. 741
AK-B is a known oncoprotein and EBNA3C has also been shown to have cell 742
transforming activity. Monitoring cell proliferation in the presence of these two proteins was 743
important to determine their contribution to EBV-mediated B-cell transformation. We previously 744
reported that EBNA3C facilitated cell proliferation and works as a potent activator of the cell 745
cycle, partially through disruption of the G1/S and the G2/M cell-cycle checkpoints (34, 59). 746
Additionally, the AK's are well known to be an oncogenic (6, 73). Our study now showed that 747
the proliferation rate of cells expressing both EBNA3C and AK-B was significantly enhanced 748
and was also consistent in a p53 and Mdm2-null background. This suggested that their activities 749
are most likely independent of p53 and Mdm2. CFSE staining assays produced similar results 750
supporting our above observation of cell proliferation. However, when AK-B is replaced by its 751
K/R mutant in the presence of EBNA3C, the proliferation rate was dramatically decreased. This 752
strongly demonstrated the functional relevance of the AK-B kinase domain in cell proliferation-753
mediated by EBNA3C. Interestingly, similar results were previously seen with other oncogenic 754
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
34
proteins regulated by EBNA3C (59), where the presence of EBNA3C resulted in increased cell 755
proliferation. 756
Earlier, we demonstrated that EBNA3C expressing cells are resistant to apoptosis, which is 757
consistent with the observation that EBNA3C promotes cell proliferation (8, 59). Similarly, 758
various reports have suggested that deregulation of AK-B either by knockdown or disruption of 759
the functional kinase domain leads to apoptosis (4, 5, 19, 77). This led us to propose that AK-B 760
combined with EBNA3C would promote resistance to apoptosis. To monitor the induction of 761
apoptosis as a result of loss of AK-B expression we showed that PARP1 cleavage was enhanced 762
along with an increase in the cell death population in the AK-B knockdown cells. This was 763
suggested earlier by others investigating the AK family proteins AK-A, B and C (21, 22, 40). 764
Recently, Yoon et al using Hepatoma cells, showed that AK-B knockdown leads to Caspase 3 765
and 9 activation, along with PARP1 cleavage (77). However, Caspase activation pathways in B-766
cell lymphoma was not previously explored. In this study we observed that AK-B knockdown in 767
LCLs activated the internal apoptosis pathway through the activation of Caspase 3 and 9. 768
Internal apoptosis pathway activated via the cleavage of Caspase 9 and 3 is well documented (3, 769
43). Furthermore, previous studies also demonstrated that the mechanism behind Caspase 3 770
activation and apoptosis (50, 54, 64), led to morphological and biochemical changes and the 771
modification of key structural and regulatory proteins by Caspase 3 (12, 39). During this process, 772
the chromatin becomes highly condensed and fragmented to form micronuclei called apoptotic 773
bodies, in a process referred to as nuclear blebbing (2, 16). The activation of Caspase 3 led to 774
striking changes in cell morphology, which included the breakup of the nucleus, redistribution of 775
nuclear fragments to blebs on the apoptotic cell surface (2). A similar trend was seen in our study 776
where we found that Caspase 3 was activated in AK-B knockdown cells. This prompted us to 777
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
35
look at morphological changes of the cells. As expected we found that a significant number of 778
cells showed nuclear blebbing and that these changes can be visualized up to nuclear dissolution 779
and cell death (2, 16). Importantly, this was dramatically reduced when we expressed EBNA3C 780
in the AK-B knockdown cells. A schematic which illustrates the contribution of EBNA3C in 781
regulating AK-B contribution to cell proliferation and inhibition of apoptosis is shown in Fig. 10. 782
Overall, this study adds another dimension to our understanding of EBV-mediated viral 783
oncogenesis through regulation of the critical mitotic kinase AK-B. EBNA3C can stabilize AK-784
B through a reduction in its ubiquitination and so maintain AK-B activity in the cell cycle to 785
phosphorylate the tumor suppressor Rb. This led to enhanced cell proliferation and ultimately 786
EBV-induced B-cell transformation. Furthermore, knockdown of AK-B led to apoptosis and cell 787
death through activation of Caspase 3 and 9. Critically important here is that the kinase-dead 788
mutant of AK-B was unable to replicate this phenomena, demonstrating a major role for the 789
kinase domain and its functional activity in contributing to EBV-mediated cell proliferation and 790
transformation of B-cells. 791
792
793
794
795
796
797
798
799
800
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
36
ACKNOWLEDGMENTS 801
We are grateful to Erich A. Nigg (Max-Planck Institute of Biochemistry, Martinsried, Germany), 802
Yukio Okano (Gifu University School of Medicine, Tsukasamachi, Japan), Jon Aster (Brigham 803
and Woman's Hospital, Boston, MA, USA), Yan Yuan (School of Dental Medicine, University 804
of Pennsylvania, Philadelphia, PA), and Elliott Kieff (Harvard Medical School, Boston, MA) for 805
kindly providing reagents. We would also like to thank Santosh Upadhyay for his help with 806
microscopy and ChIP assays. The work was supported by NCI grant CA137894-05 to ESR. ESR 807
is a scholar of the Leukemia and Lymphoma Society of America. 808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
37
REFERENCES 825
1. Adams, R. R., S. P. Wheatley, A. M. Gouldsworthy, S. E. Kandels-Lewis, M. Carmena, C. 826 Smythe, D. L. Gerloff, and W. C. Earnshaw. 2000. INCENP binds the Aurora-related kinase AIRK2 827 and is required to target it to chromosomes, the central spindle and cleavage furrow. Curr Biol 828 10:1075-8. 829
2. Andrade, R., L. Crisol, R. Prado, M. D. Boyano, J. Arluzea, and J. Arechaga. 2010. Plasma 830 membrane and nuclear envelope integrity during the blebbing stage of apoptosis: a time-lapse 831 study. Biol Cell 102:25-35. 832
3. Belov, G. A., L. I. Romanova, E. A. Tolskaya, M. S. Kolesnikova, Y. A. Lazebnik, and V. I. Agol. 833 2003. The major apoptotic pathway activated and suppressed by poliovirus. J Virol 77:45-56. 834
4. Benten, D., G. Keller, A. Quaas, J. Schrader, A. Gontarewicz, S. Balabanov, M. Braig, H. Wege, J. 835 Moll, A. W. Lohse, and T. H. Brummendorf. 2009. Aurora kinase inhibitor PHA-739358 836 suppresses growth of hepatocellular carcinoma in vitro and in a xenograft mouse model. 837 Neoplasia 11:934-44. 838
5. Bezabeh, T., M. R. Mowat, L. Jarolim, A. H. Greenberg, and I. C. Smith. 2001. Detection of drug-839 induced apoptosis and necrosis in human cervical carcinoma cells using 1H NMR spectroscopy. 840 Cell Death Differ 8:219-24. 841
6. Bischoff, J. R., L. Anderson, Y. Zhu, K. Mossie, L. Ng, B. Souza, B. Schryver, P. Flanagan, F. 842 Clairvoyant, C. Ginther, C. S. Chan, M. Novotny, D. J. Slamon, and G. D. Plowman. 1998. A 843 homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. 844 EMBO J 17:3052-65. 845
7. Brummelkamp, T. R., R. Bernards, and R. Agami. 2002. A system for stable expression of short 846 interfering RNAs in mammalian cells. Science 296:550-3. 847
8. Cai, Q., Y. Guo, B. Xiao, S. Banerjee, A. Saha, J. Lu, T. Glisovic, and E. S. Robertson. 2011. 848 Epstein-Barr virus nuclear antigen 3C stabilizes Gemin3 to block p53-mediated apoptosis. PLoS 849 Pathog 7:e1002418. 850
9. Cai, Q., B. Xiao, H. Si, A. Cervini, J. Gao, J. Lu, S. K. Upadhyay, S. C. Verma, and E. S. Robertson. 851 2012. Kaposi's sarcoma herpesvirus upregulates Aurora A expression to promote p53 852 phosphorylation and ubiquitylation. PLoS Pathog 8:e1002566. 853
10. Carvajal, R. D., A. Tse, and G. K. Schwartz. 2006. Aurora kinases: new targets for cancer therapy. 854 Clin Cancer Res 12:6869-75. 855
11. Chaitanya, G. V., A. J. Steven, and P. P. Babu. 2010. PARP-1 cleavage fragments: signatures of 856 cell-death proteases in neurodegeneration. Cell Commun Signal 8:31. 857
12. Chang, H. Y., and X. Yang. 2000. Proteases for cell suicide: functions and regulation of caspases. 858 Microbiol Mol Biol Rev 64:821-46. 859
13. Chen, T. C., S. A. Lee, T. M. Hong, J. Y. Shih, J. M. Lai, H. Y. Chiou, S. C. Yang, C. H. Chan, C. Y. 860 Kao, P. C. Yang, and C. Y. Huang. 2009. From midbody protein-protein interaction network 861 construction to novel regulators in cytokinesis. J Proteome Res 8:4943-53. 862
14. Chu, Y., P. Y. Yao, W. Wang, D. Wang, Z. Wang, L. Zhang, Y. Huang, Y. Ke, X. Ding, and X. Yao. 863 2011. Aurora B kinase activation requires survivin priming phosphorylation by PLK1. J Mol Cell 864 Biol 3:260-7. 865
15. Cohen, J. I., F. Wang, J. Mannick, and E. Kieff. 1989. Epstein-Barr virus nuclear protein 2 is a key 866 determinant of lymphocyte transformation. Proc Natl Acad Sci U S A 86:9558-62. 867
16. Elmore, S. 2007. Apoptosis: a review of programmed cell death. Toxicol Pathol 35:495-516. 868 17. Epstein, M. A., B. G. Achong, and Y. M. Barr. 1964. Virus Particles in Cultured Lymphoblasts 869
from Burkitt's Lymphoma. Lancet 1:702-3. 870
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
38
18. Fichter, C. D., C. Herz, C. Munch, O. G. Opitz, M. Werner, and S. Lassmann. 2011. Occurrence of 871 multipolar mitoses and association with Aurora-A/-B kinases and p53 mutations in aneuploid 872 esophageal carcinoma cells. BMC Cell Biol 12:13. 873
19. Fu, J., M. Bian, Q. Jiang, and C. Zhang. 2007. Roles of Aurora kinases in mitosis and 874 tumorigenesis. Mol Cancer Res 5:1-10. 875
20. Gao, J., Q. Cai, J. Lu, H. C. Jha, and E. S. Robertson. 2011. Upregulation of cellular Bcl-2 by the 876 KSHV encoded RTA promotes virion production. PLoS One 6:e23892. 877
21. Gong, Y., Y. Li, H. M. Abdolmaleky, L. Li, and J. R. Zhou. 2012. Tanshinones inhibit the growth of 878 breast cancer cells through epigenetic modification of Aurora A expression and function. PLoS 879 One 7:e33656. 880
22. Hartsink-Segers, S. A., C. M. Zwaan, C. Exalto, M. W. Luijendijk, V. S. Calvert, E. F. Petricoin, W. 881 E. Evans, D. Reinhardt, V. de Haas, M. Hedtjarn, B. R. Hansen, T. Koch, H. N. Caron, R. Pieters, 882 and M. L. Den Boer. 2013. Aurora kinases in childhood acute leukemia: the promise of aurora B 883 as therapeutic target. Leukemia 27:560-8. 884
23. Hegyi, K., and G. Mehes. 2012. Mitotic failures in cancer: Aurora B kinase and its potential role 885 in the development of aneuploidy. Pathol Oncol Res 18:761-9. 886
24. Henle, W., G. Henle, and E. T. Lennette. 1979. The Epstein-Barr virus. Sci Am 241:48-59. 887 25. Hochegger, H., N. Hegarat, and J. B. Pereira-Leal. 2013. Aurora at the pole and equator: 888
overlapping functions of Aurora kinases in the mitotic spindle. Open Biol 3:120185. 889 26. Hollyoake, M., A. Stuhler, P. Farrell, J. Gordon, and A. Sinclair. 1995. The normal cell cycle 890
activation program is exploited during the infection of quiescent B lymphocytes by Epstein-Barr 891 virus. Cancer Res 55:4784-7. 892
27. Honda, R., R. Korner, and E. A. Nigg. 2003. Exploring the functional interactions between Aurora 893 B, INCENP, and survivin in mitosis. Mol Biol Cell 14:3325-41. 894
28. Jha, H. C., S. K. Upadhyay, A. J. P. M, J. Lu, Q. Cai, A. Saha, and E. S. Robertson. 2013. H2AX 895 phosphorylation is important for LANA-mediated Kaposi's sarcoma-associated herpesvirus 896 episome persistence. J Virol 87:5255-69. 897
29. Kasibhatla, S., G. P. Amarante-Mendes, D. Finucane, T. Brunner, E. Bossy-Wetzel, and D. R. 898 Green. 2006. Acridine Orange/Ethidium Bromide (AO/EB) Staining to Detect Apoptosis. CSH 899 Protoc 2006. 900
30. Keen, N., and S. Taylor. 2004. Aurora-kinase inhibitors as anticancer agents. Nat Rev Cancer 901 4:927-36. 902
31. Kim, H. J., J. H. Cho, H. Quan, and J. R. Kim. 2011. Down-regulation of Aurora B kinase induces 903 cellular senescence in human fibroblasts and endothelial cells through a p53-dependent 904 pathway. FEBS Lett 585:3569-76. 905
32. Kimura, M., C. Uchida, Y. Takano, M. Kitagawa, and Y. Okano. 2004. Cell cycle-dependent 906 regulation of the human aurora B promoter. Biochem Biophys Res Commun 316:930-6. 907
33. Klein, U. R., E. A. Nigg, and U. Gruneberg. 2006. Centromere targeting of the chromosomal 908 passenger complex requires a ternary subcomplex of Borealin, Survivin, and the N-terminal 909 domain of INCENP. Mol Biol Cell 17:2547-58. 910
34. Knight, J. S., and E. S. Robertson. 2004. Epstein-Barr virus nuclear antigen 3C regulates cyclin 911 A/p27 complexes and enhances cyclin A-dependent kinase activity. J Virol 78:1981-91. 912
35. Knight, J. S., N. Sharma, D. E. Kalman, and E. S. Robertson. 2004. A cyclin-binding motif within 913 the amino-terminal homology domain of EBNA3C binds cyclin A and modulates cyclin A-914 dependent kinase activity in Epstein-Barr virus-infected cells. J Virol 78:12857-67. 915
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
39
36. Knight, J. S., N. Sharma, and E. S. Robertson. 2005. Epstein-Barr virus latent antigen 3C can 916 mediate the degradation of the retinoblastoma protein through an SCF cellular ubiquitin ligase. 917 Proc Natl Acad Sci U S A 102:18562-6. 918
37. Knight, J. S., N. Sharma, and E. S. Robertson. 2005. SCFSkp2 complex targeted by Epstein-Barr 919 virus essential nuclear antigen. Mol Cell Biol 25:1749-63. 920
38. Kojima, K., M. Konopleva, T. Tsao, H. Nakakuma, and M. Andreeff. 2008. Concomitant 921 inhibition of Mdm2-p53 interaction and Aurora kinases activates the p53-dependent postmitotic 922 checkpoints and synergistically induces p53-mediated mitochondrial apoptosis along with 923 reduced endoreduplication in acute myelogenous leukemia. Blood 112:2886-95. 924
39. Kroemer, G., L. Galluzzi, and C. Brenner. 2007. Mitochondrial membrane permeabilization in 925 cell death. Physiol Rev 87:99-163. 926
40. Li, M., A. Jung, U. Ganswindt, P. Marini, A. Friedl, P. T. Daniel, K. Lauber, V. Jendrossek, and C. 927 Belka. 2010. Aurora kinase inhibitor ZM447439 induces apoptosis via mitochondrial pathways. 928 Biochem Pharmacol 79:122-9. 929
41. Lowe, S. W., and A. W. Lin. 2000. Apoptosis in cancer. Carcinogenesis 21:485-95. 930 42. Maerki, S., M. H. Olma, T. Staubli, P. Steigemann, D. W. Gerlich, M. Quadroni, I. Sumara, and 931
M. Peter. 2009. The Cul3-KLHL21 E3 ubiquitin ligase targets aurora B to midzone microtubules in 932 anaphase and is required for cytokinesis. J Cell Biol 187:791-800. 933
43. Manns, J., M. Daubrawa, S. Driessen, F. Paasch, N. Hoffmann, A. Loffler, K. Lauber, A. Dieterle, 934 S. Alers, T. Iftner, K. Schulze-Osthoff, B. Stork, and S. Wesselborg. 2011. Triggering of a novel 935 intrinsic apoptosis pathway by the kinase inhibitor staurosporine: activation of caspase-9 in the 936 absence of Apaf-1. FASEB J 25:3250-61. 937
44. Meyer, H., A. Drozdowska, and G. Dobrynin. 2010. A role for Cdc48/p97 and Aurora B in 938 controlling chromatin condensation during exit from mitosis. Biochem Cell Biol 88:23-8. 939
45. Miao, H., X. Jin, A. S. Perelson, and H. Wu. 2012. Evaluation of multitype mathematical models 940 for CFSE-labeling experiment data. Bull Math Biol 74:300-26. 941
46. Murata-Hori, M., and Y. L. Wang. 2002. The kinase activity of aurora B is required for 942 kinetochore-microtubule interactions during mitosis. Curr Biol 12:894-9. 943
47. Nair, J. S., A. L. Ho, A. N. Tse, J. Coward, H. Cheema, G. Ambrosini, N. Keen, and G. K. Schwartz. 944 2009. Aurora B kinase regulates the postmitotic endoreduplication checkpoint via 945 phosphorylation of the retinoblastoma protein at serine 780. Mol Biol Cell 20:2218-28. 946
48. Nguyen, H. G., D. Chinnappan, T. Urano, and K. Ravid. 2005. Mechanism of Aurora-B 947 degradation and its dependency on intact KEN and A-boxes: identification of an aneuploidy-948 promoting property. Mol Cell Biol 25:4977-92. 949
49. Ning, S., A. M. Hahn, L. E. Huye, and J. S. Pagano. 2003. Interferon regulatory factor 7 regulates 950 expression of Epstein-Barr virus latent membrane protein 1: a regulatory circuit. J Virol 77:9359-951 68. 952
50. Nobel, C. S., D. H. Burgess, B. Zhivotovsky, M. J. Burkitt, S. Orrenius, and A. F. Slater. 1997. 953 Mechanism of dithiocarbamate inhibition of apoptosis: thiol oxidation by dithiocarbamate 954 disulfides directly inhibits processing of the caspase-3 proenzyme. Chem Res Toxicol 10:636-43. 955
51. Normand, G., and R. W. King. 2010. Understanding cytokinesis failure. Adv Exp Med Biol 956 676:27-55. 957
52. Pan, C., M. Yan, J. Yao, J. Xu, Z. Long, H. Huang, and Q. Liu. 2008. Aurora kinase small molecule 958 inhibitor destroys mitotic spindle, suppresses cell growth, and induces apoptosis in oral 959 squamous cancer cells. Oral Oncol 44:639-45. 960
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
40
53. Parker, G. A., R. Touitou, and M. J. Allday. 2000. Epstein-Barr virus EBNA3C can disrupt multiple 961 cell cycle checkpoints and induce nuclear division divorced from cytokinesis. Oncogene 19:700-962 9. 963
54. Ravid, T., A. Tsaba, P. Gee, R. Rasooly, E. A. Medina, and T. Goldkorn. 2003. Ceramide 964 accumulation precedes caspase-3 activation during apoptosis of A549 human lung 965 adenocarcinoma cells. Am J Physiol Lung Cell Mol Physiol 284:L1082-92. 966
55. Ribble, D., N. B. Goldstein, D. A. Norris, and Y. G. Shellman. 2005. A simple technique for 967 quantifying apoptosis in 96-well plates. BMC Biotechnol 5:12. 968
56. Ruchaud, S., M. Carmena, and W. C. Earnshaw. 2007. Chromosomal passengers: conducting cell 969 division. Nat Rev Mol Cell Biol 8:798-812. 970
57. Saha, A., A. Bamidele, M. Murakami, and E. S. Robertson. 2011. EBNA3C attenuates the 971 function of p53 through interaction with inhibitor of growth family proteins 4 and 5. J Virol 972 85:2079-88. 973
58. Saha, A., S. Halder, S. K. Upadhyay, J. Lu, P. Kumar, M. Murakami, Q. Cai, and E. S. Robertson. 974 Epstein-Barr virus nuclear antigen 3C facilitates G1-S transition by stabilizing and enhancing the 975 function of cyclin D1. PLoS Pathog 7:e1001275. 976
59. Saha, A., S. Halder, S. K. Upadhyay, J. Lu, P. Kumar, M. Murakami, Q. Cai, and E. S. Robertson. 977 2011. Epstein-Barr virus nuclear antigen 3C facilitates G1-S transition by stabilizing and 978 enhancing the function of cyclin D1. PLoS Pathog 7:e1001275. 979
60. Saha, A., J. Lu, L. Morizur, S. K. Upadhyay, M. P. Aj, and E. S. Robertson. 2012. E2F1 mediated 980 apoptosis induced by the DNA damage response is blocked by EBV nuclear antigen 3C in 981 lymphoblastoid cells. PLoS Pathog 8:e1002573. 982
61. Saha, A., M. Murakami, P. Kumar, B. Bajaj, K. Sims, and E. S. Robertson. 2009. Epstein-Barr 983 virus nuclear antigen 3C augments Mdm2-mediated p53 ubiquitination and degradation by 984 deubiquitinating Mdm2. J Virol 83:4652-69. 985
62. Schuler, M., E. Bossy-Wetzel, J. C. Goldstein, P. Fitzgerald, and D. R. Green. 2000. p53 induces 986 apoptosis by caspase activation through mitochondrial cytochrome c release. J Biol Chem 987 275:7337-42. 988
63. Sessa, F., M. Mapelli, C. Ciferri, C. Tarricone, L. B. Areces, T. R. Schneider, P. T. Stukenberg, and 989 A. Musacchio. 2005. Mechanism of Aurora B activation by INCENP and inhibition by hesperadin. 990 Mol Cell 18:379-91. 991
64. Shi, Y. 2001. A structural view of mitochondria-mediated apoptosis. Nat Struct Biol 8:394-401. 992 65. Sinclair, A. J., I. Palmero, G. Peters, and P. J. Farrell. 1994. EBNA-2 and EBNA-LP cooperate to 993
cause G0 to G1 transition during immortalization of resting human B lymphocytes by Epstein-994 Barr virus. EMBO J 13:3321-8. 995
66. Stewart, S., and G. Fang. 2005. Destruction box-dependent degradation of aurora B is mediated 996 by the anaphase-promoting complex/cyclosome and Cdh1. Cancer Res 65:8730-5. 997
67. Tomkinson, B., E. Robertson, and E. Kieff. 1993. Epstein-Barr virus nuclear proteins EBNA-3A 998 and EBNA-3C are essential for B-lymphocyte growth transformation. J Virol 67:2014-25. 999
68. van der Waal, M. S., R. C. Hengeveld, A. van der Horst, and S. M. Lens. 2012. Cell division 1000 control by the Chromosomal Passenger Complex. Exp Cell Res 318:1407-20. 1001
69. Vargas, J., Jr., G. L. Gusella, V. Najfeld, M. E. Klotman, and A. Cara. 2004. Novel integrase-1002 defective lentiviral episomal vectors for gene transfer. Hum Gene Ther 15:361-72. 1003
70. Wakahara, K., T. Ohno, M. Kimura, T. Masuda, S. Nozawa, T. Dohjima, T. Yamamoto, A. 1004 Nagano, G. Kawai, A. Matsuhashi, M. Saitoh, I. Takigami, Y. Okano, and K. Shimizu. 2008. EWS-1005 Fli1 up-regulates expression of the Aurora A and Aurora B kinases. Mol Cancer Res 6:1937-45. 1006
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
41
71. Wang, Y., P. Ji, J. Liu, R. R. Broaddus, F. Xue, and W. Zhang. 2009. Centrosome-associated 1007 regulators of the G(2)/M checkpoint as targets for cancer therapy. Mol Cancer 8:8. 1008
72. Wang, Y., and B. P. Zhou. 2012. FBW7-Aurora B-p53 feedback loop regulates mitosis and cell 1009 growth. Cell Cycle 11:4113-4. 1010
73. Warner, S. L., D. J. Bearss, H. Han, and D. D. Von Hoff. 2003. Targeting Aurora-2 kinase in 1011 cancer. Mol Cancer Ther 2:589-95. 1012
74. Wheatley, S. P., A. J. Henzing, H. Dodson, W. Khaled, and W. C. Earnshaw. 2004. Aurora-B 1013 phosphorylation in vitro identifies a residue of survivin that is essential for its localization and 1014 binding to inner centromere protein (INCENP) in vivo. J Biol Chem 279:5655-60. 1015
75. Xing, L., and E. Kieff. 2007. Epstein-Barr virus BHRF1 micro- and stable RNAs during latency III 1016 and after induction of replication. J Virol 81:9967-75. 1017
76. Yi, F., A. Saha, M. Murakami, P. Kumar, J. S. Knight, Q. Cai, T. Choudhuri, and E. S. Robertson. 1018 2009. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and 1019 apoptotic activities. Virology 388:236-47. 1020
77. Yoon, M. J., S. S. Park, Y. J. Kang, I. Y. Kim, J. A. Lee, J. S. Lee, E. G. Kim, C. W. Lee, and K. S. 1021 Choi. 2012. Aurora B confers cancer cell resistance to TRAIL-induced apoptosis via 1022 phosphorylation of survivin. Carcinogenesis 33:492-500. 1023
78. Young, L. S., and P. G. Murray. 2003. Epstein-Barr virus and oncogenesis: from latent genes to 1024 tumours. Oncogene 22:5108-21. 1025
79. Zeitlin, S. G., R. D. Shelby, and K. F. Sullivan. 2001. CENP-A is phosphorylated by Aurora B kinase 1026 and plays an unexpected role in completion of cytokinesis. J Cell Biol 155:1147-57. 1027
80. Zhang, Y., and Y. Xiong. 2001. A p53 amino-terminal nuclear export signal inhibited by DNA 1028 damage-induced phosphorylation. Science 292:1910-5. 1029
81. Zhao, B., R. Dalbies-Tran, H. Jiang, I. K. Ruf, J. T. Sample, F. Wang, and C. E. Sample. 2003. 1030 Transcriptional regulatory properties of Epstein-Barr virus nuclear antigen 3C are conserved in 1031 simian lymphocryptoviruses. J Virol 77:5639-48. 1032
82. Zhao, B., and C. E. Sample. 2000. Epstein-barr virus nuclear antigen 3C activates the latent 1033 membrane protein 1 promoter in the presence of Epstein-Barr virus nuclear antigen 2 through 1034 sequences encompassing an spi-1/Spi-B binding site. J Virol 74:5151-60. 1035
1036 1037
1038
1039
1040
1041
1042
1043
1044
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
42
FIGURE LEGENDS: 1045
Figure 1. AK-B levels are enhanced in EBV infected and EBNA3C expressing cells: 1046
(A) Endogenous expression of AK-B in EBV negative (BL41) and EBV positive (BL41/B95.8) 1047
cells at the protein and RNA level. 30 million cells were used to perform Western blots (WB) for 1048
EBNA3C, AK-B and GAPDH. The relative densities of AK-B was calculated and normalized 1049
according to GAPDH levels. Real-time PCR (RT-PCR) was performed on samples of 20 million 1050
cells to determine AK-B transcript levels, using GAPDH as the internal control. Step One plus 1051
real-time PCR software was applied to relatively calculate the fold change in different cDNA. 1052
(B) Endogenous AK-B levels in Mutu I and Mutu III cells using the same primary antibodies. 1053
Mutu I and III express EBV latency I and III respectively. RT-PCR was performed to check 1054
transcript levels, and the fold change of AK-B was normalized accordingly to that of endogenous 1055
GAPDH. (C) Comparison of LCL1 and LCL2 with PBMC's from two healthy individuals at the 1056
protein and RNA levels. LCL1 and LCL2 are lymphoblastoid cell lines that express all EBV 1057
proteins. (D) PBMC's were subjected to the EBV wild type and delta EBNA3C EBV infection 1058
and blotted for EBNA3C, AK-B & GAPDH at 0, 2, 4 and 7 days. We also determined the 1059
transcript levels of these genes and produced a plot to determine fold change. (E) LCL1 clones 1060
stably maintained with sh-control and sh-EBNA3C were harvested to isolate protein and RNA. 1061
Western blotting and RT-PCR was performed for AK-B, GAPDH and EBNA3C. (F) BJAB 1062
(EBNA3C negative), BJAB-7 and BJAB-10 (EBNA3C positive) cell lysates were subjected to 1063
Western blotting and RT-PCR analysis of AK-B transcript levels. (G) Western blotting were 1064
performed for AK-B, EBNA3C, LMP1 and GAPDH in P3HR1 and Jijoye cells. P3HR1 is null 1065
for EBNA2 and EBNALP. All these experiments were performed at least three times. 1066
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
43
Figure 2. EBNA3C up-regulates AK-B expression in a p53 and Mdm2 independent 1067
manner: 1068
(A) The schematic describes the promoter constructs for AK-B full length and two truncations. 1069
ETS-1 binding site is present in AK-B-pGL3-74 truncation while absent in AK-B-pGL3-337 1070
truncation. (B-D) Reporter assays were conducted in three cell lines: HEK-293T (p53+/+ & 1071
Mdm2+/+), Saos-2 (p53-/-), and MEF (p53-/- & Mdm2-/-). Cells were transfected with three 1072
clones – (B) AK-B-pGL3- full length (1871), (C) AK-B-pGL3-74, and (D) AK-B-pGL3-337 – in 1073
a dose-dependent manner with EBNA3C. Graphs are indicative of relative luciferase units 1074
(RLU/beta- gal activity). The pGL3 control plasmid was added to samples prior to transfection to 1075
equalize the amount of plasmid and normalize transfection efficiency. The beta-gal plasmid was 1076
added to all transfections to normalize the RLU measurement. The luciferase activity was 1077
calculated as described in the ‘Materials and Methods’ section. The mean values and standard 1078
deviations of three independent experiments are presented. 5% of the cell lysates were separated 1079
by an SDS-PAGE gel to determine that the transfection efficiency. The reporter constructs for 1080
AK-B and empty vector pGL3 were transfected in LCL1, LCL1-shcontrol and LCL1-shp53. 1081
Cells were processed as previously described. (H) The graph compares the relative quantities of 1082
the AK-B promoter region between the IgG and EBNA3C (A10) antibody samples as 1083
determined by real-time PCR. The panels are representative graphs from three experiments. (I) 1084
HEK-293T cells transfected with the control vector and Flag-EBNA3C were subjected to pull-1085
down with M2 (Flag) antibodies. The graph shows IgG and M2 antibodies used in the AK-B 1086
ChIP assays. The panels show representative graphs from three independent experiments. 1087
Figure 3. AK-B interaction with EBNA3C is at the N-terminal and is independent of p53 1088
and Mdm2: 1089
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
44
(A) Protein interaction between AK-B with EBNA3C was investigated in HEK-293T (p53+/+, 1090
mdm2+/+) cells. 10 million cells were used in pull-down experiments for EBNA3C using M2 1091
antibody, and the level of AK-B co-immunoprecipitation was analyzed by Western blotting. 1092
Empty vectors were used as controls in these experiments. Reverse pull-down experiments for 1093
EBNA3C (or pull-down experiments for AK-B-Myc) were also performed with 9E10 antibody 1094
and analyzed in a similar manner. (B) The interaction between AK-B and EBNA3C was 1095
investigated in Saos-2 (p53-/-) cells to determine the role or influence of p53. EBNA3C pull-1096
down was carried out with M2 antibody, and AK-B was blotted with 9E10 antibody. (C) M2 1097
antibody was used for the EBNA3C pull-down, and AK-B was blotted with Myc antibody. (D, 1098
E) BJAB, BJAB-7, BJAB-10, LCL1 and LCL2 cells were subjected to immunoprecipitation with 1099
non-specific IgG antibody and specific AK-B and A10 antibodies used for AK-B and EBAN3C. 1100
Western blots were performed for input, IgG and antibody groups. (F) EBNA3C expression 1101
plasmids with full length, N, mid and C-terminal were transfected into HEK-293T cells. GST 1102
pull-down with AK-B was carried out at 36 hrs post-transfection. Coomassie gel was shown for 1103
GST and full length AK-B-GST. (G) HEK-293T cells were transfected with full-length and 1104
truncated (N-terminus, the middle region, C-terminus) EBNA3C, and subjected to IP to 1105
determine the region of EBNA3C that binds with AK-B. (H) GST pull-down assays were 1106
conducted with EBNA3C truncations (90-325, 326-581, 582-791 and 900-992) cloned in the 1107
GST vector. HEK-293T cells were transfected with AK-B full length plasmids and lysed to 1108
collect the protein after 36 hrs. (I) Smaller truncations of EBNA3C (90-325, 90-129, 130-159 1109
and 160-190) cloned in GST were also used to determine their binding activity with AK-B. 1110
These experiments were performed in triplicate. (J) A schematic diagram of EBNA3C 1111
representative domains binding with AK-B shows the interaction domain. 1112
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
45
Figure 4. EBNA3C co-localizes with AK-B in nuclear compartments: 1113
(A) GFP-AK-B, GFP-AK-BKR and EBNA3C-dsRed were transiently transfected into HEK-1114
293T cells. DAPI was used to stained cells and the images were captured with confocal 1115
microscopy. The percent co-localization was determined (100/ field in three sets of experiments) 1116
by counting spots in the merge panel. The representative graph shows percent co-localization 1117
between AK-B and EBNA3C. (B) BJAB (control), BJAB-7 (EBNA3C stable), LCL1 (EBV 1118
positive) cells were subjected to IF using endogenous AK-B antibodies and EBNA3C antibodies. 1119
Percent localization is presented in the graph for BJAB-7 & LCL1 cells. 1120
Figure 5. AK-B wild type but not K/R mutant of AK-B is stabilized with EBNA3C: 1121
(A) In HEK-293T cells, AK-B wild type and (D) AK-B-KR was transiently transfected in the 1122
absence/presence of EBNA3C. 36 hrs post-transfection, cells were subjected to CHX (20µg/ml) 1123
treatment at 0, 2 and 4 hrs. Myc (9E10) antibody was used for blotting AK-B and AK-B KR, and 1124
the results are presented in respective graphs. (B) EBNA3C negative and positive BJAB cells, 1125
and (C) LCL1 stable cells for sh-control and sh-EBNA3C were subjected to CHX treatment and 1126
endogenous AK-B signals determined. The blots were stripped and re-probed with different 1127
antibodies. (E) Stability assays of AK-B protein in combination with full-length or mutant 1128
EBNA3C (K120A). (F) Ubiquitination assays were carried out using MG132 (20µg/ml) in 50 1129
million BJAB (EBNA3C negative) and BJAB-7 and 10 (EBNA3C positive) cells. AK-B 1130
antibody (2µg) was used for pull-down experiment and blotted using a ubiquitin antibody (for 1131
poly-ubiquitination), and AK-B antibody (for ubiquitination). The input was also analyzed using 1132
GAPDH antibodies. (G) Ubiquitination assays were carried out using MG132 (20µg/ml) in 50 1133
million LCL1 (sh-control and sh-EBNA3C) cells. AK-B antibody (2µg) was used in pull-down 1134
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
46
experiments and blotted using a ubiquitin antibody (for poly-ubiquitination), and AK-B antibody 1135
(for ubiquitination). The input was also analyzed using GAPDH antibodies. All these 1136
experiments were performed at least 3 times. 1137
Figure 6: AK-B wild type but not the K/R mutant phosphorylates Rb and deregulates its 1138
tumor suppressor activity in colony formation assays: 1139
(A) Four samples of HEK-293T/MEF cells were transfected with GFP-AK-B, GFP-AK-BKR, 1140
flag-EBNA3C and a control vector with respective amounts. 36 hrs post-transfection, cells were 1141
subjected to a pull-down with GFP specific antibody (for GFP-AK-B and GFP-AK-BKR). The 1142
protein beads were incubated with purified Rb protein. Blot were scanned using Typhoon Imager 1143
(GE Biosciences, Pittsburgh, PA, USA) and quantified with Image Quant software. A 1144
representative gel is shown. This experiments were performed 3 times. (B) The colony formation 1145
assay was performed in HEK-293T cells. Cells were electroporated in combination of control 1146
vector, Rb, AK-B, AK-B-KR and EBNA3C in cells. 24 hrs post-transfection, cells were selected 1147
using G418. The total intensity of the colonies were measured using the Odyssey Image analysis 1148
software and plotted in the representative graph. This experiment was performed 2 times. 1149
Figure 7. EBNA3C expressed with AK-B enhanced cell proliferation: 1150
(A) The colony formation assay was performed in MEF (p53-/- & Mdm2-/-) cells. Cells were 1151
electroporated with a control vector, AK-B, EBNA3C, or EBNA3C + AK-B. 24 hrs post-1152
transfection, cells were selected using G418. The total intensity of colonies were measured using 1153
the Odyssey Image analysis software and plotted in the representative graph. The student T- test 1154
was used for statistical analysis. Another colony formation assay in MEF cells was conducted 1155
with an AK-BKR mutant. Cells were transfected with AK-BKR, AK-B, EBNA3C+AK-BKR or 1156
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
47
EBNA3C+AK-B. The graph reflects the total intensity of each plate, and student T-test was 1157
applied for statistical analysis. This experiments was performed twice. (B) An identical CFA 1158
with the AK-B mutant was carried out in HEK-293T cells. The intensities were measured, and 1159
the student T - test was applied for statistical analysis. This experiments was performed twice. 1160
(C) MEF cells transiently transfected with AK-BKR, AK-B, EBNA3C+AK-BKR or 1161
EBNA3C+AK-B were stained with carboxy fluorescein diacetate succinimidyl ester (CFSC) 1162
after 0, 24 or 48 hours. This experiments was performed three times. (D) HEK-293T cells 1163
transiently transfected with AK-BKR, AK-B, EBNA3C+AK-BKR or EBNA3C+AK-B were 1164
stained with CFSC. Ten million cells were used in each transfection and incubated with CFSE 1165
dye (5µM/ml) after 24 hrs. The second and third aliquots of cells were seeded in petri dishes 1166
with regular media for 24 and 48 hrs respectively prior to being fixed and stored. This 1167
experiments was performed three times. (E) Colony formation assay using HEK-293T cells 1168
transfected with full-length (1-992) and truncated (N-terminal (1-365), the middle region (366-1169
620), C-terminal (621-992) in conjunction with AK-B. This experiments was performed twice. 1170
Figure 8. EBNA3C co-expressed with AK-B can block induction of apoptosis: 1171
(A) Cells transiently transfected with vector control, AK-B, EBNA3C, or EBNA3C+AK-B were 1172
stained with a mixture of ethidium bromide and acrydine orange. 24 hrs post-transfection, the 1173
cells were incubated with 0.1% serum added DMEM media for 12 hrs and treated with etoposide 1174
for 6 hrs. Fluorescent microscopy was used to analyze the cells. Pictures were captured through 1175
three channels – green, red, and blue – which represent live cells, dead cells, and apoptotic cells 1176
(with distorted nuclei) respectively. For each slide, 10 fields (each containing 40-100 cells) were 1177
captured and counted. Experiments were performed 3 times. To analyze differences between 1178
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
48
AK-B and EBNA3C, we excluded the vector control from the data presentation which showed 1179
greater apoptosis induction compared to all groups. 1180
(B) HEK-293T cells were transfected with vector control, AK-B, EBNA3C or EBNA3C+AK-B. 1181
24 hrs post-transfection, the cells were incubated with 0.1% serum added media for 12 hrs than 1182
normal serum added media. Cells were collected according to the showed time points. Cells were 1183
fixed with Acetone: Methanol and stained with PI (40µ/ml). This experiments was performed 3 1184
times. 1185
Figure 9. AK-B knockdown led to activation of PARP1, Caspase 3, 9 and increased nuclear 1186
blebbing formation which was rescued by EBNA3C: 1187
(A) LCL1 cells knocked down for AK-B compared to non-specific control were evaluated for 1188
EBNA3C, PARP1 cleavage, Caspase 3 and 9 along with AK-B and GAPDH. These experiments 1189
were performed three times. (B-C) HEK-293T cells were transfected with (B) sh-control and (C) 1190
sh-AK-B. Thirty-six hrs post-transfection, the cells were stained with DAPI to observe nuclear 1191
blebbing in sh-control and sh-AK-B cells. The observed cells were selected based on positive 1192
GFP staining and the experiments were performed three times with the same procedure. The 1193
graph was plotted on the Y axis for percent nuclear blebbing on the basis of counting numbers 1194
between clone1 and 2 for sh-control and sh-AK-B with counting DAPI stain. (D) When cells 1195
were transfected with EBNA3C + sh-control and EBNA3C + sh-AK-B, the occurrence of 1196
nuclear blebbing was significantly reduced in AK-B knockdown cells. These experiments were 1197
performed 3 times. 1198
1199
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
49
Figure 10. A model illustrating the putative role of EBNA3C in regulating AK-B activity 1200
leading to cell proliferation and oncogenesis: 1201
Oncogenic activity of AK-B is accelerated in the presence of EBNA3C. AK-B ubiquitination is 1202
reduced in the presence of EBNA3C. Combined AK-B and EBNA3C led to enhanced 1203
proliferation, which predominantly favor cell proliferation. AK-B phosphorylated the tumor 1204
suppressor Rb, which was significantly increased in the presence of EBNA3C. Similarly, AK-B 1205
and EBNA3C enhanced resistance towards apoptotic induction. Knockdown of AK-B led to 1206
activation of Caspase 3 and 9 through the intrinsic apoptosis pathway. These strategies ultimately 1207
favors B-cell transformation and viral-induced oncogenesis. 1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
on May 23, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
