Faculty of Bioscience Engineering

Academic year 2015 – 2016

Effect of a mycotoxin binder on gut health and performance in pigs

Linghong Jin

Promotor: Prof. dr. ir. Stefaan De Smet

Dr. ir. Joris Michiels

Master’s dissertation submitted in partial fulfillment of the requirements

for the degree of

Master of Science in Nutrition and Rural Development

Main subject Tropical Agriculture

i

Copyright

“All rights reserved. The author and the promoters permit the use of this Master’s Dissertation for consulting purposes and copying of parts for personal use. However, any other use shall under the limitations of copyright regulations, particularly the stringent obligation to explicitly mention the source when citing parts out of this Master’s dissertation.”

Ghent University, June, 2016

Promotor Promotor

Prof. dr. ir. Stefaan De Smet Dr. ir. Joris Michiels

........................................ .............................................

The Author

Linghong Jin

........................................

ii

Acknowledgments

First, I would like to express my deepest appreciation and special thanks to my academic

promotors Prof. dr. ir. Stefaan De Smet and Dr. ir. Joris Michiels for their continuous guidance

and persistent support during my thesis.

I am truly grateful to Nutrex NV for giving me this opportunity to study in Belgium. Without

your financial support, everything would not be possible.

I also would like to express my sincere thanks to Ir. Kurt Van de Mierop and Ir. Anne Goderis

from Nutrex NV for believing in me and motivating me throughout my Master program.

My sincere gratitude also goes to Ir. Wei Wang for her careful guidance throughout the thesis. I

choose this moment to acknowledge her contribution gratefully.

I would like to use this opportunity to express my deepest gratitude to Tessa Van Der Eecken

and Dr. ir. Mario Van Poucke for their technical support.

I also would like to express my sincere thanks to my course coordinators Ir. Anne-Marie

Remaut-De Winter and Marian Mareen for their support during my Master program.

I owe my deepest gratitude to Dr. ir. Marta Lourenco for her help throughout my thesis.

Without her support, it would not be possible for me to study in Belgium.

I would like to express my best regards, deepest sense of gratitude to my colleagues and

classmates for their support and for all the fun we have had throughout the thesis.

A big thank you goes to my friends Ana, Channy, Linjuan, Yanming and Ziyu for their

encouragement all the time.

Finally, I am indebted to my parents for supporting me spiritually throughout my thesis.

iii

Dedication

I dedicate this Master dissertation to my father and mother for their continuous support and

inspiration.

iv

Abstract

Contamination of animal feeds with mycotoxins is a worldwide problem. Dietary exposure to

mycotoxins can result in worse zootechnical performance such as reduced feed intake and also

irritation of the gastrointestinal tract (GIT). Deoxynivalenol (DON) is a major mycotoxin

produced by Fusarium species in the field, and is commonly found in cereal grains. After

ingesting feed contaminated with DON, the intestines are first exposed to high concentrations

of the toxin. The normal homeostasis may be affected by reducing the self-renewing capacities

of the intestinal epithelium. Mycotoxin binders as mycotoxin detoxifying agents are supposed

to reduce the negative impacts on gut health and performance of these toxins.

This study was conducted to investigate the effect of 37 days dietary exposure to DON and/or

mycotoxin binder on growth performance and gut health in weaning piglets. We hypothesized

that the mycotoxin binder can reduce the negative effects induced by DON.

To test the hypothesis, we performed an animal feeding experiment in a 2 × 2 factorial design

with either or not addition of DON, and either or not addition of binder to the feed. A total of

120 weaning piglets weaned at 3.5 weeks of age with an average weight of 7.3 kg were used in

the feeding trial for 37 days. Piglets were allocated randomly to 4 different dietary treatments.

Each treatment contained 5 pens with 6 piglets per pen. The 4 different dietary treatments were

as follows: T1, Negative control diet; T2, Negative control diet with 1 kg/ton mycotoxin binder;

T3, Negative control diet with DON and T4, Negative control diet with DON and 1 kg/ton

mycotoxin binder. From day 0 until day 14 (sampling on day 14) of the experiment, the diet of

T3 and T4 was artificially contaminated with 3 mg/kg of a mixture of DON (2.6 mg/kg),

3A-DON (0.1 mg/kg) and 15A-DON (0.3 mg/kg), after which the DON contamination level

was reduced to 1 mg/kg from day 14 until day 37.

The small intestinal mucosa was obtained from weaning piglets at d14. RT-qPCR analysis was

performed to test if transcription of inflammatory cytokines, tight junction proteins and brush

border enzymes are influenced at 75% of small intestine length. The gut barrier function was

also assessed ex vivo by measuring the permeability for FITC-dextran 4 (FD4) across sheets of

the mucosa in Ussing chambers at 75% of small intestine length.

After 37 days dietary exposure to DON, there were no significant differences on growth

performance and gut health between DON-control and DON-challenged groups. On binder

level, we found that groups that received diets with binder had a significant better Average

Daily Gain (ADG) and Average Daily Feed Intake (ADFI) for the period d0-d14 as well as the

whole period d0-d37 compared to groups that received diets without binder. Meanwhile, there

was a tendency that piglets supplemented with binder had a better feed conversion rate

compared to piglets received diets without binder from day 1 until day 14 of the experiment

v

(p<0.10). As to gene expression of pro-inflammatory cytokines, supplementation of the diets

with mycotoxin binder significantly reduced the expression of TLR-4 compared to diets with

no binder. At the same time, there was a tendency that groups that received diets with binder

up-regulated the expression of occludin (OCLN) compared to groups that received diets

without binder (p<0.10).

There were interesting interactions on the growth performance between mycotoxin and binder.

For the first 14 days of the experiment, the group that received the diet contaminated with

DON in combination with mycotoxin binder (T4) had significant higher ADFI compared to the

group that received a diet only contaminated with DON (T3). This again resulted in a better

growth rate for T4 compared to T3 for period d0-d14. From the growth performance level, we

can see that binder could help improve the production when challenged with DON. As to the

immune response, the group fed the diet contaminated with DON in combination with

mycotoxin binder (T4) significantly down-regulated the expression of TLR-4 compared to the

group fed the diet only contaminated with DON (T3). At the same time, there was a tendency

that T4 up-regulated the expression of ZO-1 compared to T3 (p<0.10).

From our result, we can conclude that the mycotoxin binder, in combination with DON or not,

could improve growth performance especially in the first 14 days and also the whole period. It

also improves gut health by increasing the expression of tight junction proteins (TJPs) and

reducing the expression of TLR-4. So, the mycotoxin binder could be a good feed additive

regardless of mycotoxin contamination or not.

In further study, pure mycotoxin and different models, perhaps challenged with

lipopolysaccharide (LPS) could be applied.

vi

Table of Contents

Copyright ................................................................................................................................ i

Acknowledgments .................................................................................................................. ii

Dedication............................................................................................................................. iii

Abstract .................................................................................................................................iv

Table of Contents ...................................................................................................................vi

List of abbreviations ............................................................................................................ viii

Chapter 1 Introduction............................................................................................................. 1

1.1 Background information .................................................................................................... 1

1.1.1 Swine production ............................................................................................................ 1

1.1.2 Gastrointestinal tract (GIT) of weaning pigs.................................................................... 1

1.2 Problem statement ............................................................................................................. 1

1.3 Motivation of the study ...................................................................................................... 2

1.4 Study objectives and research questions ............................................................................. 2

1.4.1 Broad objective .............................................................................................................. 2

1.4.2 Specific objectives .......................................................................................................... 2

1.4.3 Research questions ......................................................................................................... 2

1.4.4 Hypothesis of the study................................................................................................... 2

1.5 Limitations of the study ..................................................................................................... 2

1.6 Description of the study area ............................................................................................. 3

Chapter 2 Literature study ....................................................................................................... 4

2.1 Mycotoxins in pig feed ...................................................................................................... 4

2.1.1 The trichothecenes and deoxynivalenol (DON) ............................................................... 5

2.1.1.1The trichothecenes ........................................................................................................ 5

2.1.1.2 The occurrence of DON ............................................................................................... 6

2.1.1.3 Toxicokinetics of DON ................................................................................................ 7

2.1.1.4 Toxicodynamics of DON ............................................................................................. 8

2.1.1.5 Effect of DON on growth performance in pigs ........................................................... 10

2.1.1.6 Effect of DON on gut health in pigs ........................................................................... 11

2.1.1.6.1 Effect on intestinal cell viability and proliferation ................................................... 11

2.1.1.6.2 Effect on intestinal histology and morphology ......................................................... 12

2.1.1.6.3 Effect on intestinal immune response ...................................................................... 12

vii

2.1.1.6.4 Effect on intestinal barrier function ......................................................................... 13

2.1.1.6.5 Effect on secretion of intestinal defense components ............................................... 13

2.1.1.7 EU regulation of DON in animal feed ........................................................................ 13

2.2 Mycotoxin binders ........................................................................................................... 14

2.2.1 Definition ..................................................................................................................... 14

2.2.2 Types ............................................................................................................................ 14

2.2.2.1 Aluminosilicates ........................................................................................................ 15

2.2.2.2 Activated carbon ........................................................................................................ 15

2.2.2.3 Yeast Cell Wall .......................................................................................................... 15

2.3 Effect of mycotoxin binders ............................................................................................. 15

Chapter 3 Materials and methods ........................................................................................... 18

3.1 Animals and experiment treatments ................................................................................. 18

3.2 Feed and diet ................................................................................................................... 18

3.4 Sampling ......................................................................................................................... 20

3.5 Growth performance ........................................................................................................ 20

3.6 Ex vivo measurement of intestinal permeability................................................................ 20

3.7 RNA isolation and reverse-transcription quantitative real-time PCR ................................. 20

3.8 Statistical analysis ........................................................................................................... 22

Chapter 4 Results and discussion ........................................................................................... 24

4.1 Growth performance ........................................................................................................ 24

4.2 Permeability measurements in distal small intestine ......................................................... 24

4.3 mRNA expression of tight junction proteins, inflammatory cytokines and brush border

enzyme in distal small intestine ............................................................................................. 25

4.4 Principal component analysis ........................................................................................... 28

4.5 Discussion ....................................................................................................................... 29

4.5.1 Effect of DON addition to feed on gut health and performance...................................... 29

4.5.2 Effect of binder addition to feed on gut health and performance .................................... 31

4.5.3 Interaction between mycotoxin and mycotoxin binder ................................................... 33

Chapter 5 Conclusions and recommendations ........................................................................ 35

5.1 General conclusions ........................................................................................................ 35

5.2 Recommendations for further research ............................................................................. 35

Chapter 6 Reference list ........................................................................................................ 36

viii

List of abbreviations

3A-DON 3-acetyl- deoxynivalenol

15A-DON 15-acetyl- deoxynivalenol

AC Activated carbon

ADFI Average Daily Feed Intake

ADG Average Daily Gain

ADONs Acetylated-deoxynivalenols

AFB1 Aflatoxin B1

CLDN-1 Claudin 1

CLDN-2 Claudin 2

CLDN-5 Claudin 5

CLDN-7 Claudin 7

DON Deoxynivalenol

FB1 Fumonisin B1

FC Feed conversion

FD4 FITC-dextran 4

GIT Gastrointestinal tract

HCK Hematopoietic cell kinase

HPRT-1 Hypoxanthine Phosphoribosyltransferase 1

HSCAS Hydrated sodium calcium aluminosilicate

IAP Intestinal alkaline phosphatase

IFN-γ: Interferon, gamma

Ig Immunoglobulins

IL-1β Interleukin 1, beta

IL-8 Interleukin 8

LPS Lipopolysaccharide

MAPK Mitogen-activated protein kinase

NIV Nivalenon

OCLN Occludin

OTA Ochratoxin A

PCA Principal component analysis

ix

PPIA Peptidylprolyl isomerase A

SAPK/JNK Stress-activated protein kinases/cJun N-terminal kinases

TBP TATA-binding protein

TJP Tight junction protein

TLR-4 Toll like receptor 4

TNF-α Tumor necrosis factor, alpha

ZEA Zearalenone

ZO-1 Zona occluden 1

ZO-2 Zona occluden 2

1

Chapter 1 Introduction

This chapter briefly introduces the background information for this study. Problem statement,

motivation, study objectives, research questions and limitations of the study as well as the

description of the study area are included in this chapter.

1.1 Background information

1.1.1 Swine production

Swine production plays an important role in agriculture and occupies a large proportion of

Gross National Product in many countries worldwide. The EU produces 150 million pigs every

year, being the world's second largest pork producer. Pork occupies 9.0% of the agricultural

output of EU. There has been a 1.0% decrease in pig numbers over the past 10 years; however,

pork production has remained stable. This requires production efficiency in swine industry

despite constraints. Feed hygiene remains one of the important challenges in modern swine

production.

1.1.2 Gastrointestinal tract (GIT) of weaning pigs

Weaning is the period when piglets undergo the greatest challenge in their life in modern swine

production. Piglets after weaning may suffer from reduced feed intake as well as decreased

weight gain as the porcine gastrointestinal tract (GIT) is still underdeveloped. The gut is more

susceptible to toxins and the gut barrier may be affected easily. The mucosal epithelium of the

intestine plays an important role in resistance against gastrointestinal diseases. The intestinal

mucosa has to face important chemical and biological challenges and its health is an important

issue to maintain the homeostasis (Otte et al., 2009, Hecht, 1999, Podolsky, 2000). Defects in

barrier integrity will lead to histomorphological alterations, modulation of the expression of the

genes coding for inflammatory cytokines and impaired expression of tight junction proteins

(TJPs).

1.2 Problem statement

The contamination of feedstuffs with mycotoxins is a big issue worldwide. Mycotoxins involve

hundreds of chemically toxic compounds that are produced by fungi. The Biomin Mycotoxin

Survey showed that deoxynivalenol (DON) produced by Fusarium was the most prevalent

single mycotoxin found in all feedstuffs all over the world in 2015. The DON concentrations of

71% of finished feed samples and 88% of corn samples from all DON-contaminated samples

were above a value known to influence on pig health and performance. DON is physically

stable and easily enters the food chain (Turner et al., 2008). Humans and all animal species can

2

exhibit toxic effects by DON ingestion (Pestka and Smolinski, 2005), with pigs being the most

susceptible one (Eriksen and Pettersson, 2004). Dietary exposure to mycotoxins can result in

worse zootechnical performances such as reduced feed intake and also as an irritation of the

GIT. Hence, feed contaminated with DON is really a severe problem posing threat to swine

production.

1.3 Motivation of the study

Many studies about the effects of DON on intestinal health and growth performance in farm

animals have already been investigated. Mycotoxin binders as mycotoxin detoxifying agents

are supposed to reduce the negative impacts on gut health and performance of these toxins.

However, there are few publications on the effects of toxin binders on gut health and growth

performance in piglets.

1.4 Study objectives and research questions

1.4.1 Broad objective

The broad objective of this research was to assess the effect of 37 days dietary exposure to

DON and/or mycotoxin binder on gut health and performance in pigs.

1.4.2 Specific objectives

The specific objectives of the research were to study the effect of DON on gut health and

growth performance and to investigate if a mycotoxin binder can reduce the negative effects

induced by DON.

1.4.3 Research questions

The research questions are: 1) What was the effect of DON and/ or the mycotoxin binder on

growth performance? 2) What was the effect of DON and/ or the mycotoxin binder on

intestinal permeability? 3) What was the effect of DON and/ or the mycotoxin binder on the

gene expression of TJPs, pro-inflammatory cytokines and brush border enzyme?

1.4.4 Hypothesis of the study

We hypothesized that the mycotoxin binder could reduce or prevent detrimental interactions of

DON and its metabolites with the gut mucosa and hereby improve animal performances, either

via binding or other interactions.

1.5 Limitations of the study

3

We artificially added DON to contaminate experimental diets in this study. The toxin was a

mixture of DON and its acetylated derivates. DON and its acetylated derivates show different

toxic potential which made our study complicated.

1.6 Description of the study area

Mycotoxins produced by Fusarium are the most frequently occurring mycotoxins worldwide.

A long-term survey from 2004 to 2012 showed that DON was present in 56% of the samples

worldwide. From Figure 1-1, we can see that DON is one of the single most prevalent

mycotoxins in EU (33%-64%). Therefore this thesis will focus on DON in EU.

Figure 1-1 Global occurrence of mycotoxins (Schatzmayr and Streit, 2013)

4

Chapter 2 Literature study

2.1 Mycotoxins in pig feed

The term mycotoxin was first mentioned following a sudden and fatal outbreak with more than

100,000 young turkeys that died due to the consumption of peanut meal contaminated with

aflatoxins. It took place in 1960 on poultry farms in England, resulting in Turkey X disease

(Asao et al., 1963). Mycotoxins are harmful secondary metabolites of fungi which can cause

intoxications at very low amounts. These metabolites are produced by various fungi ,

commonly known as moulds. Mycotoxins are found in naturally contaminated feedstuffs and

also foods for human consumption, such as fruits and nuts. It has been estimated by FAO that

at least 25% of the grain production is contaminated all over the world every year (Richard et

al., 2003).

The most important mycotoxins present in animal feeds are mainly generated by the fungi of

genera Aspergillus, Penicillium, Fusarium, Alternaria and Claviceps (Steyn, 1998). Toxigenic

moulds can develop under all climate conditions and certain moisture (Aw>0.6) in two ways;

either in the field or during storage. Aspergillus and Penicillium species are referred to as

storage mycotoxins because they generally invade feed commodities after crop harvest

(Filtenborg et al., 1996). Fusarium species are known as field fungi as they develop

mycotoxins during the growth of the plant.

So far, more than 300 different mycotoxins have been identified (Binder, 2007). Some of these

are of biological and economic significance in animal production. From a global perspective,

aflatoxins, fumonisins, zearalenone (ZEA), ochratoxin and trichothecenes are the five most

frequent reported mycotoxins or mycotoxin groups in agriculture (Shephard, 2008).

Mycotoxins are very heat stable and difficult to be destroyed by normal food processing,

making it easy to enter the feed and food chain. Despite the fact that mycotoxins are tasteless

and odourless, they are still a big issue in animal production due to their toxicity after ingestion.

When consumed, they can lead to various adverse health impacts. The main toxic effects are

growth depression, reproductive disorders, immunosuppression and other abnormal

physiological effects. Aflatoxins produced by Aspergillus were first isolated and identified in

poultry in England in the earlier 1960s, then in pigs. Aflatoxins are one of the

most carcinogenic toxins known (Hudler, 1999). Aflatoxin B1 (AFB1) as the most

predominant naturally occurring aflatoxin has been classified as a group 1, being carcinogenic

to human beings by the International Agency for Research on Cancer (IARC) (WHO-IARC,

1993). AFB1 considered as very toxic for animals will lead to lowered growth rate, impaired

reproduction and other adverse effects (Rawal et al., 2010). Fumonisins are a family of

5

mycotoxins produced by Fusarium. Of these mycotoxins, fumonisin B1 (FB1) is the most

abundantly produced and the most toxic. FB1 has been classiflied as group 2B human

carcinogen by IARC. FB1 will lead to pulmonary swelling and hydrothorax in pigs. ZEA

produced by Fusarium is of critical importance in terms of its frequent occurrence and toxic

potency. Dietary exposure to low doses of ZEA will produce significant toxic effects, such as

hyperoestrogenic syndromes and subsequent reproductive dysfunction in swine. Many cases of

nephropathy in pigs were reported in Denmark that resulted from barley, being naturally

contaminated by Ochratoxin A (OTA). This resulted in the identification and characterization

of chronic detrimental effects of contaminated feed on farm animals (Krogh et al., 1973). OTA

produced by Aspergillus and Penicillium is the most commonly and most toxic member of

Ochratoxins. Pigs are particularly sensitive to OTA for its tissue accumulation, owing to a

rather long serum half-life and the enterohepatic recirculation. OTA is important for both

animal and human health because OTA is regarded as a human carcinogen by IARC when

indirect exposure through the animal derived food. Next to ZEA and FB1, the most important

Fusarium mycotoxins are the trichothecenes.

2.1.1 The trichothecenes and deoxynivalenol (DON)

2.1.1.1The trichothecenes

Trichothecenes are a large group of sesquiterpenoid mycotoxins mainly produced by different

species of Fusarium, Stachybotrys, Cephalosporum, Trichoderma, Verticimonosporium,

Myrothecium, Trichothecium and other fungi (EFSA, 2004). They share a tetracyclic

12,13-epoxytrichothec-9-ene back bone in common which is responsible for the toxicological

activity (Figure 2-1) (Desjardins et al., 1993, Sudakin, 2003). According to the absence or

presence of their functional groups, trichothecenes can be grouped into four types being type A,

B, C and D (Ueno, 1985, Ueno et al., 1973). As one of the type A members, T-2 attracted most

concern due to its acute toxicity (Calvert et al., 2005). The most frequently occurring

trichothecene, DON and other type B members such as nivalenon (NIV) are also very

important to animal health. On the other hand, type C and type D trichothecenes cause less

concern (Gutleb et al., 2002). Trichothecenes are the most prevalent mycotoxins produced by

Fusarium, mainly occurring in cereals. Acute high dose of trichothecenes will cause diarrhea,

emesis, and ultimately death. Chronic exposure to trichothecenes will lead to impaired appetite,

reduced weight gain, gastrointestinal hemorrhage and immunologic alterations (Bondy and

Pestka, 2000). Numerous laboratory animals studies have revealed that trichothecenes can be

both immunosuppressive and immunostimulatory, depending on various factors including the

dose of trichothecenes, the route and duration of exposure, the animal status and so on (Bondy

and Pestka, 2000).

6

Figure 2-1 General chemical structure of trichothecenes (Calvert et al., 2005). They share a

tetracyclic 12,13-epoxytrichothec-9-ene back bone in common.

2.1.1.2 The occurrence of DON

DON as a type B trichothecene, is an epoxy-sesquiterpenoid chemically described as (3α,

7α)-3, 7, 15-trihydroxy-12, 13-epoxytrichothec-9-en-8-one (Figure 2-2, C15 H20O6). DON is the

most commonly encountered trichothecene found in cereals in Europe and North America

(Richard et al., 2003, Schothorst and van Egmond, 2004). DON is highly toxic and is

particularly noted for two typical toxicological effects: reduced feed consumption and emesis

in swine, hence another name vomitoxin. DON is developed at field superior to harvest and the

production cannot be avoided completely under production conditions due to the high

uncertainty of weather, thus DON is of particular importance. Surveys have illustrated that

DON occurs predominantly in cereals and grains such as oats (68%), barley (59%), wheat

(57%), rye (49%) and maize (41%) and less often in rice (27%) (JECFA, 2002). It was also

detected in triticale, sorghum and popcorn and some other products. The occurrence of DON is

primarily related to two typical plant pathogens, Fusarium graminearum (Gibberella zeae) and

Fusarium culmorum. Infection by these fungi might cause Gibberella ear rot in maize and

Fusarium head blight in wheat (JECFA, 2002). Moisture at the time of flowering is the main

risk factor affecting the prevalence of Fusarium head blight. In cereals stored properly at dry

condition and free of toxin after harvest, DON production has not been observed in storage

(Jacobsen et al., 2007).

Under natural conditions, DON is present along with its two major acetylated forms,

3-acetyl-deoxynivalenol (3A-DON) and 15-acetyl-deoxynivalenol (15A-DON) at lower

concentrations in cereals (EFSA, 2004). This was confirmed by some studies that feedstuffs

naturally contaminated with DON inclined to exhibit higher toxicity than feed added with pure

DON. Feed co-contaminated with other Fusarium mycotoxins, including ZEA, NIV, as well as

FBs, is also regularly observed.

7

Figure 2-2 Chemical structure of DON: (3α,7α)-3,7,15-trihydroxy-12,13-epoxytrichothec-9-en-

8-one

2.1.1.3 Toxicokinetics of DON

Toxicokinetics studies describe the processes including absorption, distribution, metabolism

and excretion (ADME) when toxins enter the body. Upon ingestion, DON is speedily adsorbed

in swine with an oral bioavailability around 54% after single oral bolus administration

(Goyarts and Danicke, 2006). While after chronic exposure, systemic DON absorption

increased to 89% (Goyarts and Danicke, 2006). In animal studies with pigs intragastric dosing

of radio-labeled DON, it was demonstrated that the time necessary for reaching maximal

plasma concentrations was within half an hour (Prelusky et al., 1988). The rapid appearance

indicated that the greater part of DON was adsorbed from the upper part of the GIT, involving

stomach and the small intestine. However, the plasma elimination of DON is slower in pigs

compared to other species. Different studies showed that the half-life of elimination varied

between 1.2 h and 4 h in pigs (Coppock et al., 1985, Prelusky and Trenholm, 1991, Eriksen et

al., 2003, Prelusky et al., 1988). Plasma clearance was observed to be 7.14 h in pigs after

gavaging radio-labeled DON (Prelusky et al., 1988). Excretion of DON is principally via urine.

93% of intragastrically administered dose was detected in urine when pigs were given DON at

a dose of 0.6 mg/kg of body weight. Accumulation of DON in tissues or transmission to milk

or eggs is very limited (Prelusky and Trenholm, 1991).

DON may be metabolized by de-epoxidation, yielding less toxic products. The main

metabolite of DON is de-epoxy-deoxynivalenol (DOM-1), which is de-epoxidized by the

intestinal commensal bacteria (Danicke et al., 2004a). In contrast to other species, only a small

part of DON is metabolized. Though DOM-1 was eliminated in the urine, it has not been

discovered in blood (Eriksen et al., 2003, Danicke et al., 2004b). Besides de-epoxidation

reactions in the GIT, DON and DOM-1 both can be conjugated with glucuronic acid in the

intestinal mucosa and liver. The glucuronide conjugate of DON in pigs fed 3A-DON account

for 33% and 42% of the DON in urine and plasma, respectively (Eriksen et al., 2003).

8

Cereals and their by products may contain DON and its acetylated derivatives

acetylated-deoxynivalenols (ADONs). In vitro study with pig faeces and ileal digesta showed

that 3A-DON was de-acetylated to free DON (Eriksen et al., 2002). Some in vivo studies also

showed that the acetylated forms of DON were rapidly de-acetylated in the proximal part of

the GIT and absorbed exclusively as free DON (Veršilovskis et al., 2012, Eriksen et al., 2003).

12% of the dose administered was detected as free DON in the stomach after one hour

administration of 3A-DON and 15A-DON, indicating that acetylated derivatives could be

hydrolyzed in the stomach (Veršilovskis et al., 2012). Veršilovskis et al. also confirmed that the

acetylated DON can be glucuronidated in the stomach without deacetylation (Veršilovskis et al.,

2012). In pigs fed 2.5 mg/kg 3A-DON, neither 3A-DON nor de-epoxide metabolite of

3A-DON could be detected in plasma (Eriksen et al., 2003). Taken together, 3A-DON could be

nearly completely hydrolyzed to DON, and 15A-DON to a less extent to DON.

Some studies conducted in livestock found that feedstuffs naturally contaminated with DON

inclined to exhibit higher toxicity than feeds with purified DON. These findings cause concern

on the potential different toxicity of ADONs. The toxicity of DON is well investigated.

However, there are few publications on the toxicity of its derivatives 3A-DON and 15A-DON.

Pigs administered either with DON, 3A-DON or 15A-DON at dose of 0.9 mg per kg feed,

ADONs showed increased bioavailability and in vivo hydrolysis compared to DON. This may

be due to the decreased polarity of ADONs which leads to an increased passive diffusion and

oral absorption. Different models in vitro and in vivo that has been done to explore the toxicity

of DON and its acetylated forms. Results showed that 15A-DON is the most toxic, followed by

DON and 3A-DON (Table 2-1) (Pinton et al., 2012). The higher toxicity of 15A-DON should

be taken into consideration for the maximum level in feedstuffs.

Table 2-1 Toxicity of DON, 3A-DON and 15A-DON in different models

2.1.1.4 Toxicodynamics of DON

DON exhibits toxic effects after administration to experimental animals, with impaired growth

rate being the most consistent effect observed in most species in routine analysis of toxicity

(JECFA, 2002). Studies have also demonstrated alternations in immune function induced by

9

DON. These alternatives can be explained by the cellular and molecular mechanism of DON

(Figure 2-3) (Pestka, 2007). DON is known to be an inhibitor of protein synthesis as well as

nucleic acid synthesis (Ueno, 1983). DON binds to the 60S mammalian ribosomal subunit and

interferes with the active site of peptidyl transferase, inhibiting protein synthesis of chain

initiation and elongation (Ehrlich and Daigle, 1987). Futhermore, inhibitors of the peptidyl

transferase can trigger cell apoptosis by aribotoxic stress response (RSR). Binding of DON to

ribosomes can rapidly activate stress-activated protein kinases/cJun N-terminal kinases

(SAPK/JNK), which is a mitogen-activated protein kinase (MAPK) (Iordanov et al., 1997).

DON-induced MAPK activity activates transcription factors that promote gene expression of

pro-inflammatory cytokines as well as induce apoptosis (Yang et al., 2000, Zhou et al., 2003,

Moon and Pestka, 2002).

Exposure to low concentrations of DON appears to promote expression of chemokines,

cytokines and pro-inflammatory genes together with immune stimulation in vitro and in vivo

(Pestka, 2007). However exposure to high doses, leukocyte apoptosis ensues, resulting in

immunosuppression (Pestka, 2007). In intestinal epithelium, the toxicity of DON has been

related to MAPK activation along with a reduced expression of TJPs and loss of barrier

function (Pestka, 2010, Pinton et al., 2010, Sergent et al., 2006). Literature indicates the

following order of decreasing toxicity: 15A-DON, DON and 3A-DON (Pinton et al., 2012).

The molecular basis for the higher toxicity of 15-ADON was due to its potential to increase

phosphorylation of MAPK.

Figure 2-3 Molecular mechanism for DON. DON enters the cell via diffusion and binds to 60S

mammalian ribosomal subunit and interferes with the active site of peptidyl transferase, which

transduces signal to RNA-activated protein kinase (PKR) and hematopoietic cell kinase (HCK).

10

DON-induced mitogen-activated protein kinases (MAPK) activity activates transcription

factors that promote gene expression of pro-inflammatory cytokines as well as induce

apoptosis(Pestka, 2007)

2.1.1.5 Effect of DON on growth performance in pigs

DON is physically stable and easily enters the food chain (Turner et al., 2008). Humans and all

animal species can exhibit toxic effects by DON ingestion (Pestka and Smolinski, 2005).

Although DON is not considered as a major acute toxin to domestic animals, it is considered as

a critical factor for economic loss due to loss of productivity. Among all the animals, pigs

exhibit the greatest sensitivity to DON through their cereal-rich diet (Eriksen and Pettersson,

2004). Dietary exposure of animals to feeds contaminated with DON can affect metabolic

disturbances, influence the immune system (Pestka and Smolinski, 2005, Pinton et al., 2008,

Wache et al., 2009) and cause reproductive alterations (Tiemann and Danicke, 2007). DON

contaminated feed can affect pigs’ appetite depending on the dose. Clinical signs in affected

swine include digestive problems, such as soft faeces, diarrhea, and an increased susceptibility

to other diseases and reduced feed intake and other impaired growth performance.

After administration of DON regardless long term or short term, reduced feed intake and lower

growth rate are the principal effects shown in pigs. Feed contaminated with as low as 1 mg/kg

DON have been related to reduced feed intake and feed refusal in pigs. However more

typically, doses over 2-5 mg/kg are required for reduced feed consumption and lowered weight

gain. Concentrations over 12 mg/kg are required for complete feed refusal followed by

concentrations over 20 mg/kg for vomiting (Haschek et al., 2002, Abbas et al., 1986, Pestka et

al., 1987, Young et al., 1983). Figure 2-4 (House, 2003) represents data collected from

numerous studies conducted to assess the effect of dietary exposure to DON on feed intake in

swine. Each point represents the mean value of a treatment and the trend line has been plotted.

On the basis of simple regression analysis, approximately 7.5% reduction in feed intake for

every 1 mg/kg DON is expected. Feed refusal even shows up when pigs are administered with

DON intraperitoneally, thus, feed refusal is not owing to taste (Prelusky, 1997). Feed refusal

and emesis seem to be a result of neurochemical imbalances on the level of brain.

11

Figure 2-4 The effect of dietary exposure to DON on feed intake in swine (House, 2003).

2.1.1.6 Effect of DON on gut health in pigs

The GIT acts as the first barrier against the uptake of xenobiotics such as nutritional antigens,

food contaminants and bacteria present in the intestinal lumen (Arrieta et al., 2006). After

consumption of feed contaminated with DON, the intestine can expose to high levels of the

toxin (Pinton et al., 2009). The normal homeostasis may be destroyed by influencing

self-renewing capacities of the intestinal epithelial cells.

2.1.1.6.1 Effect on intestinal cell viability and proliferation

Effects of trichothecenes on intestinal epithelium viability and proliferation were measured in

various cell types in vitro. Different studies show that there is a great heterogeneity in

sensitivity among different cell types. Proliferating intestinal epithelial cells are more sensitive

to DON-induced toxicity compared to differentiated cells. The higher sensitivity of

proliferating intestinal epithelium is probably depending on the capacity of DON to inhibit

protein synthesis as well as DNA and RNA synthesis(Bony et al., 2006). When studying the

effects of DON on intestinal epithelial cell viability, it has been shown that cytotoxicity is

affected in a time and dose dependent manner. High concentrations of DON exhibit toxic

effects negatively affecting the intestinal barrier integrity. Whereas at low concentrations,

DON do not induce toxic effects, but has modulatory effects on cellular regulation (Diesing et

al., 2011b). Studies concerning the effects of DON on intestinal epithelium proliferation reveal

12

that high doses of DON influence cell proliferation by blocking the cell cycle in the G2/M

phase (Yang et al., 2008).

2.1.1.6.2 Effect on intestinal histology and morphology

A wide range of histomorphological alterations are related to the presence of contaminants in

animal feeds. Studies show that DON can affect the intestinal histology and morphology by

affecting intestinal cell viability and proliferation. DON and its acetyl derivatives are

associated with mucosal morphological abnormalities in pigs. Villi height decrease or atrophy

and other regressive lesions in the GIT are frequently reported in pigs (Kolf-Clauw et al., 2009,

Zielonka et al., 2009, Bracarense et al., 2012). These alterations can result by suppression of

mitosis and protein synthesis (Eriksen and Pettersson, 2004, Yunus et al., 2012).

2.1.1.6.3 Effect on intestinal immune response

The intestinal mucosa functions as a vital barrier between the intestinal milieu and the luminal

content, and has to face important chemical and biological challenges. The intestinal

epithelium are connected by TJPs and covered with mucus (Schenk and Mueller, 2008). The

mucosal immunity can be influenced by feed contaminants, such as Fusarium mycotoxins

(Figure 2-5) (Bouhet and Oswald, 2005). It is indicated that DON will enlarge the permeability

of the intestinal epithelium in pigs (Pinton et al., 2009). DON is also able to regulate the

production of pro-inflammatory cytokines, increasing the expression of IL-1β, IL-2 and IL-6 in

the jejunum, and IL-1β, IL-6 and TNF-α in the ileum in pigs (Bracarense et al., 2012).

Figure 2-5 Overview of the effects of DON on intestinal immune response. DON alters the

13

intestinal defense mechanisms including cell proliferation, immunoglobulins (Ig) production,

pro-inflammatory cytokines production and intestinal permeability (Bouhet and Oswald,

2005).

2.1.1.6.4 Effect on intestinal barrier function

Epithelial integrity can be measured by transepithelial electrical resistance (TEER) and the

passage of macromolecular markers, such as FITC-dextran 4 (FD4), across the epithelial

monolayer. Several in vitro studies indicated that DON is able to decrease TEER and increase

the intestinal permeability of IPEC-1 cells in a dose and time dependent manner (Pinton et al.,

2009). The alterations in these two parameters are related to the decrease in the expression of

specific TJPs (Pinton et al., 2009, Diesing et al., 2011a). Claudins are the most important

components of the TJPs. The family of zonula occludens (ZO) is a part of the cytoplasmic

plaque of the TJPs. These are important parameters as DON leads to the impaired intestinal

barrier function through the reduced expression of the TJPs. It was reported that claudin 3 and

claudin 4 showed reduced protein expression in IPEC-1 monolayer epithelium exposed to

DON (9000 ng/mL) (Pinton et al., 2009, Pinton et al., 2010). Testing 2000 ng/ml DON on the

intestinal cell lines resulted in disintegration of zonula occludens-1 (ZO-1), while 200ng/ml

showed no effect on this parameter (Diesing et al., 2011b). The activation of MAPK by DON

and its acetyl derivatives suppresses the expression of TJPs, which is responsible for the loss of

barrier function (Pinton et al., 2012). In this way, DON is able to decrease the expression of

TJPs, which in turn lowers the intestinal barrier function.

2.1.1.6.5 Effect on secretion of intestinal defense components

Feed contaminants can modulate mucus secretion. The mucin glycoproteins produced by

goblet cells have direct antimicrobial properties that limit the growth of microorganisms in the

mucus. Secretory antibodies, IgA and IgG are very important components of the mucosal

barrier, and are secreted into the mucus by the epithelial cells (Strugnell and Wijburg, 2010).

Some studies dealing with the effect of DON on pigs showed interesting results related to

immunologic alterations. Several studies have demonstrated the concentration of IgA in the

serum of pigs treated with contaminated feed (Etienne et al., 2008). It was indicated that the

concentration of IgA in the serum of piglets significantly increased when piglets were fed with

600 µg/kg DON (Drochner et al., 2004). However, the concentrations of IgA in the plasma

remained unchanged when piglets were applied with 4 mg/kg of DON for 3 months (Bergsjo et

al., 1992, Danicke et al., 2004b).

2.1.1.7 EU regulation of DON in animal feed

Maximum levels for DON in animal feedstuffs have not been set in EU. In Europe, guidance

14

values for the presence of DON in animal feedstuffs have been established by the European

Commission (Table 2-2).

Table 2-2 The guidance values for the presence of DON in products intended for animal feed

(feedstuffs with a relative moisture of 12%) (The commission of the European Commission,

2006)

Mycotoxin Products intended for animal feed Guidance value in mg/kg

DON Feed materials:

Cereals and cereal products with the exception of maize by-products 8

Maize by-products 12

Complementary and complete feedingstuffs:

Complementary and complete feedingstuffs with the exception of*: 5

*Complementary and complete feedingstuffs for pigs 0.9

*Complementary and complete feedingstuffs for calves (< 4 months), lambs and kids 2

2.2 Mycotoxin binders

2.2.1 Definition

Supplementation with mycotoxin binders to feeds contaminated with mycotoxins has been

considered to be the most promising dietary strategy to reduce the negative effects of

mycotoxins. Regarding the establishment of the new feed additive in EU, a basic worry is that

the safety towards farm animals and in vivo efficacy in binding mycotoxins of the majority of

these feed additives have not been completely tested yet (Ledoux et al., 2001). Therefore, the

commission regulation (EC, 386/2009) defines mycotoxin detoxifying agents as “Substances

for reduction of the contamination of feed by mycotoxins: substances that can suppress or

reduce the absorption, promote the excretion or modify their mode of action”. In other words,

these are substances that can modify mechanisms of mycotoxins. On the one hand, they can

decrease or inhibit the absorption of mycotoxins, and on the other hand, they can promote the

excretion of mycotoxins.

2.2.2 Types

Depending on different mechanisms, we can divide mycotoxin detoxifying agents into two

main subcategories: absorbing agents and biotransforming agents. Mycotoxin absorbing agents

are also called mycotoxin binders, leading to a reduction of the bioavailability of the

mycotoxins (Huwig et al., 2001). Mycotoxin binders are large weight molecules and capable of

15

binding to mycotoxins in animal feeds efficiently without dissociating in the digestive tract

under all conditions of the GIT (Döll and Dänicke, 2004). Then the complex passes through

the GIT and is excreted via the faeces whereby mycotoxin uptake by the animal is prevented.

This helps minimize absorption of mycotoxins by target organs. Some typical binders of

absorbing agents are listed below.

2.2.2.1 Aluminosilicates

Aluminosilicate minerals are inorganic substances composed of aluminium, silicon oxygen and

countercations. Most studies on the mycotoxin binders have focused on aluminosilicates, such

as montmorillonites, bentonites, zeolite and hydrated sodium calcium aluminosilicate

(HSCAS). HSCAS is the most preferred one among the absorbents (Galvano et al., 2001,

Kabak et al., 2006).

2.2.2.2 Activated carbon

Activated carbon (AC) is an organic mycotoxin binder of interest. It is also called as activated

charcoal, activated coal, or carbo activates. AC is formed by pyrolysis of different kinds of

organic substances. It is produced by activation processes to develop a highly permeable

structure available for adsorption or chemical reactions (Galvano et al., 2001). Different

original AC shows different adsorbing properties. AC is one of the non-toxic and most

effective mycotoxin binders with a wide variety of toxins. AC has been commonly used for

severe intoxications and demonstrated to be an effective mycotoxin binder of DON, AFB1 and

OTA (Devreese et al., 2012, Huwig et al., 2001).

2.2.2.3 Yeast Cell Wall

Cell walls naturally derived from the Saccharomyces cerevisiae yeasts are commonly used as

an organic mycotoxin binder. Yeast cell walls are mainly made up of carbohydrates and

proteins, exhibiting various different but easy approachable adsorption centers. Instead of the

whole cell but only using yeast cell walls shows enhanced binding ability to mycotoxins. This

binder has demonstrated to effectively bind to DON, AFB1, ZEA, OTA and T-2 (Bejaoui et al.,

2004, Freimund et al., 2003, Yiannikouris et al., 2004).

2.3 Effect of mycotoxin binders

In summary, the present data provide strong evidence that exposure to DON in domestic

animals will result in reduced feed intake and vomiting with decreased performances. Pigs are

more sensitive to these negative effects. Available data regarding dietary exposure to DON in

pigs is not complete and no safe level for feed intake is worked out for pigs.

In order to solve the problem caused by mycotoxicosis, various strategies have been

16

investigated, such as physical, chemical, and biological methods (Doyle et al., 1982, Ramos

and Hernandez, 1997). The most applied method is the utilization of mycotoxin binders mixed

with the feed (Huwig et al., 2001). The mycotoxin binders are stable over a wide pH range and

able to absorb a wide range of mycotoxins. Also binders can bind different levels of

contamination and have low inclusion rate. All these properties have proven that the addition

of a non-nutritive absorbent material to animal diets is practically feasible and very useful.

Binders help reduce gastrointestinal absorption of mycotoxins and the mycotoxins are no

longer absorbed by the animal (Huwig et al., 2001). Some in vivo and in vitro studies about the

absorption of DON by different mycotoxin binders are given in Table 2-3 and Table 2-4. Some

authors suggest that mycotoxin binder not only bind to the mycotoxin, but perhaps, can bind

also other toxins such as bacterial endotoxins. In that respect, supplementation with binders

could potentially reduce the risk for infection and inflammatory responses by Gram-negative

bacteria (Collier et al., 2011).

Table 2-3 Effect of mycotoxin binders on growth inhibition of trichothecenes

Adsorbent Concentration Mycotoxin Effects observed* Reference

Super-activated charcoal 0.5 trichothecenes No effect (Edrington et al., 1997)

Inorganic 0.5 trichothecenes 25%(broiler chickens) (Bailey et al., 1998)

HSCAS 0.5 trichothecenes No effect (Kubena et al., 1990)

HSCAS 0.5 trichothecenes 3% ( chickens) (Kubena et al., 1993)

HSCAS 0.25/0.375/0.8 trichothecenes 43% (young broiler chickens) (Kubena et al., 1998)

HSCAS 0.5/1.0 trichothecenes No significant effect (pigs) (Patterson and Young,

* Effects observed was calculated as percentage of the decline of growth inhibition.

Table 2-4 In vitro absorption of trichothecenes by different mycotoxin binders

Adsorbent Mycotoxin Adsorption Index (%) Reference

Activated carbon DON 1.8-98.9 (Lemke et al., 2001)

Activated carbon trichothecenes 1.3 (Galvano et al., 1998)

HSCAS DON 3.9 (Galvano et al., 1998)

Sepiolite DON 4.5 (Galvano et al., 1998)

Diatomaceous earth trichothecenes 0.5-1.5 (Natour and Yousef, 1998)

Modified yeast cell walls extract trichothecenes 0.2-1.9 (Howes and Newman, 2000) Adsorption Index is defined as the ratio of difference between the amount of mycotoxin bound and the amount

desorbed to the initial amount.

In a word, mycotoxin binders can reduce the uptake of the toxins and alleviate the adverse

effects of mycotoxins. The efficiency of the absorption relies on the chemical structure of both

the mycotoxins and the binders. As different mycotoxins act in different ways, it is necessary

17

to investigate that the mycotoxin binder does not eliminate essential nutrients from the diet

before applying this technique into practice.

18

Chapter 3 Materials and methods

3.1 Animals and experiment treatments

To test the hypothesis, we performed an animal feeding experiment in a 2 × 2 factorial design

with either or not addition of DON, and either or not addition of binder to the feed. A total of

120 weaning (3.5week suckling period) piglets with an average weight of 7.3 kg were used in

the feeding trial for 37 days. They were provided with water and feed ad libitum throughout

the whole experimental period. Animal experimental procedures were in accordance to the

guidelines of the Ethical Committee of the Faculty of Veterinary Sciences, Ghent University.

Piglets were allocated randomly to 4 different dietary treatments. Each treatment contained 5

pens with 6 piglets per pen. The 4 different treatments were as follows:

T1. Negative control diet (uncontaminated basal diet);

T2. Negative control diet with 1 kg/ton mycotoxin binder;

T3. Negative control diet with DON;

T4. Negative control diet with DON and 1 kg/ton mycotoxin binder

From day 0 until day 14 (sampling on day 14) of the experiment, the diet of T3 and T4 was

artificially contaminated with 3 mg/kg of a mixture of DON (2.6 mg/kg), 3A-DON (0.1 mg/kg)

and 15A-DON (0.3 mg/kg), after which the DON contamination level was reduced to 1 mg/kg

from day 14 until day 37.

3.2 Feed and diet

The compositions of the negative control diets used in this study are given in Table 3-1. They

were wheat-barley based diets.

The challenge diets were artificially contaminated with the fungal culture containing DON and

its metabolites. DON was produced in vitro by F. graminearum mixing on MIN medium. The

MIN medium contained per liter: 10 mg FeSO4·7H2O, 0.5 g KCl, 0.5 g MgSO4·7H2O, 1 g

KH2PO4, 2 g NaNO3, 30 g sucrose, 200 μL trace element solution (per 100 mL contained

50 mg MnSO4·H2O, 50 mg H3BO3, 50 mg NaMoO4·2H2O, 5 g ZnSO4·7H2O, 5 g citric acid,

0.25 g CuSO4·5H2O), pH 6.5 with NaOH, and 5g Arginine. After growing up of the mold, the

amount of DON was quantified by ELISA assay on the MIN medium. The result was verified

by LC/MSMS on the certified standard blank wheat. Taken together, the MIN medium

contained 240 mg/kg total DON metabolites (87.5% DON, 2.7% 3A-DON and 9.8%

15A-DON). All other mycotoxins were under the detection limit thus considered as negligible.

Based on the concentration of the MIN medium, we calculated the amount of medium needed

19

for 3 mg/kg and 1 mg/kg pig diet respectively. After homogenization, MIN medium was added

to the basal diet. Thus, the diet was artificially contaminated with an exact amount of DON.

Table 3-1 Composition of the negative control diets for pre-starter (d0-d14) and starter

(d14-d37) periods

Pre-starter Starter

Ingredients Value (%) Ingredients Value (%)

Wheat 22.5714% Barley 25.000%

Barley 22.5000% Wheat 22.932%

Whey 7.0000% Corn 15.000%

Extruded soybeans 2.4000% Toasted soybeans 12.000%

Calcium formate and Agricid 1.0000% Whey 4.200%

Potato protein 2.0000% Extruded soybeans 1.700%

Toasted soybeans 12.0000% Calcium formate and Agricid 0.500%

Extruded oats and barley 10.0000% Coconut 0.200%

Corn 7.5000% Soybean meal, 49/3,5 ARGtype9 9.072%

Soybean meal, 49/3,5 ARGtype9 4.0401% Wheat gluten feed 2.690%

Fat, min 88% triglycerides 0.5000% Beet pulp, sugar 72% 2.000%

Sodium bicarbonate 0.3019% Fat, min 88% triglycerides 0.952%

CB Organic acids mixture 0.3000% CB Organic acids mixture 0.300%

Lime fine 0.2856% Salt 0.052%

Lysine HCl 0.0010% Lysine HCl 0.001%

Premix 7.6000% Threonine 0.001%

Total 100.000% Premix 3.400%

Total 100.000%

We used 3 mg/kg for pre-starter period (from day 0 until day 14) before sampling because

typically feed contamination with 2-5 mg/kg DON is required for reduced feed intake and

decreased body weight gain (Haschek et al. 2002). We reduced to 1 mg/kg DON for starter

period (from day 14 until day 37) after sampling because the maximum tolerable level in the

complete feed for pigs is 0.9 mg/kg DON (refer to Table 2-1). Chronic exposure to low

concentration of DON will impair animal performances, such as decreased feed intake and can

cause more severe problems on long term than an acute toxic dosage. Feed contamination with

as low as 1 mg/kg DON can result in decreased feed intake in pigs.

20

The mycotoxin binder produced by Nutrex NV(Free-Tox) is a blend of well selected

indigestible adsorbents that bind mycotoxins in the GIT and prevent their uptake into the blood.

We choose1kg/ton toxin binders because this is the most commonly used dosage in practice.

The mycotoxin binder was added as an additive to the basal diet.

3.4 Sampling

After 14 days of feeding, one pig out of each pen was euthanized. The whole GIT was

removed and the small intestine was obtained and measured for the sample collection. A 10 cm

segment from the 75% length of the small intestine (distal small intestine, ileum) was collected

for Ussing chamber measurements. Another 20 cm segment from the same region was

processed to harvest mucosa, and frozen immediately in liquid nitrogen then stored at -80°C

for gene expression analysis.

3.5 Growth performance

The piglets as well as feed intake were weighed at d0, d14 and d37. Average Daily Gain (ADG,

g/d), Average Daily Feed Intake (ADFI, g/d) and Feed conversion rate (FC) were analyzed for

period d0-d14, d14-d37 and d0-d37. Diarrhea and mortality were checked and recorded for

every piglet every day.

3.6 Ex vivo measurement of intestinal permeability

Permeability was assessed ex vivo by measuring the permeability for the macromolecular

marker FITC-dextran 4 (FD4) across sheets of the mucosa by Ussing chamber technique as

described by Wang et al (Wang et al., 2016). Briefly, fresh segments of mucosa samples from

the 75% of the small intestine were got from the seromuscular layer and then mounted in

Ussing chamber system. They were bathed on 6.5 mL Ringer bicarbonate buffer solution with

6 mM glucose and 6 mM mannitol in the serosal and mocosal sides, respectively. The system

was maintained at 37°C and oxygenated (95% O2 and5% CO2). After a 20-min equilibration

period, 0.8 mg/mL 4-kDa FD4 (Sigma-Aldrich, Bornem, Belgium) was added to the mucosal

side. Samples from the serosal compartment were taken at 20-min intervals for 80 minutes to

monitor mucosal-to-serosal flux of FD4. Fluorescence intensity of FD4 was determined by

fluorescence spectrophotometry (Thermo Fisher Scientific, Marietta, OH, USA). The flux over

the 100-min period was calculated.

3.7 RNA isolation and reverse-transcription quantitative real-time

PCR

Relative mRNA expression of TJPs (ZO-1, ZO-2, Occludin, Claudin 1, Claudin 2, Claudin 5,

Claudin 7) and pro-inflammatory cytokines (TLR-4, TNF-α, IFN-γ, IL-1β, IL-8) and a brush

21

border enzyme intestinal alkaline phosphatase (IAP) were determined by quantitative real-time

PCR. Briefly, mucosal total RNA was extracted using the Bio-Rad Aurum Total RNA Fatty

and Fibrous Tissue Kit (Bio-Rad Laboratories, Inc.,Hercules, CA, USA) and treated with

DNase I to remove genomic DNA (gDNA). The concentration and purity (260/280) of RNA

were measured with the NanoDrop ND-1000 (NanoDrop Technologies, Thermo Scientific,

Wilmington, DE, USA). 1 μg RNA was analyzed by 1% agarose gel electrophoresis to check

RNA integrity (18S, 28S rRNA bands). In addition to this assessment, a control PCR was

performed to verify the absence of any gDNA contamination. Following this, 1 μg of extracted

RNA was reverse transcribed in the 20 μL reverse-transcription reaction with the ImProm-II

cDNA synthesis kit (Promega, Madison, WI, USA), containing both oligo dT and random

primers. The obtained cDNA was diluted 10 times with molecular grade water to a final

concentration of 5 μg/μL. A control PCR using 2 μL cDNA was performed to verify the

reverse-transcription reaction.

Primers (Table 3-2) used for genes in the study were designed with Primer3Plus. The

mutations, the secondary structure and single nucleotide polymorphism (SNP) in target

sequence were checked with RepeatMarker, mfold and dbSNP, respectively. All these primer

sequences were gene isoform specific as they were designed based on certain exon-exon

boundaries of published pig gene sequences corresponding to the accession number. Primers

were then purchased from IDT (Integrated DNA Technologies, Leuven, Belgium).

The qRT-PCR was performed on the CFX96 Touch Real-Time PCR Detection System

(Bio-Rad Laboratories, Inc.). Briefly, 2μL cDNA template, 5 μL 2X KAPA SYBR FAST

qPCR Kit Master Mix (Kapa Biosystems, Inc., Wilmington, MA, USA), 2 μL molecular grade

water, 0.5 μL forward primer and 0.5 μL reverse primer were added to a total volume of 10 μL.

The amplification conditions were as follows: 1) enzyme activation and initial denaturation

(95°C for 3 min); 2) denaturation (95°C for 20 s ) and annealing/extension and data

acquisition(annealing temperature depending on primer for 40 s) repeated 40 cycles; and 3)

dissociation( melt curve analysis from 70 to 90°C with 0.5°C increment every 5 s).

Primers used in this study were first optimized by gradient quantitative real-time PCR. A

5-fold dilution series of cDNA as standard curve was included at 3 gradient temperatures to

determine PCR amplification efficiency (E) and specificity. The standard curve was also

included in each run to determine PCR efficiency. In this study, PCR amplification efficiencies

were consistently between 90 and 110%. Gene-specific amplification was verified by agarose

gel electrophoresis melting and curve analysis.

The cycle in which fluorescence can be detected is termed quantification cycle (Cq value). Cq

values are directly related to the starting quantity of DNA. Efficiency was used to convert the

22

Cq value into raw data with the highest expressed samples (lowest Cq value) as a calibrator for

the normalization of raw data. The relative expression was expressed as the percentage of the

target gene in the stable expressed reference gene.

Table 3-2 Primer sequences used for reverse-transcription quantitative real-time PCR

Gene

symbol

Accession

number

Nucleotide sequence of primers, 5'-3' Product

length(bp Tm Forward Reverse

CLDN-1 NM_001244539.1 TATGACCCCATGACCCCAGT GCAGCAAAGTAGGGCACCTC 108 59

CLDN-2 NM_001161638.1 TTCCTCCCTGTTCTCCCTGA CACTCTTGGCTTTGGGTGGT 152 62

CLDN-5 NM_001161636.1 GTGGTCCGCGAGTTCTACGA CTTGACAGGGAAGCCGAGGT 171 60

CLDN-7 NM_001160076.1 GGTCCCCACAAACGTGAAGTA TCACTCCCAGGACAAGAGCA 114 60

HPRT-1 DQ178126 CCGAGGATTTGGAAAAGGT CTATTTCTGTTCAGTGCTTTGATGT 181 60

IAP XM_003133729.3 GGCCAACTACCAGACCATCG CCGACTTCCCTGCTTTCTTG 116 60

IFN-Ƴ NM_213948.1 GCTTTTCAGCTTTGCGTGACT CACTCTCCTCTTTCCAATTCTTCA 166 58

IL-1β NM_214055.1 GCACCCAAAACCTGGACCT CTGGGAGGAGGGATTCTTCA 143 58

IL-8 XM_003361958.3 TGTCAATGGAAAAGAGGTCTGC CTGCTGTTGTTGTTGCTTCTCA 100 60

OCLD NM_001163647.2 CATGGCTGCCTTCTGCTTCATTGC ACCATCACACCCAGGATAGCACTCA 129 65

PPIA NM_214353 CTGAAGCATACGGGTCCTGG TGCCCTCTTTCACTTTGCCA 139 65

TBP DQ178129 GATGGACGTTCGGTTTAGG AGCAGCACAGTACGAGCAA 124 59

TLR-4 NM_001113039.2 TTCTTGCAGTGGGTCAAGGA GACGGCCTCGCTTATCTGAC 135 58

TNF-α NM_214022.1 CATGATCCGAGACGTGGAGC AACCTCGAAGTGCAGTAGGC 151 62

ZO-1 XM_003480423.3 ATCTCGGAAAAGTGCCAGGA CCCCTCAGAAACCCATACCA 172 61

ZO-2 XM_005660148.2 CCAGGAAGCACAGAATGCAA AAGTCTGGCGGGACCTCTCT 148 61

CLDN-1, claudin-1; CLDN-2, claudin-2; CLDN-5, claudin-5; CLDN-7, claudin-7; HPRT-1, Hypoxanthine Phosphoribosyltransferase 1; IAP, intestinal alkaline phosphatase; IFN-Ƴ, interferon gamma; IL-1β, interleukin 1 beta; IL-8, interleukin 8; OCLN, occludin; PPIA, Peptidylprolyl isomerase A; TBP, TATA-binding protein; TLR-4, toll like receptor 4; TNF-α, tumor necrosis factor, alpha; ZO-1, zona occulden 1; ZO-2, zona occulden 2.

3.7.1 Reference gene selection

A selection of reference gene was done as described by Wang et al (Wang et al., 2016). PPIA,

HPRT1 and TBP were used as the reference gene in this study to normalize the raw data from

reverse-transcription quantitative real-time PCR. Primers for HPRT1 and TBP were obtained

from Erkens et al.(Erkens et al., 2006), whereas PPIA was obtained from Wang et al. (Wang et

al., 2016)

3.8 Statistical analysis

All data were expressed as mean ± standard errors. After determination of normality and

23

variance homogeneity, general linear model with fixed effect of DON addition, binder addition

and the interaction was used with Tukey’s test as a multiple comparison test in SAS Enterprise

Guide 7(SAS Institute, Cary, NC, USA). P value < 0.05 was considered as significant.

Principal component analysis (PCA) as described by Montagne et al. was then conducted to

work out the variables that contributed most to the variation between subjects (Montagne et al.,

2007). In brief, the data of 17 variables were standardised before the application of PCA. At

first, a scree plot was carried out to fix the number of principal components to be maintained.

After that, 5 principal components retained with the eigenvalues > 1.0. In addition, variables

that did not show any principal component retained were excluded (correlation coefficient

between variables and principal components ≤ 0.5). Then, retained variables were grouped into

families to check the correlation. Only the main representative variable with highest principal

component loading together with high correlation (r > 0.55; P < 0.05) was retained for the final

analysis. Finally, 11 variables entered the final PCA.

24

Chapter 4 Results and discussion

4.1 Growth performance

After 37 days dietary exposure to DON and/or mycotoxin binder, the growth performances

(ADG, ADFI, FC) for period d0-d14, d14-d37 and d0-d37 on different levels are given in

Table 4-1. Only few pigs from different groups had diarrhea problems in the first few days of

the experiment probably due to weaning stress. No case of emesis and mortality was observed.

Overall, no clinical signal of toxicity was observed.

On mycotoxin level, there was no significant difference between DON-control groups (T1 and

T2) and DON-challenged groups (T3 and T4).

On binder level, pigs supplemented with binder (T2 and T4) consumed more feed per day for

the first 14 days when compared to pigs that received diets with no binder (T1 and T3) (265

g/d vs 242 g/d) (p < 0.05). This resulted in a significant better growth for groups that received

diets with binder (T2 and T4) compared to groups that received diets with no binder (T1 and

T3) in the same period (197 g/d vs 170 g/d). That was the same case for period d0-d37. Groups

received diets with binder (T2 and T4) had a significant better ADG (368 g/d vs 341 g/d) and

ADFI (548 g/d vs 519 g/d) for the whole period compared to groups that received diets without

binder (T1 and T3). Meanwhile, there was a tendency that groups that received diets with

binder (T2 and T4) had a better feed conversion rate compared to groups that received diets

without binder (T1 and T3) from day 1 until day 14 of the experiment (p<0.10). No significant

difference for other parameters was found.

There were interesting interactions on the growth performance between mycotoxin and binder.

For the first 14 days of the experiment, DON contaminated diet supplemented with mycotoxin

binder (T4) had significant higher ADFI compared to diet only contaminated with DON (T3)

(272 g/d vs 227 g/d). This again resulted in a better growth rate for group received diet

contaminated with DON in combination with mycotoxin binder (T4) compared to group

received diet only contaminated with DON (T3) for period d0-d14 (205 g/d vs 159 g/d). No

significant difference for other parameters was found.

4.2 Permeability measurements in distal small intestine

At the moment of sampling (d14) of this study, the average value for permeability did not

differ significantly. Hence, there was no significant effect of DON, nor the binder addition on

the FD4 flux (Table 4-2).

On mycotoxin level, the average value of DON-control groups (T1 and T2) was 7.5×10-7 cm/s;

while the average value of DON-challenged groups (T3 and T4) was 7.6×10-7 cm/s.

25

On binder level, the difference of FD4 flux between groups that received diets with the

addition of binder (T2 and T4) and groups that received diets without the addition of binder

(T1 and T3) was larger compared to the difference between DON-challenged and DON-control

groups but still not significant. The average value for groups that received diet with the

addition of binder (T2 and T4) was 6.5 ×10-7 cm/s while the average value for groups that

received diet without the addition of binder (T1 and T3) was 8.6 ×10-7 cm/s.

4.3 mRNA expression of tight junction proteins, inflammatory

cytokines and brush border enzyme in distal small intestine

The gene expression of TJPs (ZO-1, ZO-2, OCLN, CLDN-1, CLDN-2, CLDN-5, CLDN-7),

pro-inflammatory cytokines (TLR4, TNF-α, IFN-γ, IL-1β, IL-8) and brush border enzyme

(IAP) in distal small intestine was summarised in Table 4-3.

Ingestion of diets contaminated with or without DON, did not significantly change the gene

expression of junction proteins, pro-inflammatory cytokines and brush border enzyme in distal

small intestine.

Ingestion of diets supplemented with mycotoxin binder (T2 and T4) significantly

down-regulated the expression of TLR-4 compared to diets with no binder (T1 and T3) (0.72

vs 1.00). At the same time, there was a tendency that groups that received diet with the

addition of binder (T2 and T4) up-regulated the expression of OCLN compared to groups that

received diet without the addition of binder (T1 and T3) (p < 0.10). No significant difference

for other parameters was found.

There were interesting interactions on the relative mRNA expression between mycotoxin and

mycotoxin binder. DON contaminated diet supplemented with mycotoxin binder (T4)

significantly down-regulated the expression of TLR-4 compared to diet only contaminated

with DON (T3) (0.57 vs 1.11). At the same time, there was a tendency that group received diet

contaminated with DON in combination with mycotoxin binder (T4) up-regulated the

expression of ZO-1 compared to group received diet only contaminated with DON (T3) (p <

0.10). No significant difference for other parameters was found.

26

Table 4-1 growth performance (ADG, ADFI, and FC) for period d0-d14, d14-d37 and d0-d37

mycotoxin binder interaction P value

mycotoxin + - + - + + - - mycotoxin binder interaction

binder + - + -

ADG d0-d14 (g/d) 182 ± 7 185 ± 8 197 ± 7b 170 ± 7a 205 ± 9b 159 ± 10a 188 ± 11ab 181 ± 10ab 0.80 0.02 0.03

ADFI d0-d14 (g/d) 250 ± 7 257 ± 8 265 ± 8b 242 ± 7a 272 ± 10b 227 ± 10a 257 ± 12ab 256 ± 10ab 0.50 0.05 0.05

FC d0-d14 1.38 ± 0.03 1.40 ± 0.03 1.35 ± 0.03 1.43 ± 0.03 1.33 ± 0.04 1.43 ± 0.04 1.38 ± 0.05 1.43 ± 0.04 0.64 0.08 0.25

ADG d14-d37 (g/d) 455 ± 10 457 ± 12 467 ± 11 445 ± 11 466 ± 13 444 ± 15 469 ± 17 446 ± 17 0.86 0.17 0.55

ADFI d14-d37 (g/d) 733 ± 14 742 ± 16 755 ± 15 720 ± 15 750 ± 19 716 ± 21 760 ± 23 724 ± 21 0.68 0.11 0.44

FC d14-d37 1.62 ± 0.02 1.60 ± 0.02 1.62 ± 0.02 1.60 ± 0.02 1.62 ± 0.03 1.62 ± 0.03 1.62 ± 0.03 1.59 ± 0.03 0.68 0.55 0.83

ADG d0-d37 (g/d) 353 ± 8 355 ± 10 368 ± 9b 341 ± 9a 370 ± 11 337 ± 12 366 ± 14 344 ± 14 0.90 0.05 0.21

ADFI d0-d37 (g/d) 530 ± 9 537 ± 10 548 ± 10b 519 ± 10a 549 ± 13 511 ± 14 548 ± 16 527 ± 14 0.59 0.05 0.19

FC d0-d37 1.50 ± 0.02 1.50 ± 0.02 1.50 ± 0.02 1.51 ± 0.02 1.49 ± 0.02 1.51 ± 0.03 1.50 ± 0.03 1.50 ± 0.03 0.84 0.63 0.92 Values are means ± SEM. Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder. Means with different small letters (a,b) represent

differences among different groups. P < 0.05 was considered significant.

Table 4-2 Intestinal permeability in distal small intestine (10-7cm/s)

mycotoxin binder interaction P value

mycotoxin + - + - + + - - mycotoxin binder interaction

binder + - + -

permeability 7.59 ± 1.11 7.51 ± 1.23 6.48 ± 1.18 8.62 ± 1.16 7.33 ± 1.49 7.86 ± 1.63 5.63 ± 1.83 9.39 ± 1.63 0.96 0.21 0.51

Values are means ± SEM. Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder.

27

Table 4-3 Relative mRNA expression of TJPs and pro-inflammatory cytokines and IAP

mycotoxin binder interaction P value

mycotoxin + - + - + + - - mycotoxin binder interaction

binder + - + -

ZO-1 1.58 ± 0.11 1.47 ± 0.12 1.66 ± 0.12 1.39 ± 0.11 1.88 ± 0.15 1.29 ± 0.16 1.45 ± 0.18 1.50 ± 0.16 0.50 0.12 0.08

ZO-2 1.23 ± 0.11 1.29 ± 0.12 1.30 ± 0.11 1.26 ± 0.12 1.42 ± 0.15 1.13 ± 0.17 1.18 ± 0.17 1.40 ± 0.17 0.95 0.82 0.50

OCLN 1.21 ± 0.16 1.03 ± 0.17 1.29 ± 0.16 0.96 ± 0.17 1.60 ± 0.22 0.83 ± 0.24 0.97 ± 0.24 1.09 ± 0.24 0.45 0.18 0.13

CLDN-1 1.19 ± 0.10 1.20 ± 0.11 1.33 ± 0.10 1.06 ± 0.11 1.36 ± 0.15 1.03 ± 0.15 1.30 ± 0.15 1.10 ± 0.17 0.96 0.10 0.36

CLDN-2 1.06 ± 0.19 1.43 ± 0.19 1.21 ± 0.19 1.28 ± 0.19 1.25 ± 0.25 0.87 ± 0.28 1.17 ± 0.28 1.68 ± 0.28 0.19 0.81 0.26

CLDN-5 0.71 ± 0.15 0.99 ± 0.16 0.85 ± 0.15 0.86 ± 0.16 0.66 ± 0.21 0.76 ± 0.23 1.04 ± 0.23 0.95 ± 0.23 0.22 0.98 0.61

CLDN-7 1.41 ± 0.16 1.60 ± 0.17 1.49 ± 0.16 1.52 ± 0.17 1.62 ± 0.21 1.20 ± 0.23 1.36 ± 0.23 1.83 ± 0.23 0.42 0.92 0.26

TLR-4 0.84 ± 0.09 0.88 ± 0.09 0.72 ± 0.08a 1.00 ± 0.09b 0.57 ± 0.11a 1.11 ± 0.14b 0.87 ± 0.12ab 0.88 ± 0.12ab 0.77 0.04 0.05

TNF-α 0.92 ± 0.14 0.91 ± 0.14 0.91 ± 0.14 0.92 ± 0.14 0.98 ± 0.18 0.85 ± 0.20 0.84 ± 0.20 0.98 ± 0.20 0.99 0.98 0.92

IFN-γ 0.59 ± 0.12 0.34 ± 0.13 0.38 ± 0.12 0.55 ± 0.13 0.45 ± 0.17 0.73 ± 0.18 0.30 ± 0.18 0.38 ± 0.18 0.18 0.34 0.41

IL-1β 0.99 ± 0.16 0.94 ± 0.17 0.85 ± 0.16 1.08 ± 0.17 0.79 ± 0.22 1.20 ± 0.24 0.92 ± 0.24 0.97 ± 0.24 0.83 0.34 0.65

IL-8 1.05 ± 0.21 1.24 ± 0.22 1.10 ± 0.21 1.19 ± 0.22 1.20 ± 0.28 0.89 ± 0.31 1.00 ± 0.31 1.48 ± 0.31 0.54 0.78 0.57

IAP 0.88 ± 0.15 0.96 ± 0.16 1.015 ± 0.15 0.82 ± 0.16 1.03 ± 0.20 0.73 ± 0.22 1.00 ± 0.22 0.91 ± 0.22 0.72 0.37 0.65

Values are means ± SEM. Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder. Means with different small letters (a,b) represent

differences among different groups. P<0.05 was considered significant.

28

4.4 Principal component analysis

Weight at d0, weight at d14, ADG d0-d14, permeability, ZO-1, ZO-2, OCLN, CLDN-1,

CLDN-2, CLDN-5, CLDN-7, TLR4, TNF-α, IFN-γ, IL-1β, IL-8 and IAP were the 17 variables

used in the PCA. After the application of a first PCA, 5 principal components were retained

following a scree plot. Weight at d0 was the only variable that did not show any principal

component and was excluded. Then, weight at d14 and ADG d0-d14 were grouped into growth

performance family and ZO-1, ZO-2, OCLN, CLDN-1, CLDN-2, CLDN-5 and CLDN-7 were

grouped into TJPs family as well as TNF-α, IFN-γ, IL-1β and IL-8 were grouped into

inflammatory cytokines family. Some variables were highly correlated within each family. In

growth performance family, ADG d0-d14 was highly correlated with weight at d14 (r = 0.966,

p < 0.01). Within the family of TJPS, OCLN was correlated with ZO-1 (r = 0.762, p < 0.01),

ZO-2 (r = 0.811, p < 0.01) and CLDN-7 (r = 0.683, p < 0.01). Then, OCLD, CLDN-1,

CLDN-2 and CLDN-5 were retained for the final PCA. For the family of inflammatory

cytokines, only IFN-γ was excluded. Finally, 11 variables were kept for this final PCA (Table

4-4). The 5 principal components explained 85.5% of the variance, of which the first principal

component contributing 22.6% and the second principal component contributing 22.2%. The

first principal component grouped the TJPs family OCLN, CLDN-1, CLDN-2 as well as

TNF-α and brush border enzyme IAP together. General linear model with fixed factor

mycotoxin addition, binder addition and the interaction was then conducted for the scores of

piglets for these 5 principal components. On binder level, principal component 1 had higher

principal component score in groups with addition of binder (T2 and T4) compared to groups

without addition of binder (T1 and T3) (0.330 vs -0.398) (p < 0.1). In other words, ingestion of

diets supplemented with binder tended to have higher gene expression of OCLN, CLDN-1,

CLDN-2 and IAP compared to diet without binder. This finding is consistent with the gene

expression result of CLDN-1 in Table 4-3. What’s more, it provided strong evidence that

binder may also up-regulate the expression of other TJPs (OCLN, CLDN-2) and IAP. Taken

the correlation into consideration, binder may stimulate the expression of other TJPs as OCLN

is highly correlated to ZO-1, ZO-2 and CLDN-7. The second principal component indicates

that the high expression of TLR-4 was associated with high expression of TNF-α and IL-1β.

The third principal component indicates that high expression of CLDN-1, CLDN-2 and

CLDN-5 was related to higher weight at d14. The other principal components are more

complicated and difficult to interpret.

29

Table 4-4 Description of 5 principal components obtained by principal component analysis

(PCA) of 11 variables *

Principal component

1 2 3 4 5

Mycotoxin§ + 0.054 0.000 -0.243 -0.203 -0.016

Mycotoxin§ - -0.122 0.063 0.255 0.196 0.031

Binder§ + 0.330A -0.312 0.135 -0.128 -0.303

Binder§ - -0.398B 0.375 -0.123 0.121 0.318

Weight at d14 0.889

Permeability 0.974

OCLN 0.813

CLDN1 0.767 0.401

CLDN2 0.343 0.335 0.754

CLDN5 0.546 0.713

TLR4 0.891

TNF-α 0.498 0.666

IL-1β 0.866

IL-8 0.910

IAP 0.856 *Rotation method: varimax with Kaiser normalisation.

§ General linear model with fixed factor mycotoxin addition, binder addition and the interaction was conducted for

the scores of piglets for these 5 principal components.

Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder.

Scores with different capital letters (A, B) represent a tendency of differences among different groups within main

factors (P < 0.1).

Only correlations with |r| >0.3 are indicated.

4.5 Discussion

4.5.1 Effect of DON addition to feed on gut health and performance

The gastrointestinal epithelium is an important dynamic barrier against the uptake of

xenobiotics such as nutritional antigens, food contaminants and bacteria present in the gut

(Arrieta et al., 2006). Intestinal epithelium form a polarised layer with two separate

compartments; the apical (luminal) and the basolateral, thereby constituting a physical barrier.

The intestine has to deal with the xenobiotics from the mucosa protected apical side, as well as

the already absorbed ones from the basolateral side. Literature shows that ingestion of feed

contaminated with DON could exhibit toxic effects on performance, reproduction, GIT and

30

other organs, with the reduced feed intake and lower growth rate being the most consistent

ones (Rotter et al., 1994). Thus, we performed a study with weaning pigs fed with

contaminated feed to investigate the effects of DON on the intestinal barrier function and

growth performance. We fed 3mg DON per kg feed for the first 14 days and reduced to 1

mg/kg for the remaining days. DON was present with its two acetylated forms 3A-DON and

15A-DON in this study. All other mycotoxins were below the detection limit thus could be

considered as negligible.

After 37 days dietary exposure to DON, no case of emesis or mortality was found. In our study,

there were no significant differences for growth performance between DON-control and

DON-challenged groups. The gender, age, health status of piglets may influence the effect of

DON and it’s difficult to see significant difference on growth performance level.

In addition, our results did not show significant differences of DON on gut health in the distal

small intestine (ileum), regarding intestinal permeability and mRNA expression of TJPs and

pro-inflammatory cytokines as well as IAP. This may be associated with its toxicokinetics

property. As we know from literature, after chronic exposure to DON in pigs, a fast and almost

complete absorption ( > 90%) was observed, with DON appearing within 15 minutes in the

blood and reaching maximal concentrations 1.65 h after oral exposure (Goyarts and Danicke,

2006). Danicke et al. also revealed that 88.5% of the DON dose was detected in stomach

whereas only 1.5% in the small intestine (Dänicke et al., 2004). Also, the acetylated derivatives

of DON are rapidly hydrolyzed to DON in vivo and then absorbed. In vivo and in vitro studies

demonstrated that DON and its acetylated forms were rapidly absorbed from the upper GIT,

involving stomach until proximal jejunum. Thus, the ileum is less susceptible to DON as the

majority of DON is already absorbed in the proximal parts of the GIT (Awad et al., 2007).

That’s may be the explanation for the slight effects of DON on gut health in ileum where the

majority of DON was already absorbed.

Our knowledge about the effect of DON is expanding quickly. All animal species can exhibit

toxic effects when exposed to DON (Pestka and Smolinski, 2005), with pigs being the most

susceptible one (Eriksen and Pettersson, 2004). However, the severity depends on various

factors, including type and dose of DON, the routine and duration of application, as well as the

animal status (Bondy and Pestka, 2000). After application of DON on the apical side or on the

basolateral side of the IPEC-J2 cell, Diesing et al. found that the apical epithelium seems to be

more resistant to DON application while the same concentration of DON from basolateral side

severely impairs barrier integrity (Diesing et al., 2011a). In our case, it can be assumed that the

majority of DON was adsorbed in the upper GIT, reaching the more susceptible basolateral

side whereby only a small part of DON was left in the less susceptible apical side. That’s

31

probably the reason for little differences of DON on gut health could be seen in samples from

ileum.

So far, data about the effects of DON is incomplete, especially lack of in vivo data. At first,

feed naturally contaminated with DON was used in studies in vivo and in vitro. However, the

situation with naturally contaminated diets is very complicated as co-occurrence with other

mycotoxins is commonly found in cereals and mycotoxicoses may be caused by multiple

toxins, making it difficult to focus on the effects of the target mycotoxin DON. At present, it is

challenging to study the effect of DON and its masked mycotoxins ADONs. Also, purified

mycotoxins are generally used in in vitro experiments. However, it is difficult to correlate in

vitro exposure with in vivo dosage as the amount of mycotoxin that can be absorbed in vivo

does not necessarily correspond to the amount absorbed by cells in culture. Taken together, it’s

difficult to say at what dose DON will exhibit toxic properties as the dose, the type of

mycotoxin, the routine and duration of exposure all are factors influencing the mode of action.

4.5.2 Effect of binder addition to feed on gut health and performance

Based on literature study, we know that DON might negatively influence the gut health and

growth performance in pigs. Mycotoxin binder as mycotoxin detoxifying agents are supposed

to reduce the negative effects induced by DON. Addition of mycotoxin binder in this study

was to check how it could act with DON and other materials. The mycotoxin binder used in the

study was a combination of silicates, yeast cell walls and organic acids and salts, provided by

Nutrex NV.

To evaluate the effect of the mycotoxin binder on nutrient binding, a tolerance trial was

performed by Nutrex with inclusion of 20 kg/ton (10× the advised maximum dosage) in an

uncontaminated piglet diet. Results showed no significant difference between control and

mycotoxin group (ADG: 359 g/d vs 361 g/d; FC: 1.91 vs 1.83). Then, it’s clear that no

essential nutrient binding could have taken place. It was also confirmed that no vitamin E is

absorbed at the maximum advised dosage of 2 kg/ton mycotoxin binder compared to control

feed. Thus, to our knowledge, addition of the mycotoxin binder in this study will neither

reduce nutrient absorption nor cause bad effects.

From our results of performance (Table 4-1), we found that groups that received diets with

binder (T2 and T4) had a significant higher ADG and ADFI for the period d0-d14 as well as

the whole period d0-d37 compared to groups that received diets without binder (T1 and T3).

Meanwhile, there was a tendency that pigs supplemented with binder (T2 and T4) had a better

feed conversion rate compared to pigs without binder (T1 and T3) from day 0 until day 14 of

the experiment (p < 0.10). Based on the results above, to some extent we can conclude that the

binder could improve the growth performance regardless of DON. However, little is known

32

about the mechanism by which the myctoxin binder improved growth performance. It is

probably related to the immune response after the addition of myxotoxin binder.

As to gene expression of pro-inflammatory cytokines (Table 4-3), ingestion of diet

supplemented with mycotoxin binder (T2 and T4) significantly reduced the expression of

TLR-4 compared to diet with no binder (T1 and T3). TLR-4 plays an important role in

recognizing pathogen and activating of the innate immune system. Activation of TLR-4 leads

to the release of its downstream inflammatory modulators including TNF-α and IL-1 (Telepnev

et al., 2003). This mechanism is clearly illustrated by the positive association between mRNA

TLR-4, TNF-α and Il-1β as found for principal component 2 (Table 4-4). TLR-4 is most

well-known for recognizing lipopolysaccharide (LPS), a structural component of the outer

membrane of Gram-negative bacteria. LPS, also known as endotoxin, consists of a lipid,

O-antigen and core. The toxic component of the LPS is the lipid portion, called lipid A. LPS

will induce strong inflammatory responses in vivo. Under certain circumstances, endotoxins

are toxic to specific hosts (Goscinski et al., 2003). LPS is only released when the cell is lysed

or during bacterial cell division. Supplementation of toxin binders in other studies showed

reduced expression of pro-inflammatory cytokines such as IL-1β and IL-6 and other immune

responses in LPS-induced pigs (Collier et al., 2011). In other words, the mycotoxin binder not

only can bind to mycotoxins, but might also bind other toxins such as bacterial endotoxins.

That may be the case in our study. Perhaps, this binder could adsorb LPS and helped reduce

the production of cytokines. Still, the effect of toxin binder on cytokine production warrants

further study as current literature is limited.

At the same time, there was a tendency that groups with the supplementation of binder (T2 and

T4) up-regulated the expression of CLDN-1 compared to groups without binder (T1 and T3)

(p<0.10). Claudins function as major components of the tight junction strands that regulate the

permeability of epithelia. CLDN-1, as a member of the claudin family, is an integral membrane

protein. CLDN-1 can decrease paracellular permeability and tighten the tight junctions. As the

mycotoxin binder in the current study is able to absorb a wide range of toxins, it could bind

other xenobiotics which might impair the barrier function, thus addition of mycotoxin binder

improved the gut health by increasing the production of TJPs.

From the result of PCA (Table 4-4), we know that groups with the supplementation of binder

(T2 and T4) tended to have higher gene expression of OCLN, CLDN-1, CLDN-2 and IAP

compared to diet without binder (T1 and T3). This finding is consistent with the gene

expression result of CLDN-1 in Table 4-3. The PCA results provided strong evidence that

binder may also up-regulate the expression of other TJPs (OCLN, CLDN-2) and IAP. OCLN,

together with the Claudin group of proteins, is an important component of the tight junctions. It

was the first transmembrane protein of TJPs to be discovered in 1993 by Shoichiro and Tsukita

33

(Tsukita and Tstlkita, 1993). Studies have shown that rather than being important in assembly

and maintenance of tight junctions, OCLN is important in stability and barrier function of tight

junctions. As the OCLN gene is essential and plays a fundamental role in modulating the

epithelial tight junctions, OCLN is a good marker of epithelial barrier and its presence or

absence could reflect the permeability of intestinal epithelium (Saitou et al., 2000). Taken the

correlation into consideration, binder may stimulate the expression of other TJPs as OCLN is

highly correlated to ZO-1, ZO-2 and CLDN-7. The family of ZO is a part of the cytoplasmic

plaque of the TJPs.

IAP is a brush border enzyme which is a component of the gut mucosal defense system. IAP is

involved in regulating secretion of bicarbonate in the duodenum. Failure to neutralize acid

environment can lead to acidified chyme injuring cells, finally increasing inflammation and

intestinal permeability. IAP is also known to detoxify LPS and prevent bacterial translocation

in the gut (Bates et al., 2007). As discussed, LPS will induce strong inflammatory responses in

vivo. In other words, IAP can inhibit the inflammatory responses by detoxification of LPS. So,

IAP is an important indicator to gut health.

Taken together, the addition of mycotoxin binder could improve the gut health by increasing

the expression of TJPs and IAP as well as decreasing the expression of TLR-4. However, the

detailed mode of action by which the mycotoxin binder showed positive effects on gut health

remains unclear. More researches should be carried out to explore the mechanism.

4.5.3 Interaction between mycotoxin and mycotoxin binder

There were interesting interactions on the growth performance between mycotoxin and binder.

For the first 14 days of the experiment, diet contaminated with DON in combination with

mycotoxin binder (T4) had significant higher ADFI compared to diet only contaminated with

DON (T3). This again resulted in a better growth rate for pigs fed diet contaminated with DON

in combination with binder (T4) compared to pigs fed diet only contaminated with DON (T3)

for period d0-d14. From the growth performance level, we can see that the binder could help

improve the production when challenged with DON.

As to the immune response, the group that received diets contaminated with DON in

combination with the mycotoxin binder (T4) significantly down-regulated the expression of

TLR-4 compared to diet only contaminated with DON (T3). DON is also able to regulate the

production of pro-inflammatory cytokines, increasing the expression of IL-1β, IL-2 and IL-6 in

the jejunum, and IL-1β, IL-6 and TNF-α in the ileum in pigs (Bracarense et al., 2012).

At the same time, there was a tendency that the group received diets contaminated with DON

in combination with the mycotoxin binder (T4) up-regulated the expression of ZO-1 compared

to diet only contaminated with DON (T3) (p < 0.10). We learn from literature that DON

34

impairs gut barrier by increasing the permeability of the intestinal epithelium and decreasing

the expression of TJPs in pigs (Pinton et al., 2009). Mycotoxin binder here could bind DON in

the diets without dissociating in the GIT (Döll and Dänicke, 2004). And then the complex

passes through the GIT and is excreted via the faeces whereby mycotoxin uptake by the animal

is prevented. Finally, this helps minimize absorption of DON by target organs. So

supplementation of mytoxin binder could reduce the potential negative effects induced by

DON.

In this experiment, the results of growth performance and gut health between the group

contaminated with DON in combination with binder and the group only contaminated with

DON differed a lot. Statistically we can say that there were interactions between mycotoxin

and binder.

According to the results above, we can conclude that the mycotoxin binder can reduce the

negative effects caused by DON to some extent.

35

Chapter 5 Conclusions and recommendations

5.1 General conclusions

From literature, we can conclude that the toxicity of DON may be influenced by various

factors, such as the type and concentration of DON, the routine and duration of exposure as

well as the animal status and so on. It’s difficult to say at what dosage DON will exhibit toxic

properties. Here in our case, we could only say that the inclusion rate of DON showed no

significant effects on growth performance and gut health.

However, this mycotoxin binder, in combination of DON or not, both could indeed improve

growth performance especially in the first 14 days and also for the whole period. It also

improves gut health by increasing the expression of TJPs and reducing the expression of

TLR-4. So the mycotoxin binder could be a good feed additive regardless of mycotoxin

contamination or not.

5.2 Recommendations for further research

In further study, pure mycotoxin could be applied as not only DON but also its acetylated

forms were present in the culture medium in this study. DON and ADONs show different toxic

potential which made our study complicated.

Different models, perhaps challenged with LPS, could be investigated to check the interaction

between LPS and binder.

36

Chapter 6 Reference list

ABBAS, H., MIROCHA, C. & TUITE, J. 1986. Natural occurrence of deoxynivalenol,

15-acetyl-deoxynivalenol, and zearalenone in refusal factor corn stored since 1972. Applied

and environmental microbiology, 51, 841-843.

ARRIETA, M., BISTRITZ, L. & MEDDINGS, J. 2006. Alterations in intestinal permeability.

Gut, 55, 1512-1520.

ASAO, T., WOGAN, G. N., CHANG, S. B., BUCHI, G., WICK, E. L. & ABDELKAD.MM

1963. Aflatoxins B and G. Journal of the American Chemical Society, 85, 1706-&.

AWAD, W., ASCHENBACH, J., SETYABUDI, F., RAZZAZI-FAZELI, E., B HM, J. &

ZENTEK, J. 2007. In vitro effects of deoxynivalenol on small intestinal D-glucose uptake and

absorption of deoxynivalenol across the isolated jejunal epithelium of laying hens. Poultry

science, 86, 15-20.

BAILEY, R., KUBENA, L., HARVEY, R., BUCKLEY, S. & ROTTINGHAUS, G. 1998.

Efficacy of various inorganic sorbents to reduce the toxicity of aflatoxin and T-2 toxin in

broiler chickens. Poultry Science, 77, 1623-1630.

BATES, J. M., AKERLUND, J., MITTGE, E. & GUILLEMIN, K. 2007. Intestinal alkaline

phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response

to the gut microbiota. Cell host & microbe, 2, 371-382.

BEJAOUI, H., MATHIEU, F., TAILLANDIER, P. & LEBRIHI, A. 2004. Ochratoxin A

removal in synthetic and natural grape juices by selected oenological Saccharomyces strains.

Journal of applied microbiology, 97, 1038-1044.

BERGSJO, B., MATRE, T. & NAFSTAD, I. 1992. Effects of Diets with Graded-Levels of

Deoxynivalenol on Performance in Growing Pigs. Journal of Veterinary Medicine Series

a-Zentralblatt Fur Veterinarmedizin Reihe a-Physiology Pathology Clinical Medicine, 39,

752-758.

BINDER, E. M. 2007. Managing the risk of mycotoxins in modern feed production. Animal

Feed Science and Technology, 133, 149-166.

BONDY, G. S. & PESTKA, J. J. 2000. Immunomodulation by fungal toxins. J Toxicol

Environ Health B Crit Rev, 3, 109-43.

BONY, S., CARCELEN, M., OLIVIER, L. & DEVAUX, A. 2006. Genotoxicity assessment of

deoxynivalenol in the Caco-2 cell line model using the Comet assay. Toxicology letters, 166,

67-76.

37

BOUHET, S. & OSWALD, I. P. 2005. The effects of mycotoxins, fungal food contaminants,

on the intestinal epithelial cell-derived innate immune response. Veterinary Immunology and

Immunopathology, 108, 199-209.

BRACARENSE, A. P. F. L., LUCIOLI, J., GRENIER, B., PACHECO, G. D., MOLL, W. D.,

SCHATZMAYR, G. & OSWALD, I. P. 2012. Chronic ingestion of deoxynivalenol and

fumonisin, alone or in interaction, induces morphological and immunological changes in the

intestine of piglets. British Journal of Nutrition, 107, 1776-1786.

CALVERT, T. W., AIDOO, K. E., CANDLISH, A. G. G. & FUAT, A. R. M. 2005.

Comparison of in vitro cytotoxicity of Fusarium mycotoxins, deoxynivalenol, T-2 toxin and

zearalenone on selected human epithelial cell lines. Mycopathologia, 159, 413-419.

COLLIER, C. T., CARROLL, J. A., BALLOU, M. A., STARKEY, J. D. & SPARKS, J. C.

2011. Oral administration of Saccharomyces cerevisiae boulardii reduces mortality associated

with immune and cortisol responses to Escherichia coli endotoxin in pigs. Journal of Animal

Science, 89, 52-58.

COPPOCK, R., SWANSON, S., GELBERG, H., KORITZ, G., HOFFMAN, W., BUCK, W. &

VESONDER, R. 1985. Preliminary study of the pharmacokinetics and toxicopathy of

deoxynivalenol (vomitoxin) in swine. American journal of veterinary research, 46, 169-174.

DOLL, S. & DANICKE, S. 2004. In vivo detoxification of Fusarium toxins. Archives of

animal nutrition, 58, 419-441.

DANICKE, S., VALENTA, H., KLOBASA, F., DOLL, S., GANTER, M. & FLACHOWSKY,

G. 2004. Effects of graded levels of Fusarium toxin contaminated wheat in diets for fattening

pigs on growth performance, nutrient digestibility, deoxynivalenol balance and clinical serum

characteristics. Archives of animal nutrition, 58, 1-17.

DANICKE, S., VALENTA, H. & DOLL, S. 2004a. On the toxicokinetics and the metabolism

of deoxynivalenol (DON) in the pig. Arch Anim Nutr, 58, 169-80.

DANICKE, S., VALENTA, H., DOLL, S., GANTER, A. & FLACHOWSKY, G. 2004b. On

the effectiveness of a detoxifying agent in preventing fusario-toxicosis in fattening pigs.

Animal Feed Science and Technology, 114, 141-157.

DESJARDINS, A. E., HOHN, T. M. & MCCORMICK, S. P. 1993. Trichothecene

Biosynthesis in Fusarium Species - Chemistry, Genetics, and Significance. Microbiological

Reviews, 57, 595-604.

DEVREESE, M., OSSELAERE, A., GOOSSENS, J., VANDENBROUCKE, V., DE BAERE,

S., EECKHOUT, M., DE BACKER, P. & CROUBELS, S. 2012. New bolus models for in

38

vivo efficacy testing of mycotoxin-detoxifying agents in relation to EFSA guidelines, assessed

using deoxynivalenol in broiler chickens. Food Additives & Contaminants: Part A, 29,

1101-1107.

DIESING, A. K., NOSSOL, C., DANICKE, S., WALK, N., POST, A., KAHLERT, S.,

ROTHKOTTER, H. J. & KLUESS, J. 2011a. Vulnerability of Polarised Intestinal Porcine

Epithelial Cells to Mycotoxin Deoxynivalenol Depends on the Route of Application. Plos One,

6.

DIESING, A. K., NOSSOL, C., PANTHER, P., WALK, N., POST, A., KLUESS, J.,

KREUTZMANN, P., DANICKE, S., ROTHKOTTER, H. J. & KAHLERT, S. 2011b.

Mycotoxin deoxynivalenol (DON) mediates biphasic cellular response in intestinal porcine

epithelial cell lines IPEC-1 and IPEC-J2. Toxicology Letters, 200, 8-18.

DOYLE, M., APPLEBAUM, R., BRACKETT, R. & MARTH, E. 1982. Physical, chemical

and biological degradation of mycotoxins in foods and agricultural commodities. Journal of

Food Protection®, 45, 964-971.

DROCHNER, W., SCHOLLENBERGER, M., PIEPHO, H.-P., G TZ, S., LAUBER, U.,

TAFAJ, M., KLOBASA, F., WEILER, U., CLAUS, R. & STEFFL, M. 2004. Serum

IgA-promoting effects induced by feed loads containing isolated deoxynivalenol (DON) in

growing piglets. Journal of Toxicology and Environmental Health, Part A, 67, 1051-1067.

EDRINGTON, T., KUBENA, L., HARVEY, R. & ROTTINGHAUS, G. 1997. Influence of a

superactivated charcoal on the toxic effects of aflatoxin or T-2 toxin in growing broilers.

Poultry Science, 76, 1205-1211.

EFSA, S. 2004. Opinion of the Scientific Panel on Contaminants in the Food Chain on a

request from the Commission related to Deoxynivalenol (DON) as undesirable substance in

animal feed. EFSA J, 73, 1-42.

EHRLICH, K. C. & DAIGLE, K. W. 1987. Protein synthesis inhibition by 8-oxo-12,

13-epoxytrichothecenes. Biochimica et Biophysica Acta (BBA)-General Subjects, 923,

206-213.

ERIKSEN, G. S. & PETTERSSON, H. 2004. Toxicological evaluation of trichothecenes in

animal feed. Animal Feed Science and Technology, 114, 205-239.

ERIKSEN, G. S., PETTERSSON, H., JOHNSEN, K. & LINDBERG, J. 2002. Transformation

of trichothecenes in ileal digesta and faeces from pigs. Archives of animal nutrition, 56,

263-274.

ERIKSEN, G. S., PETTERSSON, H. & LINDBERG, J. 2003. Absorption, metabolism and

39

excretion of 3-acetyl DON in pigs. Archives of animal nutrition, 57, 335-345.

ERKENS, T., VAN POUCKE, M., VANDESOMPELE, J., GOOSSENS, K., VAN ZEVEREN,

A. & PEELMAN, L. J. 2006. Development of a new set of reference genes for normalization

of real-time RT-PCR data of porcine backfat and longissimus dorsi muscle, and evaluation

with PPARGC1A. BMC Biotechnol, 6, 41.

ETIENNE, M., WACHE, Y., OSWALD, I. & TARANU, I. 2008. Biological and physiological

effects of deoxynivalenol (DON) in the pig. Mycotoxins in farm animals, 113-130.

FILTENBORG, O., FRISVAD, J. C. & THRANE, U. 1996. Moulds in food spoilage. Int J

Food Microbiol, 33, 85-102.

FREIMUND, S., SAUTER, M. & RYS, P. 2003. Efficient Adsorption of the Mycotoxins

Zearalenone and T‐2 Toxin on a Modified Yeast Glucan. Journal of Environmental Science

and Health, Part B, 38, 243-255.

GALVANO, F., PIETRI, A., BERTUZZI, T., PIVA, A., CHIES, L. & GALVANO, M. 1998.

Activated carbons: in vitro affinity for ochratoxin A and deoxynivalenol and relation of

adsorption ability to physicochemical parameters. Journal of Food Protection®, 61, 469-475.

GALVANO, F., PIVA, A., RITIENI, A. & GALVANO, G. 2001. Dietary strategies to

counteract the effects of mycotoxins: a review. Journal of Food Protection®, 64, 120-131.

GOSCINSKI, G., LIPCSEY, M., ERIKSSON, M., LARSSON, A., TANO, E. & SJ LIN, J.

2003. Endotoxin neutralization and anti-inflammatory effects of tobramycin and ceftazidime in

porcine endotoxin shock. Critical Care, 8, R35.

GOYARTS, T. & DANICKE, S. 2006. Bioavailability of the Fusarium toxin deoxynivalenol

(DON) from naturally contaminated wheat for the pig. Toxicology Letters, 163, 171-182.

GUTLEB, A. C., MORRISON, E. & MURK, A. J. 2002. Cytotoxicity assays for mycotoxins

produced by Fusarium strains: a review. Environ Toxicol Pharmacol, 11, 309-20.

HASCHEK, W., VOSS, K. & BEASLEY, V. 2002. Selected mycotoxins affecting animal and

human health. Handbook of toxicologic pathology, 1, 645-699.

HECHT, G. 1999. Innate mechanisms of epithelial host defense: spotlight on intestine.

American Journal of Physiology-Cell Physiology, 277, C351-C358.

HOUSE, J. In Search of a Magic Bullet! Strategies for Dealing with Fusarium-Contaminated

Grains in the Swine Industry. Proceedings of the 2003 Manitoba Swine Seminar, 2003.

133-144.

HOWES, A. D. & NEWMAN, K. E. 2000. Compositions and methods for removal of

mycotoxins from animal feed. Google Patents.

40

HUDLER, G. W. 1999. Magical mushrooms, mischievous molds: The remarkable story of the

fungus kingdom and its impact on human affairs. Virginia Quarterly Review, 75, 103-104.

HUWIG, A., FREIMUND, S., KAPPELI, O. & DUTLER, H. 2001. Mycotoxin detoxication of

animal feed by different adsorbents. Toxicology Letters, 122, 179-188.

IORDANOV, M. S., PRIBNOW, D., MAGUN, J. L., DINH, T.-H., PEARSON, J. A., CHEN,

S. & MAGUN, B. E. 1997. Ribotoxic stress response: activation of the stress-activated protein

kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA

damage to the alpha-sarcin/ricin loop in the 28S rRNA. Molecular and cellular biology, 17,

3373-3381.

JACOBSEN, B., BOWEN, K., SHELBY, R., DIENER, U., KEMPPAINEN, B. & FLOYD, J.

2007. Mycotoxins and mycotoxicoses. Montana State University Extension Publication

EBO174, Montana State University, Bozeman, MT.

JECFA 2002. Evaluation of certain mycotoxins in food. Fifty-sixth report of the Joint

FAO/WHO Expert Committee on Food Additives. World Health Organ Tech Rep Ser, 906,

i-viii, 1-62.

KABAK, B., DOBSON, A. D. & VAR, I. L. 2006. Strategies to prevent mycotoxin

contamination of food and animal feed: a review. Critical reviews in food science and nutrition,

46, 593-619.

KOLF-CLAUW, M., CASTELLOTE, J., JOLY, B., BOURGES-ABELLA, N.,

RAYMOND-LETRON, I., PINTON, P. & OSWALD, I. P. 2009. Development of a pig jejunal

explant culture for studying the gastrointestinal toxicity of the mycotoxin deoxynivalenol:

Histopathological analysis. Toxicology in vitro, 23, 1580-1584.

KROGH, P., HALD, B. & PEDERSEN, E. J. 1973. Occurrence of Ochratoxin-a and Citrinin in

Cereals Associated with Mycotoxic Porcine Nephropathy. Acta Pathologica Et Microbiologica

Scandinavica Section B-Microbiology, B 81, 689-695.

KUBENA, L., HARVEY, R., BAILEY, R., BUCKLEY, S. & ROTTINGHAUS, G. 1998.

Effects of a hydrated sodium calcium aluminosilicate (T-Bind) on mycotoxicosis in young

broiler chickens. Poultry Science, 77, 1502-1509.

KUBENA, L., HARVEY, R., HUFF, W., CORRIER, D., PHILLIPS, T. & ROTTINGHAUS,

G. 1990. Efficacy of a hydrated sodium calcium aluminosilicate to reduce the toxicity of

aflatoxin and T-2 toxin. Poultry science, 69, 1078-1086.

KUBENA, L., HARVEY, R., HUFF, W., ELISSALDE, M., YERSIN, A., PHILLIPS, T. &

ROTTINGHAUS, G. 1993. Efficacy of a hydrated sodium calcium aluminosilicate to reduce

41

the toxicity of aflatoxin and diacetoxyscirpenol. Poultry Science, 72, 51-59.

LEDOUX, D., ROTTINGHOUS, G., BERMUDEZ, A., KOE, W., SAMSON, R., VAN

EGMOND, H., GILBERT, J. & SABINO, M. 2001. In vitro binding of mycotoxins by

adsorbents does not always translate into in vivo efficacy. Mycotoxins and Phycotoxins in

Perspective at the Turn of the Millennium, 279-287.

LEMKE, S., OTTINGER, S., MAYURA, K., AKE, C., PIMPUKDEE, K., WANG, N. &

PHILLIPS, T. 2001. Development of a multi-tiered approach to the in vitro prescreening of

clay-based enterosorbents. Animal Feed Science and Technology, 93, 17-29.

MONTAGNE, L., BOUDRY, G., FAVIER, C., LE HU ROU-LURON, I., LALLES, J.-P. &

SEVE, B. 2007. Main intestinal markers associated with the changes in gut architecture and

function in piglets after weaning. British Journal of Nutrition, 97, 45-57.

MOON, Y. & PESTKA, J. J. 2002. Vomitoxin-induced cyclooxygenase-2 gene expression in

macrophages mediated by activation of ERK and p38 but not JNK mitogen-activated protein

kinases. Toxicological Sciences, 69, 373-382.

NATOUR, R. & YOUSEF, S. 1998. Adsorption efficiency of diatomaceous earth for

mycotoxin. Arab gulf journal of scientific research, 16, 113-127.

OTTE, J.-M., ZDEBIK, A.-E., BRAND, S., CHROMIK, A. M., STRAUSS, S., SCHMITZ, F.,

STEINSTRAESSER, L. & SCHMIDT, W. E. 2009. Effects of the cathelicidin LL-37 on

intestinal epithelial barrier integrity. Regulatory peptides, 156, 104-117.

PATTERSON, R. & YOUNG, L. 1993. Efficacy of hydrated sodium calcium aluminosilicate,

screening and dilution in reducing the effects of mold contaminated corn in pigs. Canadian

Journal of Animal Science, 73, 615-624.

PESTKA, J., LIN, W.-S. & MILLER, E. 1987. Emetic activity of the trichothecene

15-acetyldeoxynivalenol in swine. Food and Chemical Toxicology, 25, 855-858.

PESTKA, J. J. 2007. Deoxynivalenol: Toxicity, mechanisms and animal health risks. Animal

Feed Science and Technology, 137, 283-298.

PESTKA, J. J. 2010. Deoxynivalenol: mechanisms of action, human exposure, and

toxicological relevance. Archives of Toxicology, 84, 663-679.

PESTKA, J. J. & SMOLINSKI, A. T. 2005. Deoxynivalenol: Toxicology and potential effects

on humans. Journal of Toxicology and Environmental Health-Part B-Critical Reviews, 8,

39-69.

PINTON, P., ACCENSI, F., BEAUCHAMP, E., COSSALTER, A. M., CALLU, P.,

GROSJEAN, F. & OSWALD, I. P. 2008. Ingestion of deoxynivalenol (DON) contaminated

42

feed alters the pig vaccinal immune responses. Toxicology Letters, 177, 215-222.

PINTON, P., BRAICU, C., NOUGAYREDE, J.-P., LAFFITTE, J., TARANU, I. & OSWALD,

I. P. 2010. Deoxynivalenol impairs porcine intestinal barrier function and decreases the protein

expression of claudin-4 through a mitogen-activated protein kinase-dependent mechanism. The

Journal of nutrition, 140, 1956-1962.

PINTON, P., NOUGAYR DE, J.-P., DEL RIO, J.-C., MORENO, C., MARIN, D. E.,

FERRIER, L., BRACARENSE, A.-P., KOLF-CLAUW, M. & OSWALD, I. P. 2009. The food

contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin

expression. Toxicology and applied pharmacology, 237, 41-48.

PINTON, P., TSYBULSKYY, D., LUCIOLI, J., LAFFITTE, J., CALLU, P., LYAZHRI, F.,

GROSJEAN, F., BRACARENSE, A.-P., MARTINE, K.-C. & OSWALD, I. P. 2012. Toxicity

of deoxynivalenol and its acetylated derivatives on the intestine: differential effects on

morphology, barrier function, tight junctions proteins and MAPKinases. Toxicological

Sciences, kfs239.

PODOLSKY, D. 2000. Review article: healing after inflammatory injury–coordination of a

regulatory peptide network. Alimentary pharmacology & therapeutics, 14, 87-93.

PRELUSKY, D., HARTIN, K., TRENHOLM, H. & MILLER, J. 1988. Pharmacokinetic Fate

of14C-Labeled Deoxynivalenol in Swine. Toxicological Sciences, 10, 276-286.

PRELUSKY, D. B. 1997. Effect of intraperitoneal infusion of deoxynivalenol on feed

consumption and weight gain in the pig. Natural toxins, 5, 121-125.

PRELUSKY, D. B. & TRENHOLM, H. L. 1991. Tissue distribution of deoxynivalenol in

swine dosed intravenously. Journal of Agricultural and Food Chemistry, 39, 748-751.

RAMOS, A. J. & HERNANDEZ, E. 1997. Prevention of aflatoxicosis in farm animals by

means of hydrated sodium calcium aluminosilicate addition to feedstuffs: A review. Animal

Feed Science and Technology, 65, 197-206.

RAWAL, S., KIM, J. E. & COULOMBE, R. 2010. Aflatoxin B-1 in poultry: Toxicology,

metabolism and prevention. Research in Veterinary Science, 89, 325-331.

RICHARD, J., PAYNE, G., EDS, DESJARDINS, A., MARAGOS, C., NORRED, W. &

PESTKA, J. 2003. Mycotoxins: risks in plant, animal and human systems. CAST Task Force

Report, 139, 101-103.

ROTTER, B., THOMPSON, B., LESSARD, M., TRENHOLM, H. & TRYPHONAS, H. 1994.

Influence of low-level exposure to Fusarium mycotoxins on selected immunological and

hematological parameters in young swine. Toxicological Sciences, 23, 117-124.

43

SAITOU, M., FURUSE, M., SASAKI, H., SCHULZKE, J.-D., FROMM, M., TAKANO, H.,

NODA, T. & TSUKITA, S. 2000. Complex phenotype of mice lacking occludin, a component

of tight junction strands. Molecular biology of the cell, 11, 4131-4142.

SCHATZMAYR, G. & STREIT, E. 2013. Global occurrence of mycotoxins in the food and

feed chain: facts and figures. World Mycotoxin Journal, 6, 213-222.

SCHENK, M. & MUELLER, C. 2008. The mucosal immune system at the gastrointestinal

barrier. Best Practice & Research in Clinical Gastroenterology, 22, 391-409.

SCHOTHORST, R. C. & VAN EGMOND, H. P. 2004. Report from SCOOP task 3.2.10

"collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by

the population of EU member states" - Subtask: trichothecenes. Toxicology Letters, 153,

133-143.

SERGENT, T., PARYS, M., GARSOU, S., PUSSEMIER, L., SCHNEIDER, Y.-J. &

LARONDELLE, Y. 2006. Deoxynivalenol transport across human intestinal Caco-2 cells and

its effects on cellular metabolism at realistic intestinal concentrations. Toxicology letters, 164,

167-176.

SHEPHARD, G. S. 2008. Determination of mycotoxins in human foods. Chemical Society

Reviews, 37, 2468-2477.

STEYN, P. S. 1998. The biosynthesis of mycotoxins. Revue De Medecine Veterinaire, 149,

469-478.

STRUGNELL, R. A. & WIJBURG, O. L. 2010. The role of secretory antibodies in infection

immunity. Nat Rev Microbiol, 8, 656-67.

SUDAKIN, D. L. 2003. Trichothecenes in the environment: relevance to human health.

Toxicology Letters, 143, 97-107.

TELEPNEV, M., GOLOVLIOV, I., GRUNDSTR M, T., T RNVIK, A. & SJ STEDT, A. 2003.

Francisella tularensis inhibits Toll‐like receptor‐mediated activation of intracellular signalling

and secretion of TNF‐α and IL‐1 from murine macrophages. Cellular microbiology, 5, 41-51.

TIEMANN, U. & DANICKE, S. 2007. In vivo and in vitro effects of the mycotoxins

zearalenone and deoxynivalenol on different non-reproductive and reproductive organs in

female pigs: A review. Food Additives and Contaminants, 24, 306-314.

TSUKITA, S. & TSTLKITA, S. 1993. Occludin: a novel integral membrane protein localizing

at tight junctions. J Cell Biol, 123, 17771788.

TURNER, P. C., BURLEY, V. J., ROTHWELL, J. A., WHITE, K. L., CADE, J. E. & WILD,

C. P. 2008. Deoxynivalenol: Rationale for development and application of a urinary biomarker.

44

Food Additives and Contaminants, 25, 864-871.

UENO, Y. 1983. Trichothecenes. Chemical, biological and toxicological aspects, Elsevier.

UENO, Y. 1985. The toxicology of mycotoxins. Crit Rev Toxicol, 14, 99-132.

UENO, Y., NAKAJIMA, M., SAKAI, K., ISHII, K. & SATO, N. 1973. Comparative

toxicology of trichothec mycotoxins: inhibition of protein synthesis in animal cells. J Biochem,

74, 285-96.

VERŠILOVSKIS, A., GEYS, J., HUYBRECHTS, B., GOOSSENS, E., DE SAEGER, S. &

CALLEBAUT, A. 2012. Simultaneous determination of masked forms of deoxynivalenol and

zearalenone after oral dosing in rats by LC-MS/MS. World Mycotoxin Journal, 5, 303-318.

WACHE, Y. J., HBABI-HADDIOUI, L., GUZYLACK-PIRIOU, L., BELKHELFA, H.,

ROQUES, C. & OSWALD, I. P. 2009. The mycotoxin Deoxynivalenol inhibits the cell surface

expression of activation markers in human macrophages. Toxicology, 262, 239-244.

WANG, W., DEGROOTE, J., VAN GINNEKEN, C., VAN POUCKE, M., VERGAUWEN,

H., DAM, T. M., VANROMPAY, D., PEELMAN, L. J., DE SMET, S. & MICHIELS, J. 2016.

Intrauterine growth restriction in neonatal piglets affects small intestinal mucosal permeability

and mRNA expression of redox-sensitive genes. FASEB J, 30, 863-73.

WHO-IARC 1993. Toxins derived from Fusarium moniliforme: fumonisins B1 and B2 and

fusarin C. IARC Monogr Eval Carcinog Risks Hum, 56, 445-66.

YANG, G.-H., JARVIS, B. B., CHUNG, Y.-J. & PESTKA, J. J. 2000. Apoptosis induction by

the satratoxins and other trichothecene mycotoxins: relationship to ERK, p38 MAPK, and

SAPK/JNK activation. Toxicology and applied pharmacology, 164, 149-160.

YANG, H., CHUNG, D. H., KIM, Y. B., CHOI, Y. H. & MOON, Y. 2008. Ribotoxic

mycotoxin deoxynivalenol induces G 2/M cell cycle arrest via p21 Cip/WAF1 mRNA

stabilization in human epithelial cells. Toxicology, 243, 145-154.

YIANNIKOURIS, A., FRANCOIS, J., POUGHON, L., DUSSAP, C.-G., BERTIN, G.,

JEMINET, G. & JOUANY, J.-P. 2004. Adsorption of zearalenone by β-D-glucans in the

Saccharomyces cerevisiae cell wall. Journal of Food Protection®, 67, 1195-1200.

YOUNG, L., MCGIRR, L., VALLI, V., LUMSDEN, J. & LUN, A. 1983. Vomitoxin in corn

fed to young pigs. Journal of animal science, 57, 655-664.

YUNUS, A. W., BLAJET-KOSICKA, A., KOSICKI, R., KHAN, M. Z., REHMAN, H. &

BOHM, J. 2012. Deoxynivalenol as a contaminant of broiler feed: Intestinal development,

absorptive functionality, and metabolism of the mycotoxin. Poultry Science, 91, 852-861.

ZHOU, H.-R., ISLAM, Z. & PESTKA, J. J. 2003. Rapid, sequential activation of

45

mitogen-activated protein kinases and transcription factors precedes proinflammatory cytokine

mRNA expression in spleens of mice exposed to the trichothecene vomitoxin. Toxicological

sciences, 72, 130-142.

ZIELONKA, L., WISNIEWSKA, M., GAJECKA, M., OBREMSKI, K. & GAJECKI, M. 2009.

Influence of low doses of deoxynivalenol on histopathology of selected organs of pigs. Pol. J.

Vet. Sci, 12, 89-95.