H U M A N G E N E T H E R A P Y 9:2577-2583 (November 20, 1998) Mary Ann Liebert, Inc.

Efficient C o n s t r u c t i o n o f a R e c o m b i n a n t A d e n o v i r u s V e c t o r

b y a n I m p r o v e d In Vitro Ligation M e t h o d

HIROYUKI MIZUGUCHli-2 and MARK A. KAY'

ABSTRACT

A n efficient method for constructing a recombinant adenovirus (Ad) vector, based on an in vitro ligation, has

been developed. T o insert the foreign gene into an adenoviral D N A , we introduced three unique restriction

sites, l-Ceu\, Swal, and Pl-Scel, into the El deletion site of the vector plasmid, which contains a complete El,

E3-deleted adenovirus type 5 genome. \-Ceu\ and Pl-Scel are intron-encoded endonucleases with a sequence

specificity of at least 9-10 and 11 bp, respectively. A shuttle plasmid, p H M 3 , containing multiple cloning sites

between the \-Ceu\ and ¥\-Scel sites, was constructed. After the gene of interest was inserted into this shut­

tle plasmid, the plasmid for El-deleted adenovirus vector could be easily prepared by in vitro ligation using

the \-Ceul and Pl-Scel sites. Swal digestion of the ligation products prevented the production of a plasmid

containing a parental adenovirus genome (null vector). After transformation into E. coli, more than 9 0 % of

the transformants had the correct insert. T o m a k e the vector, a jPacI-digested, linearized plasmid was trans­

fected into 293 cells, resulting in a homogeneous population of recombinant virus. The large number and

strategic location of the unique restriction sites will not only increase the rapidity of production of new first-

generation vectors for gene transfer but will allow for rapid further improvements in the vector D N A back­

bone.

OVERVIEW SUMMARY

One of the limitations of recombinant adenovirus vectors is their construction, which is a time-consuming procedure. This study demonstrates that the plasmid containing re­combinant adenovirus D N A can be prepared by a simple in vitro ligation using three unique restriction sites, I-C^mI, Swal, and Pl-Scel, in the El deletion region. P a d digestion of the recombinant plasmid generates the D N A for aden­ovirus vector, which has an inverted terminal repeat at both ends of the genome. Homogeneous recombinant virus could be obtained by the transfection of the linearized plasmid into 293 cells. This improved in vitro ligation system is a simple and efficient method by which to construct a re­combinant adenovirus vector for gene therapy.

INTRODUCTION

RECOMBINANT ADENOVIRUS VECTORS havc been shown to have great promise for gene transfer in basic research as

well as for clinical treatment of many diseases (Kozarsky and

Wilson, 1993; Kay and Woo, 1994). They can transduce for­eign genes efficiently into both cultured cells and many target organs in vivo. There are more than 40 serotypes of adenovims (Ad) identified. The Ad type 5 genome has been used most commonly to make recombinant Ad vector. The genome of hu­man Ad is a linear 36-kb, double-stranded D N A genome that encodes more than 50 gene products. In the first-generation Ad vector, the early region 1 (El) is replaced by the foreign gene and the vims propagated in an El-rran.y-complementing cell line such as 293. By deleting El and early region 3 (E3) se­quences up to about 8 kb of foreign gene can be inserted (Bett et al, 1994). However, in vitro manipulation of Ad D N A is dif­ficult. Unique and useful restriction sites are limited because of the large size of the genome, making the constmction of Ad vectors relatively labor intensive. Two standard methods to make El-deleted Ad vectors have been developed: an in vitro ligation method (Berkner and Sharp, 1983; Gilardi et al, 1990; Rosenfeld et al, 1991) and a homologous recombination method in 293 cells (Bett et al 1994; Miyake et al, 1996). The in vitro ligation method uses whole viral D N A genomes and a plasmid containing the left end of the Ad genome with the left inverted terminal repeat (ITR), the packaging signal, and the

'Departments of Pediatrics and Genetics, Stanford University School of Medicine, Stanford, CA 94305. Present address: Division of Biological Chemistry and Biologicals, National Institute of Health Sciences, Tokyo 158. lapan.

2577

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.

2578 MIZUGUCHI AND KAY

EIA enhancer sequence (map units 0 to 1.3). After the gene of interest is inserted downstream ofthe viral sequence ofthe plas­mid, the fragment containing viral sequence and the gene of in­terest is excised and ligated into the unique Clal site (map unit 2.6), replacing a portion of the viral El region. Then, the lig­ated D N A is directly transfected into 293 cells to make re­combinant vims. However, this method is rarely used now be­cause the efficiency is low and the recombinant virus requires purification of contaminating wild-type and transgene null vimses related to incomplete restriction digestion and self-reli-gation. One system based on homologous recombination (Bett et al, 1994) uses two plasmids with overlapping fragments that recombine In vivo. The first plasmid contains the entire Ad genome with a deletion of the D N A packaging signal and El region. The second plasmid contains the left ITR, packaging signal, and overlapping sequence with the first plasmid. After the gene of interest is introduced into the second plasmid, the two plasmids are cotransfected into 293 cells. The vims, which is produced by the recombination in 293 cells, is isolated through plaque purification. The major limitation to this ap­proach is that the recombination event occurs at a low fre­quency.

Newer methods for adenoviral preparation are based on ho­mologous recombination of two plasmids, using yeast artificial chromosomes (YACs; Ketner et al, 1994) or bacteria (Chartier et al, 1996; Crouzet et al, 1997; He et al, 1998). These meth­ods, while more efficient, are more complex. The Y A C system requires yeast culture and manipulation (Ketner et al, 1994), while the Escherichia coli system requires three-step transfor­mations using an additional, nonconventional host bacterial strain (BJ5183recBCsbcBC) (Chartier et al, 1996; Crouzet et al, 1997; He et al, 1998).

In this article we report the efficient constmction of an El-deleted Ad vector by an improved in vitro ligation method. This system requires a simple in vitro ligation using routine molec­ular biology reagents and transformation in commonly used bacterial strains.

MATERIALS AND METHODS

Plasmids

Vector plasmids pAdHMl, -2, -3, and -4 were constmcted as follows. pHVad2 (provided by HepaVec, Berlin, Germany), which has the left end (bp 1-341 and bp 3524-5790) of the Ad type 5 genome with an El deletion, was cut by Clal and £coRI, and ligated with oligonucleotides 1 (5' CGTAACTATAACG-G T C C T A A G G T A G C G A G 3') and 2 (5' AATTCTCGCTAC-CTTAGGACCGTTATAGTTA 3') (l-Ceiil recognition se­quences are underlined), resulting in pAd4. pAd4 was then cut with EcoRI and Sail, and then ligated with oligonucleotides 3 (5' AATTA7Tr/L4ArATCTATGTCGGGTGCGGAGAAA-G A G G T A A T G A A A T G G C A 3!j and 4 (5! TCGATGC-CATTTCATTACCTCTTTCTCCGCACCCGACATA-GAT/4TTTAAAT 3') (Pl-Scel and Swal recognition sequences are underlined and italicized, respectively), resulting in pAdl8, which contains l-Ceul, Swal, and Pl-Scel sites. pAdl9, which contains the Ad type 5 genome (bp 1 to 21562), was prepared by the insertion of the Pad/BamHl fragment of pTG3602

(Chartier et al. 1996), which has a full-length Ad type 5 genome flanked with a Pad site, in the plasmid derived from pGEM7Zfi-) (Promega, Madison, WI). The PadlXcal frag­ment of pAdl8 and pAdI9 were then ligated, resulting in pAdl6. The BaniHlIPad fragment (bp 21562 to the right end of the genome) of pTG3602 or pHVad I (provided by HepaVec), both of which have the Ad type 5 genome with a deletion in the E3 region (bp 28133-30818), were introduced into the Clal and BamHI sites of pGEM7Zf(-), after the Pad site of pTG3602 and pHVadl was changed into a Clal site by using a Clal linker (New England BioLabs, Beveriy, M A ) , resulting in pAdI and pAd2, respectively. The fragment of pAdl6 di­gested with Pad and BamHI was then cloned into the Nsil and BamHI sites of pAdl and pAd2, respectively, after the Nsil site was changed into a Pad site by using a Pad linker (New Eng­land BioLabs). The resulting plasmids were named pAdHMl and pAdHM2, respectively. The Clal site of pAdHMI and pAdHM2 was changed into a Pad site by using oligonu­cleotides 5 (5' CGTTAATTAA 3') and 6 (5' CGTTAATTAA 3') (Pad recognition sequences are underlined), resulting in pAdHM3 and pAdHM4, respectively. pAdHMl, -2, -3, and -4 have 1-Ceul, Swal, and PI-5ceI sites in the El deletion region. pAdHMl and -3 have the Ad genome with a deletion in the El region (AEl; bp 342-3523). while pAdHM2 and -4 have the Ad genome with a deletion in the El and E3 regions (AEl, bp 342-3523; AE3, bp 28133-30818). pAdHMl and pAdHM2 have a Pad site at the left end of the Ad genome and a Clal site at the right end of the genome. pAdHM3 and pAdHM4 have Pad sites at both ends of the Ad genome (Fig. lA).

Shuttie plasmid pHM3 was constmcted as follows. pUC18 was cut by AatU and Hindlll, and ligated with oligonucleotides 7 (5' T A A C T A T A A C G G T C C T A A G G T A G C G A A 3') and 8 (5' AGCTTTCGCTACCTTAGGACCGTTATAGTTAACGT 3') (1-Ceul recognition sequences are underlined), resulting in pHMl. pHMl was cut with £coRl and PvuU, and then ligated with oligonucleotides 9 (5' AATTCTGGCAAACAGCTAT-TATGGGTATTATGGGT 3') and 10 (5' ACCCATAATACC-CATAATAGCTGTTTGCCAG 3') (Pl-Pspl recognition se­quences are underiined), resulting in pHM2. This plasmid has another intron-coded enzyme (PI-P.spI) recognition site. The Pl-Pspl fragment of pHM2 was then ligated with oligonu­cleotides 11 (5' AT C T A T G T C G G G T G C G G A G A A A G A G -G T A A T G A A A T G G C A T T A T 3') and 12 (5' TGCCATTT-CATTACCTCTTTCTCCGCACCCGACATAGATATAA 3') (PI-5ceI recognition sequences are underlined). The resulting plasmid was named pHM3 (Fig. IB). pHM3 contains the pUC18-derived multicloning site between the 1-Ceul and Pl-Scel sites. Al! mutations were sequenced with a Sequenase version 2.0 D N A sequencing kit (New England Nuclear, Boston. MA).

Construction of recombinant Ad vector DNA containing human aj-antitiypsin expression cassette

The Xhol fragment of pBSRSVhAAT (Kay et al, 1992), containing the Rous sarcoma virus long terminal repeat (RSV LTR) promoter, human c ,-antitrypsin (hAAT) cDNA, and bovine growth hormone polyadenylation signal, was cloned into the Sail site of pHM3. Depending on the orientation of the hAAT expression cassette, the resulting plasmids were named pHM3-hAATl and pHM3-hAAT2 (Fig. IC).

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.

EFFICIENT CONSTRUCTION OF Ad VECTORS 2579

Swal l-Ceul Pl-Scel

; : £ : adenovirus genome

E1(-)(342-3S23)

pAdHMI 33.0 Kb

Swal l-Ceul Pl-Scel

p Clal Pad. ^ \ / adenovin 1 1 ^ i-^ir^

- ^ r - . 1 Amp'

E1(-) (342-3523)

p A d H M 3 33.0 Kb Amp^

Swal l-Ceul Pl-Scel

;4 adenovirus genome

El (-) (342-3623)

p A d H M 2 30.3 Kb

E3(-) (28133-30616) <-

Amp'

Swal l-Ceul Pl-Scel

f Clal Pad fE * , - ^

^ adenovirus genome

El (-) (342-3523)

p A d H M 4 30.3 Kb

E3(-) (26133-30816) ^

Amp^

B

Amp'

l-Ceul Hindlll SphI Pstl Sall'Accl/Hincll Xbal BamHI Smal/Xmal Kpnl Sad EcoRI Pl-Scel

pAdHM4

i

l-Ceul Pl-Scel

Ligation products

i

i

Swal digestion to reduce background

Transformation with DH5a

RSV hAAT bPA

Pad

, Pl-Sael

adenovirus genome

pHM3

hAAT expression cassette

hAAT

Pl-Scel bPA

pAdHWI4-hAAT 32.4 K b

I Pad digestion

Transfection into 293 cells

E3(-) (28133-30818)

Pad

Amp'

F I G 1 Constmction of recombinant adenovirus vectors by a simple in vitro ligation method. (A) Vector plasmids p A d H M l , -2 -3 and -4 (B) Shuttie plasmid p H M 3 . (C) The sttategy for constmction of El- and E3-deleted adenovims vector. The ex­pression cassette of interest ( R S V h A A T b P A ) was inserted into the SaU site of the multicloning site of p H M 3 , and the resulting plasmid p H M 3 - h A A T l was digested with l-Ceul and Pl-Scel. The fragment containmg the h A A T expression cassette was lig­ated with p A d H M 4 digested with l-Ceul and PI-5ceI. Transformation into D H 5 a was performed after the ligation samples were digested with Swal to reduce the formation of colonies containing parental vector plasmid (pAdHM4).

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.

2580 M I Z U G U C H I A N D K A Y

To constmct the plasmid for a recombinant Ad vector ex­pressing hAAT, pHM3-hAATI was digested with I-G?i(I and Pl-Scd. and the fragment containing the h A A T expression cas­sette was isolated by gel extraction after agarose gel elec­trophoresis. p A d H M 4 was also digested with l-Ceul and PI-Scel, but the digested D N A was purified by phenol-chloroform extraction and ethanol precipitation. Digested p A d H M 4 (0.1 pg) was then ligated to the p H M 3 fragment containing the h A A T expression cassette at I6°C for more than 2 hr. To re­duce the background with the parental plasmid, p A d H M 4 , the ligation products were treated at 65°C for 20 min to inactivate T4 D N A ligase, and then digested with Swal. Swal cuts the parental plasmid (pAdHM4), but not the recombinant plasmid. Finally, the D N A s were transformed with electrocompetent D H 5 a (chemical-competent D H 5 a can be also used), and the individual clones were screened by restriction analysis (Fig. IC). Large-scale preparation of plasmid p A d H M 4 - h A A T was performed by using a Qiagen Plasmid Maxi-kit (Qiagen, Chatsworth, CA). No rearrangement ofthe plasmid during am­plification was observed.

Generation of adenovirus vector

p A d H M 4 - h A A T was linearized by the digestion with Pad and purified by phenol-chloroform extraction and ethanol pre-

1 2 3 4 5 6 7 8 9 1011121314

cipitation. The D N A was transfected into subconfluent 293 cells plated in a 60-mm dish with SuperFect (Qiagen) according to the manufacturer's instructions. The cells were cultured with Dulbecco's modified Eagle's medium ( D M E M ) (GIBCO, Grand Island, N Y ) containing 1 0 % fetal calf semm (FCS) or with 0.5% overlaid agarose-DMEM containing 1 0 % FCS. Ten days later, the cells were harvested and five independent plaques were isolated. The virus was released by four cycles of freez­ing and thawing, and amplified in 293 cells. Recombinant virus expressing h A A T was referred to as AdhAAT. The titer of the vims was measured by standard plaque assay in 293 cells (Kay etal, 1995).

To analyze the viral D N A . Ad D N A was isolated from the cells with full cytopathic effect (CPE) as described previously (Lieber et al. 1996). Briefly, 293 cells with full C P E were di­gested with 0.1% pronase m )0 m M Tris-HCl (pH 7,5)-l% sodium dodecyl sulfate-10 m M E D T A ovemight at 37°C. Af­ter phenol-chloroform extraction, D N A was ethanol precipi­tated, dissolved in T E (10 niM Tris [pH 7.5]. 1 m M E D T A ) , and digested with Hindlll or I-C(?i(l/PI-5c<?I, and analyzed in a 0.8% agarose gel stained with ethidium bromide.

h/\AT expression in HeLa cells infected with AdhAAT

HeLa cells (8 X 10^ cells) were seeded into a 60-mm dish, and the next day they were treated with A d h A A T (at a multi­plicity of infection [MOI] of 20 or 100). The cells were cul­tured with D M E M containing 1 0 % FCS and 2 days later h A A T concentrations in the medium were determined by enzyme-linked immunosorbent assay as previously described (Kay et al, 1995).

FIG. 2. Restriction endonuclease analysis. p A d H M 4 . p A d H M 4 - h A A T plasmid, or recombinant adenovims A d h A A T D N A was digested by Pad. Pad/HmdlU, Hindlll or 1-Ceul/Pl-Scd, separated in a 0.8% agarose gel, and ethidium bromide stained. Lane 1, I kb D N A ladder marker; Lane 2, Pod-di­gested p A d H M 4 plasmid D N A ; lane 3, PcfcI/W/ndlll-digested p A d H M 4 plasmid D N A ; lane 4, l-C<?Hl/Pl-5cfI-digested p A d H M 4 - h A A T plasmid D N A ; lane 5, Pod-digested p A d H M 4 - h A A T plasmid D N A ; lane 6, Pc(d////;!dIII-digested p A d H M 4 - h A A T plasmid D N A ; lane 7,1-Ccid/PI-Scd-digested A d h A A T (pool) viral D N A ; lane 8, //mdlll-digested A d h A A T (pool) viral D N A ; lane 9, ////tdlll-digested A d h A A T (clone I) viral D N A ; lane 10, /f//idIII-dige,sted A d h A A T (clone 2) viral D N A ; lane 11. //mdlll-digested A d h A A T (clone 3) Viral D N A ; lane 12, //;>7dlll-digested A d h A A T (clone 4) viral D N A ; lane 13, ////jdlll-digested A d h A A T (clone 5) viral D N A ; lane 14. //oidlll-digested A marker.

RESULTS

Construction and characterization of El-deleted adenovirus vector D N A

To constmct the plasmid with recombinant Ad vector DNA containing a foreign gene at the El deletion site by a single in vitro ligation, three unique restriction sites (I-C<?;(1, Swal. and PI-Scel) were introduced into the El deletion site of the vector plas­mid containing a complete vector genome. l-Ceul (Mai'shall and Lemieux, 1991) and Pl-Scel (Gimble and Thomer. 1992) are in­tron-encoded endonucleases that recognize at least 9-10 and 11 bp, respectively. Swal is a rare-cutting resttiction enzyme with a sequence speciticity of 8 bp. The l-Cc((I and PI-5ceI sites were used for the insertion of foreign gene, while the Swal site was used to reduce the generation of parental, nonrecombined plas­mid. The resulting vector plasmids, p A d H M 1, -2, -3, and -4, con­tain the complete Ad genome minus the El (pAdHMl, -3) or EI/E3 region (pAdHM2. -4), have Pod (pAdHM3. -4) or PacUClal (pAdHMI. -2) sites at both ends of the Ad genome, and have \-Ceul, Swal. and Pl-Scd sites in the El deletion site (Fig. I A). «//;dIIl and Pad treatment of p A d H M 4 produced the expected fragments shown in Fig. 2 (lanes 2 and 3).

A shuttle plasmid, p H M 3 , containing a pUC18-derived mul­ticloning site between the I-Cc„I and PI-5c<?I sites was con­stmcted (Fig. IB) and used for cloning an expression cassette containing human a,-antitrypsin c D N A under the transcrip­tional control of the R S V LTR promoter (RSVhAATbPA); the

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.

EFFICIENT CONSTRUCTION OF Ad VECTORS 2581

MOI

Table 1. Human al-Antitrypsin Expression IN HeLa Cells Infected with AdhAAT"

hAAT concentration (\i,g/dish/24 hr)

20 100

2.44 12.6

0.65 0.8

"HeLa cells were infected with AdhAAT (MOIs of 20 and 100), and h A A T concentration in the medium was determined 48 hr postinfection. Data represent means ± SD for four experiments.

product was called pHM3-hAATl. The cortesponding Ad vec­tor DNA, pAdHM4-hAAT (Fig. IC), was produced by in vitro ligation of I-Ce«I/PI-SceI-digested p A d H M 4 and pHM3-hAATl (Fig. IC). l-Ceul and Pl-Scel digestion of pAdHM4-hAAT produced the expected 2.1-kb D N A fragment corre­sponding to an h A A T expression cassette in addition to the expected adenoviral fragments (Fig. 2, lane 4). The expected D N A fragments were also detected with either Pad or PadlHindlll digestion (Fig. 2, lanes 5 and 6). More than 9 0 % (15 of 16 clones) of the transformants had the cortect restric­tion pattem.

Generation of adenovirus vector expressing hAAT

To demonstrate that pAdHM4-hAAT was able to produce A d vector in 293 cells. Pad-linearized p A d H M 4 - h A A T D N A

was transfected into 293 cells and the cells were cultured for 10 days. The cell lysates were used to infect fresh 293 cells, followed by routine adenovims preparation. The cortectness of the viral D N A was verified by double digestion with l-Ceul and PI-5ceI (Fig. 2, lane 7) or Hindlll digestion (Fig. 2, lane 8) and found to have the same pattem as PacI///indIII-digested p A d H M 4 - h A A T plasmid D N A . For further confirmation, 17 independent plaques were found to have identical D N A re­striction pattems (results for 5 clones are shown in Fig. 2, lanes 9-13). V i m s was not produced by the transfection of circular plasmid ( p A d H M 4 - h A A T ) into 293 cells, consistent with pre­vious reports (Chartier et al, 1996; H e et al, 1998). Finally, to confirm the functionality of the vector, robust h A A T expres­sion was detected in AdhAAT-infected H e L a cells (Table 1).

D I S C U S S I O N

We have developed a simple and efficient method for con­stmcting recombinant El-deleted adenoviral vectors by in vitro ligation. Previously, it has been difficult to manipulate A d D N A in vitro because of the paucity of unique useful restriction sites. Thus, by insertion of unique l-Ceul, Swal, and Pl-Scel sites in the El-deleted region of the plasmid with an El-deleted A d genome, w e could easily produce a vector by a simple in vitro ligation. The shuttle plasmid p H M 3 , which has multicloning sites between the 1-Ceul and PI-5ceI sites, allowed for the gene of interest to be easily introduced into the El deletion region

Method of Mizuguchi and Kay Method of Chartier et al.

Vector plasmid (e.g. pAdHM4)

>!' I-Ceul and Pl-Scel

digestion

Shuttle plasmid (e.g. pHM3)

Insert gene of Interest

Vector plasmid (e.g. pTG3602) Clal digestion

\ ^ < 2-3 l-Ceul and Pl-Scel

digestion /

ligation (Swal digestion)

Transformation into DHSa ^ ^ 3-4 days

Preparation of plasmid and restriction anaiysis

>!< Plasmid containing recombinant Ad virus

genome ^ • S-7 days

Pad digestion Transfection

Into 293 ceiis

days

Plaques •15-20 days (Almost all the plaques have the expected recombinant virus)

\

Shuttle plasmid

insert gene of interest ^ <•••

Linearization by cutting with

restriction enzyme

' 2-3 days

Transformation intoBJ5183

Preparation of plasmid >!'

Transformation Into standard strain of E.coil Preparation of plasmid and restriction analysis Plasmid containing recombinant Ad virus

genome Pad digestion

Transfection into 293 cells

^ 4 Plaques T"

(Almost all the plaques have the expected recombinant virus)

• 3-4 days

Method of Bett et al. Vector plasmid Shuttie plasmid (e.g. pBHGIO) (e.g. pAEIsplA) V ^

\ Insert gene \ of interest \ / • 2-3 days Transfection into 293 ceiis

^ ^ 2-4 days Plaques •••" 12-17 days

(Some plaques have wild type Ad virus. Need to amplify > .... 1*^^°'^°'^ and analyze the virus trom ^ additional each plaque) "* • 5-6 days

• 7-9 days

•17-22 days

F I G . 3. A comparison flow chart of the in vitro ligation and homologous recombination methods in E. coli or 293 cells.

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.

2582 MIZUGUCHI AND KAY

of the vector. The Swal site of the vector plasmid nearly elim­inated the possibility of generating a null cassette (nontrans-gene)-containing vector owing to the presence of the parental plasmid D N A .

The conventional in vitro ligation method (Berkner and Sharp, 1983; Gtiardi et al, 1990; Rosenfeld et al, 1991) has a number of disadvantages. Recombinant D N A cannot be recov­ered as a plasmid, because the viral D N A is used as a vector and the ligation products are directiy transfected into 293 cells. Therefore, in addition to the low efficiency, there is the gener­ation of null vector and wild-type vims because of incomplete digestion and/or religation of the D N A s .

Although several other improved methods to make recom­binant A d vectors have been reported (Bett et al, 1994; Chartier et al, 1996; Miyake et al, 1996; Crouzet et al, 1997; Fu and Deisseroth, 1997; He et al, 1998), they are based on inefficient homologous recombination in 293 cells (Bett et al, 1994; Miyake et al, 1996) or require additional steps. Miyake et al. (1996) reported an efficient method of vector production based on homologous recombination in 293 cells, but this required an extra step of A packaging and wild-type adenoviral genome gen­eration was observed. The homologous recombination method in yeast (Ketner et al, 1994) and E. coli (Chartier et al, 1996; Crouzet et al, 1997; He et al, 1998) is probably as efficient in terms of recombinant viral production as the method described here; however, the E. coli system requires a three-step trans­formation, including the use of two different E. coli strains. This system does allow easy insertion of foreign genes into the E3 region as well as the El region. A cosmid A d vector plasmid cloning strategy requires an additional A packaging step (Fu and Deisseroth, 1997). A flow chart comparing the properties ofthe different homologous recombination systems is shown in Fig. 3.

The major advantage of our system is its simplicity; it re­quires only a routine two-step transformation protocol that is familiar to any molecular biologist. Because of the paucity of generation of wild-type or null vectors, the time-consuming plaque purification procedure is not absolutely required to pro­duce vims. Furthermore, the system will allow for the easy mod­ification of vector D N A backbone, or for addition of various expression cassettes, by routine cloning because of the many unique restriction sites in p A d H M l and p A d H M 2 . These in­clude P o d (left end ofthe genome); 1-Ceul, Swal, and PI-5ceI; Xcal (bp 5764, in the case of p A d H M 2 ) ; Pmel (bp 13255); BamHI (bp 21562); Spel (bp27082); Srfl (bp 27527); and CZal (right end of the genome). In addition, this system may allow for the production of vectors that have proven difficult to make because they produce a protein that interferes with D N A re­combination, or because they reduce cell viability because of their prolonged expression in mammalian cells. In general, the use of this system should facilitate the constmction of addi­tional Ad vectors for gene transfer in basic research as well as gene therapy.

ACKNOWLEDGIVIENTS

We thank Leonard Meuse for technical assistance and An­dre Lieber for helpful discussion. H.M. is the recipient of a fel­

lowship from the Japan Society for the Promotion of Science. This work was supported by N I H DK49022.

REFERENCES

BERKNER, K.L., and SHARP, P.A. (1983). Generation of adenovirus by ttansfection of plasmids. Nucleic Acids Res. 11, 6003-6020.

BETT, A.J., H A D D A R A , W., PREVEC, L., and G R A H A M , F.L. (1994). An efficient and flexible system for construction of aden­ovirus vectors with insertions or deletions in early regions 1 and 3. Proc. Nati. Acad. Sci. U.S.A. 91, 8802-8806.

CHARTIER, C, DEGRYSE, E., GANTZER, M., DIETERLE, A„ PAVIRANI, A., and MEHTALI, M. (1996). Efficient generation of recombinant adenovirus vectors by homologous recombination in Es­cherichia coll J. Virol. 70, 4805^810.

CROUZET, J., NAUDIN, L., ORSINI, C, VIGNE. E., FERRERO, L., LE ROUX, A., BENOIT, P., LATTA, M., TORRENT, C, BRANEL­LEC, D., DENEFLE, P., M A Y A U X , IF., PERRICAUDET, M., and YEH, P. (1997). Recomblnational construction in Escherichia coli of infectious adenoviral genomes. Proc. Nati. Acad. Sci. U.S.A. 94, 1414-1419.

FU, S., and DEISSEROTH, A.B. (1997). Use ofthe cosmid adenovi­ral vector cloning system for the in vitro construction of recombi­nant adenoviral vectors. Hum. Gene Ther. 20, 1321-1330.

GILARDI, P., COURTNEY, M.. PAVIRANI, A., and PERRI­CAUDET, M. (1990). Expression ofhuman alpha 1-antitrypsin us­ing a recombinant adenovirus vector. FEBS Lett. 267, 60-62.

GIMBLE, F.S., and THORNER, J. (1992). Homing of a D N A en­donuclease gene by meiotic gene conversion in Saccharomyces cere­visiae. Nature (London) 357, 301-306.

HE, T.C, ZHOU, S., D A COSTA, L.T., YU, J., KINZLER, K.W., and VOGELSTEIN, B. (1998). A simplified system for generating re­combinant adenoviruses. Proc. Natl. Acad. Sci. U.S.A. 95, 2509-2514.

KAY. M.A., and W O O . S.L. (1994). Gene therapy for metabolic dis­orders. Trends Genet. 19, 253-257.

KAY, M.A.. Ll, Q.. LIU, T.J., LELAND, F., T O M A N . C. FINEGOLD, M., and W O O , S.L.C. (1992). Hepatic gene therapy: Persistent ex­pression of human alpha 1 -antitrypsin in mice after direct gene de­livery in vivo. Hum. Gene Ther. 3, 641-647.

KAY, M.A., G R A H A M , F., LELAND. F., and W O O , S.L.C. (1995). Therapeutic serum concentrations of human alpha 1-antitrypsin after adenoviral-mediated gene transfer into mouse hepatocytes. Hepatol­ogy 21, 815-819.

KETNER, G., SPENCER, F., TUGENDREICH, S.. CONNELLY, C, and HIETER, P. (1994). Efficient manipulation ofthe human aden­ovirus genome as an infectious yeast artificial chromosome clone. Proc. Nati. Acad. Sci. U.S.A. 91, 6186-6190.

KOZARSKY, K.F., and WILSON, J.M. (1993). Gene therapy: Aden­ovirus vectors. Curr. Opin. Genet. Dev. 3, 499-503.

LIEBER, A., HE, C.-Y., KIRILLOVA, I., and KAY, M.A. (1996). Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first-generation vectors in vitro and in vivo. J. Virol. 70, 8944-8960.

MARSHALL. P., and LEMIEUX, C. (1991). Cleavage pattern of the homing endonuclease encoded by the fifth intron in the chloroplast large subunit rRNA-encoding gene of Chlamvdomonas eugametos. Gene 104, 241-245.

MIYAKE, S., MAKIMURA, M., KANEGAE. Y., HARADA, S., SATO, Y., TAKAMORI, K., TOKUDA, C, and SAITO. I. (1996). Efficient generation of recombinant adenoviruses using adenovirus DNA-terminal protein complex and a cosmid bearing

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.

EFFICIENT CONSTRUCTION OF Ad VECTORS 2583

the full-length virus genome. Proc. Natl. Acad. Sci. U.S.A. 93, 1320-1324.

ROSENFELD, M.A., SIEGFRIED, W., YOSHIMURA, K., YONEYAMA, K., FUKAYAMA, M., STIER, L.E., PAAKKO, P.K., GILARDI, P., STRATFORD PERRICAUDET, L.D., PERRI­CAUDET, M., et al (1991). Adenovirus-mediated transfer of a re­combinant alpha 1-antitrypsin gene to the lung epithelium in vivo. Science 252, 431^34.

Address reprint requests to; Dr. Mark A. Kay

Department of Pediatrics Stanford University School of Medicine

300 Pasteur Drive, Room G305A Stanford CA 94305

Received for publication June 3, 1998; accepted after revision September 9, 1998.

Dow

nloa

ded

by S

tanf

ord

Uni

vers

ity M

edic

al C

ente

r fr

om w

ww

.lieb

ertp

ub.c

om a

t 10/

09/1

8. F

or p

erso

nal u

se o

nly.