encephalomyocarditis virus internal ribosomal entry site rna

JOURNAL OF VIROLOGY, May 1994, P. 3183-31920022-538X/94/$04.00+0Copyright X) 1994, American Society for Microbiology

Encephalomyocarditis Virus Internal Ribosomal Entry SiteRNA-Protein Interactions

GARY W. WITHERELL* AND ECKARD WIMMER

Department of Microbiology, State University ofNew York at Stony Brook, Stony Brook New York 11794

Received 9 June 1993/Accepted 16 November 1993

Translational initiation of encephalomyocarditis virus (EMCV) mRNA occurs by ribosomal entry into the 5'nontranslated region of the EMCV mRNA, rather than by ribosomal scanning. Internal ribosomal bindingrequires a cis-acting element termed the internal ribosomal entry site (IRES). IRES elements have beenproposed to be involved in the translation of picornavirus mRNAs and some cellular mRNAs. Internalribosome binding likely requires the interaction of trans-acting factors that recognize both the mRNA and theribosomal complex. Five cellular proteins (p52, p57, p70, p72, and plOO) cross-link the EMCV IRES or

fragments of the IRES. For one of these proteins, p57, binding to the IRES correlates with translation.Recently, p57 was identified to be very similar, if not identical, to polypyrimidine tract-binding protein. On thebasis of cross-linking results with 21 different EMCV IRES fragments and cytoplasmic HeLa extract or rabbitreticulocyte lysate as the source of polypeptides, consensus binding sites for p52, p57, p70, and plOO areproposed. It is suggested that each of these proteins recognizes primarily a structural feature of the RNA ratherthan a specific sequence.

Encephalomyocarditis virus (EMCV) is a member of thegenus Cardiovirus of the family Picomaviridae. Like otherpicornaviruses, the 5' nontranslated region (NTR) of EMCVmRNA is unusually long, is uncapped, and contains severalnoninitiating AUG codons. Translational initiation of EMCVmRNA occurs by a cap-independent mechanism, requiringapproximately 600 nucleotides (nt) of the 830-nt-long 5' NTR(19, 20, 22, 33). This 600-nt segment, which occurs approxi-mately 260 nt downstream from the 5' end of the RNA, istermed the internal ribosomal entry site (IRES). SimilarIRES-dependent translational initiation mechanisms are uti-lized by other picornavirus mRNAs, such as poliovirus (39, 40),foot-and-mouth disease virus (23), and hepatitis A virus (5).The IRES element also occurs in the genome of an envelopedplus-strand RNA virus, hepatitis C virus (53), and of a cellularmRNA, BiP (28). Picornavirus IRES elements can be dividedinto two types on the basis of their nucleotide sequences andproposed secondary structures; type 1 belongs to the generaEnterovirus and Rhinovirus, and type 2 belongs to the generaCardiovirus, Aphthovirus, and Hepatovirus of the Picomaviridae(5, 9, 21, 26, 42, 43). Remarkably, the IRES elements of thetwo groups have little, if any, sequence or structural homology.One common primary sequence element located at the 3'

border of each IRES element, the Yn-Xm-AUG motif, with Yncorresponding to a pyrimidine tract of length n and Xmcorresponding to a random spacer sequence of length m, hasbeen proposed to unify cap-independent translation amongpicornaviruses (21, 44). Another possible unifying feature ofIRES elements could be their interaction with specific proteins(7). Four cellular proteins (p52, p57, p70, and plOO) whichcross-link fragments of IRES elements have been observed. Apolypeptide with a molecular mass of 52 kDa has been foundto bind the IRES of poliovirus (29, 41) and of EMCV (4, 22).p52 has recently been identified to be La (30), a nuclearprotein that binds the 3' terminus of nascent RNA polymerase

* Corresponding author. Current address: RiboGene Inc., 21375Cabot Blvd., Hayward, CA 94545. Phone: (510) 732-5651. Fax: (510)732-7741.

III transcripts (15). Immunodepletion of cell extracts with Laantibodies inhibits cap-independent translation, while the ad-dition of La to rabbit reticulocyte lysate (RRL) correctsaberrant and enhances authentic translational initiation ofpoliovirus mRNA (30).Another protein, p57, was found to bind the IRES elements

of EMCV (4, 22), foot-and-mouth disease virus, (27), andpoliovirus (1Sa, 41). It has been proposed that p57 recognizesa linear nucleotide sequence within these IRES elements (4,27). Recently, p57 has been found to be very similar, if notidentical, to polypyrimidine tract-binding protein (pPTB) (16),a predominantly nuclear protein, also known as hnRNPI (12),that is possibly involved in 3' splice site selection or RNAmetabolism (11, 13, 35, 38). Cap-independent translation isinhibited by the addition of pPTB antibodies to cell extractsbut cannot be restored by the addition of purified pPTB (16).This observation suggests that pPTB is associated with otherfactors required for translation (16). Additional studies indi-cate that purified pPTB recognizes RNA structural elementsrather than specific sequences and that the binding specificityof pPTB is increased by the presence of factors within HeLaextract (57). Thus, the binding properties of pure pPTB/p57may not reflect the binding properties of pPTB/p57 within aribonucleoprotein complex (RNP). We have therefore at-tempted to determine the binding specificity of pPTB/p57when presented to RNA within the context of a cellularextract.

Additional proteins have also been observed to cross-linkfragments of various IRES elements (4, 22, 29, 41). Two ofthese proteins, p70 and plOO, may associate with pPTB/p57since pPTB antibodies immunoprecipitate not only p57 butalso p70 and plOO (51a). The addition of purified pPTB toHeLa extract has also been observed to enhance both p57 andplOO cross-linking (57). Furthermore, pPTB and a protein witha molecular mass of 97 kDa (likely the same as plOO describedhere) have been found to act synergistically to stimulatecap-independent translation directed by the rhinovirus IRESelement (3a). Interestingly, formation of a large RNP contain-ing pPTB and a 100-kDa nuclear protein has been proposed tobe required to restore splicing activity to pPTB-immunode-

3183

Vol. 68, No. 5

3184 WITHERELL AND WIMMER

pleted extracts (38). It is uncertain, however, whether thenuclear 100-kDa protein described by Patton et al. (38) and thecytoplasmic 100-kDa protein studied here are identical pro-teins.

In this paper p57, p52, p7O, and plOO are shown to bindspecifically to multiple fragments of the EMCV IRES. Con-sensus binding sites for each protein are proposed on the basisof cross-linking results with 21 different EMCV IRES frag-ments.

MATERIALS AND METHODS

Materials. Oligodeoxynucleotides were synthesized on an

Applied Biosystems 380B DNA synthesizer. [t_-32P]UTP,[cx- 2P]CTP, and [ot-32P]ATP (3,000 Ci/mmol) and 35S-dATPwere purchased from Amersham. RNase A, RNase Ti, andcalf intestine alkaline phosphatase were obtained from Boehr-inger Mannheim. T7 DNA polymerase (Sequenase) was pur-

chased from United States Biochemical Corporation. TaqDNA polymerase was purchased from Perkin-Elmer Cetus.RRL was purchased from Promega. DNA restriction enzymes,

T4 DNA ligase, T4 DNA polymerase, and DNA polymerase Ilarge (Klenow) fragment were purchased from New EnglandBiolabs. Manufacturer's protocols were followed for all reac-

tions.Construction of transcription templates. Plasmids were

constructed by introducing deletions or insertions into plasmidvectors pBS-ECAT (20), pBS-ECAT393 (22), and pBS-ECAT422 (22) to create transcription templates for RNAfragments 2, 9, 15, 16, and 21. Styl, EcoRI, and ApaLIrestriction sites blunt ended with the polymerase activity of theKlenow fragment of DNA polymerase I and ApaI restrictionsites blunt ended with the 3'-to-5' exonuclease activity of T4DNA polymerase are designated (blunt) in the text below.Plasmid pBS-ECAT was used to construct the template forfragment 2. pBS-ECAT was digested with StyI, blunt endedwith Klenow fragment, and religated. ApaI (blunt)-NcoI frag-ments of this construct were then ligated to an EcoRI (blunt)-NcoI fragment of pBS-ECAT to create the fragment 2 DNAtemplate. The plasmid template for fragment 9 was created byligating StyI-PstI and BstXI-PstI fragments of pBS-ECAT393with oligo-A (described below) digested with StyI and BstXI.Oligo-A was amplified by PCR from pBS-ECAT with primersTAACCTAGGGGTCTTTCCCCTAGGAATGCAAGGTCTand GGATATATCAACGGTGG. Mispriming resulted in thedeletion of the sequence underlined. Fragments of plasmidpBS-ECAT (ApaI-NcoI and EcoRI-NcoI digested) were li-gated to oligo-B (described below) digested with EcoRI andApaI to construct the plasmid template for fragment 15 andfragment 16. Oligo-B was PCR amplified from pBS-ECATwith primers CCCGAATTCGAGCTCTAACGTTACTGGCCG and ATTGGGCCCTCGGTGGAAAATACATATAG.The plasmid template for fragment 21 was created by ligatingtogether EcoRI (blunt)-PstI and ApaLI (blunt)-PstI fragmentsof pBS-ECAT. Following complete digestion with restrictionenzymes, DNA fragments were purified on low-melting-pointagarose gels (49) and ligated with T4 DNA ligase. Escherichiacoli C600 was used as a host in each case (45). Transformantsharboring plasmid DNA were screened by ampicillin resistanceand restriction analysis of minilysate plasmid DNA (49).Plasmids were sequenced in the region of interest with T7DNA polymerase by use of 35S-labeled dATP.

In vitro transcription reactions. Oligoribonucleotides were

prepared by in vitro transcription from synthetic DNA (frag-ments 6, 7, 8, 11, and 12), from PCR templates amplified witha 5' primer containing a T7 promoter (fragments 3, 4, 5, 17,

and 18), or from restricted CsCl-purified (49) plasmid DNA(fragments 1, 2, 9, 10, 13, 14, 15, 16, 19, 20, and 21) byprocedures previously described (31, 50). Restricted plasmidDNA constructs, described above, were used directly as tem-plates for fragments 2, 9, 15, 16, and 21. Restricted plasmidpBS-ECAT (20) was used directly as a template for fragments13 and 14, restricted plasmid pBS-ECAT393 (22) was useddirectly as a template for fragments 1 and 10, and restrictedplasmid pBS-ECAT422 (22) was used directly as a template forfragments 19 and 20. RNAs were typically labeled by theaddition of [ot-32P]UTP (5 ,uCi) into the transcription reactionmixture. Transcription reaction mixtures were purified withStratagene NucTrap push columns, eluted with 5 mM HEPES(N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; pH7.6), 25 mM KCl, and 5 mM MgCl2, and stored at - 20°C.

Preparation of HeLa extract. A cytoplasmic extract of S3HeLa suspension cells (referred to as HeLa extract) wasprepared as described previously (34) except that dialysis andmicrococcal nuclease steps were omitted. HeLa extract wasadjusted to 10% (vol/vol) glycerol and stored at - 80°C.

Cross-linking assays. UV light cross-linking assays wereperformed as described previously (22). 32P-labeled RNAswere incubated with either 50 ,ug of HeLa extract or 600 ,ug ofrabbit reticulocyte lysate in 30 ,ul of cross-link buffer (5 mMHEPES [pH 7.6], 25 mM KCl, 5 mM MgCl2, 3.8% glycerol)containing 1 ,ug of rRNA at 30°C for 20 min. Reactions werecross-linked in a Stratagene Stratalinker 2400 UV CrossLinker at 4,000 ViW/cm2 for 40 min. RNAs were digested byincubation with 20 jig of RNase A and 200 U of RNase Ti.Cross-linked proteins were separated on 12.5% sodium dode-cyl sulfate (SDS)-polyacrylamide gels by the buffer system ofLaemmli (24), as modified by Nicklin et al. (36). Gels wereelectrophoresed at 5 to 10 V/cm at constant current (70 mA),dried, and autoradiographed. The electrophoretic mobility andintensity of the cross-linking signal for each band were quan-titated by scanning densitometry.

Competition assays were used to ensure that the same set orsubset of proteins were cross-linking each RNA. Competitionassays were performed as described above, except that labeledIRES fragments (fragments 1, 2, 3, 14, 15, 16, and 21) wereincubated with RRL in the presence of either 3 jig ofunlabeled fragment 1 or 3 jig of unlabeled rRNA. Fragment 1was chosen as the unlabeled competitor since in the absence ofrRNA it shows some affinity for all four cross-linkable RRLproteins, p52, p57, p70, and p72 (data not shown). Theaddition of excess unlabeled fragment 1 was found to inhibitp52, p57, p70, and p72 cross-linking to each labeled fragmenttested, whereas the addition of the same amount of rRNA hadlittle or no effect on cross-linking (data not shown).RNA folding. Optimal and suboptimal foldings for RNA

sequences were computed by use of the mfold package byZuker and Jaeger (see references 17, 18, and 62). The second-ary structure illustrated was the thermodynamically most fa-vored structure for all fragments except fragments 1 and 9.These two suboptimal foldings were chosen since they corre-spond most closely to the folding of the EMCV IRES. Subop-timal foldings shown for fragments 1 and 9 are within 0.2 kcal(ca. 0.8 kJ; 0.8%) and 0.1 kcal (ca. 0.4 kJ; 0.6%), respectively,of the most favored structure.

RESULTS

Cross-linking of EMCV IRES to RRL and HeLa extracts.The EMCV IRES used in this study contains the 580-nt3'-terminal segment (nt 260 to 840) of the 5' NTR of theEMCV genome (Fig. 1A). Although a core of 438 nt (nt 402 to

J. VIROL.

EMCV IRES RNA-PROTEIN INTERACTIONS 3185

AACAGaU-C_CUCC0AUCCAC COCOA

G M

E

uAmeC

oAA

IMMo C c$7

Ac A 1a u 0 AC C Cleoa U CAAC GAU

A C

u c nD

F

a

JB

C0 o P I. 50 50om. * g. as 50vNcl rcN 55 5 5

IRES [

131 1 20[14 1111191_l

15 I 1 1 171 21

16 21 * A Zla

IIF_0 3 1* *i12[J 4l

5**

6m

7 [}80F-

9

10oEIFIG. 1. EMCV IRES sequence, predicted secondary struct

relation of IRES fragments to the full-length IRES. (A) Prinpredicted secondary structure of the EMCV IRES (9, 42). Ststructures are sequentially named by letters according to Du(9), and nucleotide positions on the EMCV genome are mEnumbers. The initiating AUG start codon is boxed. (B)representation of EMCV IRES and IRES fragments used

840) is sufficient to promote internal ribosomal entry (22), itstranslational efficiency in a dicistronic mRNA is reducedapproximately fivefold, compared with the 580-nt fragment.For this reason, we chose to use the 580-nt 5' NTR sequencethat includes 24 nt of the 5' polypyrimidine tract and theauthentic EMCV initiation codon. A series of stem-loopstructures, designated D to M, follow the 5' polypyrimidinetract (note that we have changed our designation of the loopsaccording to the proposal of Duke et al. [9]; for example, theE-loop is now referred to as the H-loop). The full-length IRESand fragments of the IRES were synthesized and used for UVcross-linking experiments. The relation of the IRES fragmentsto the full-length IRES is illustrated in Fig. 1B. Sequences andpossible secondary structures of IRES fragments (see Materi-als and Methods) are shown in Fig. 2.To analyze the binding of cellular proteins to the EMCV

IRES, we prepared 32P-labeled RNAs and incubated themwith either HeLa extract or RRL. After the RNA-proteincomplexes were cross-linked with UV light, the RNAs weredigested with nucleases and the labeled proteins were sepa-rated by SDS-polyacrylamide gel electrophoresis. The EMCVIRES was found to cross-link two proteins (p52 and pS7) withHeLa extract (Fig. 3A, lane IRES) and three proteins withRRL (p52, p57, and p72) (Fig. 3B, lane IRES). Fragments ofthe IRES were synthesized (Fig. 2) in an attempt to localize the

CA , binding site of these proteins. Fragments contained sequencesderived from either the D-loop (fragments 14 and 16), theDE-loops (fragment 15), the DEF-loops (fragment 13), the

uu F-loop (fragments 11 and 12), the H-loop (fragments 1-10), thexc I-loop (fragment 17), the J-loop (fragment 18), the IJ-loops

(fragment 19), the IJKLM-loops (fragment 20), or the KLM-loops (fragment 21). Fragments 20 and 21 include the Yn-Xm-AUG motif, of which the AUG is the initiation codon of theEMCV polyprotein (21). Relative cross-linking intensities forthese fragments are shown in Table 1.

Cross-linking of the H-loop to HeLa extract and RRLproteins. The H-loop, a term used for the H stem-loopstructure shown in Fig. 1A, was of special interest to us sincetwo point mutations in the stem adjacent to the loop abolishboth IRES function and UV cross-linking of p57 (22). RNA

I fragments containing H-loop sequences are designated H-loopvariants and contain extra 5' and 3' nucleotides because of T7promoter restrictions and the application of runoff transcrip-

Z tion reactions. Results for UV cross-linking of HeLa extractand RRL proteins to various H-loop variants labeled with[a-32P]UTP are shown in Table 1 and Fig. 3A and B (lane

1 numbers correspond to fragment numbers detailed in Fig. 1Band 2). pS7, the HeLa-specific plOO, and the RRL-specific p72proteins cross-link well when fragment 1 is labeled with[a-32P]UTP, whereas a polypeptide migrating with an apparentmolecular mass of 52 kDa cross-links only weakly (Fig. 3A andB, lanes 1, and Table 1). These results are in agreement withpublished data (22).

In an attempt to localize the p57 and p52 cross-linking site(s)on the H-loop, fragment 1 was synthesized with either[a-32P]UTP, [a-32P]ATP, or [a-32P]CTP as the source of the

ture, andnary andtem-loopIke et al.arked byLinear

for UV

cross-linking studies. Numbers above the IRES correspond to nucle-otide positions on EMCV mRNA shown in panel A. IRES fragmentsare identified by number and positioned below the full-length IRES toshow the relation of fragment sequences to the IRES sequence.Regions of sequence difference between IRES fragments and thefull-length IRES are indicated by asterisks, and deletions are indicatedby lines.

VOL. 68, 1994


cwuU U

ElC

u A

AC AA AUG U-A

@pUOLR-e11611 UGAAGGAAfrgwnt 1

,26. kcalWmd

U U U CU U U6-C 6-C C-C6-C 6-C G-C6-C 6-C 6-C

ricL c4 .0nGGnAACC

U-A U-A fanentSEl to ~~~~~~4.0 kCS11f

framet 6 -.6 kcallmol

-153 kcaMmol

^fagnt 9

-165 kcalmol

CUU

UU-C

UU GAC QAGC U CCUUCL" A-A-U

10agment 10

-13.2 lkcalhnn

CWU CUUU U U UC-U-

040COUt U-A

U-A U-AAU4U-0

C0O A A

famnt 11 fraomet 12

-116 kead -12.2 kealwad

a6CU

AC$5

11cc ,A C U En u ~~~~~~~~~U-A

UCCCCCCCCUACC AG

ragment 1S

41.1 kceWad

a'

UU

a A6 AAU

0-C

.UAACGLeaAfrnamnt 16

-11.0lkeel/wa

A

6CU-A

CC

cCCuCAA

CHUA-U

UCC-C

AAAAGCCAGC

rgmnt 17

.212 kCl/mol

f"rmagt 14

-102 kclfld

6U U

C4C-.C4

UC a

A

C-.CC-.UA 6

A-U

GGLUU

4S52 kcalhnol

6CUC4

C4A AUG

C-G 6-C

C6C U -U__

fragment 15

-19.3 kceel/md

A A CUU A A cc.GUU ' U-ACA U-A

6-Cm lX-~l ACC U-A

AA~~ fl~~JA A U-A

GC4A G-ALAAt LAJA C-. A-- IAAIIALIG

framet 21

-23.1 keel/d

FIG. 2. RNA fragments derived from the EMCV IRES. Sequences and possible secondary structures of RNA fragments derived from theH-loop (fragments 1 to 10), from the 5' end of the EMCV IRES (fragments 11 to 16), and from the 3' half of the EMCV IRES (fragments 17,18, and 21) are shown. Asterisks indicate nucleotide differences between fragments 2 to 8 and fragment 1. Boxes indicate sequence motifs commonto fragments 1, 2, 5, 9, 10, 13, 14, 15, 16, and 21. Minimum free energies computed with the mfold package by Zuker and Jaeger (17, 18, 62) areshown below each fragment.

radioisotope. Complete RNase digestion after cross-linkingtransfers the 32P label from the 5' end of the labeled nucleotideincorporated during transcription to the 3' end of its 5'neighbor. Thus, cross-linking can only be detected if the

cross-linked nucleotide is the 5' neighbor of the labelednucleotide incorporated. In RNAs labeled with [o-32P]UTP(Fig. 4A) or [ot-3P]CTP (Fig. 4C), the labels are distributeduniformly throughout the RNA, allowing cross-linking sites

J. VIROL.

-uu u

Ucc-A AACAC6-

C£4WA*af

* A-

fragmIt 3k6 -4. Gcu

B:A*vA

fro_t 3

-39A4kcadfaogmnt 2

.299 kcdaIl

CU0U

U~ 5.1c

CGAQ

UAC* AC4 * rA-C-

* -4

fragment 4

-172 kcallmol

ccc cu uuc

A U- A

AAUU U-A* A-U

GACGAtragnmnt S

-13.3 kcalhnd


A

.5 0 IRES fragments

= u 12 3 4 5 6 7 8 9 10 1112 M 13 14151617 1819 2021

p100

p70p57p52

B

p70

p57p52

IRES fragments' w

1 2 3 4 5 6 7 8 9 10 1112 M 13 14151617 1819 2021

FIG. 3. UV cross-linking of RNA fragments derived from EMCVIRES. Fragments were labeled with [ox-32P]UTP and incubated witheither 50 p.g of HeLa extract (A) or 600 ,ug of RRL, in cross-link buffer(pH 7.6) at 30°C for 20 min. After incubation, the complexes were UVcross-linked and digested with ribonucleases, and the labeled proteinswere separated on SDS-polyacrylamide gels. Lanes -HeLa and -RRL,no extract; lane IRES, EMCV IRES from nt 260 to 837; lanes 1 to 21,fragments 1 to 21, respectively, as shown in Fig. 2 or described in thetext; lane M, protein markers of 92 kDa, 69 kDa, and 46 kDa. Bandscorresponding to p52, p57, p7O, and plOO are indicated.

throughout the RNA to be detected. RNAs labeled with[Ox-32P]ATP, however, are not labeled in the upper hairpin ofthe second stem-loop (Fig. 4B), allowing only cross-linkingsites in the first, third, and fourth stem-loops and the lower

stem of the second stem-loop to be detected. From Fig. 4D, itis apparent that cross-linking of RRL to RNAs labeled with[cx-32P]UTP (lane 1) and [_x-32P]CTP (lane 3) results in transferof label to p57, whereas with [at-32P]ATP-labeled RNA, p57cross-linking is greatly reduced (lane 2). If RNAse digestionwas less than complete, then cross-linking to a site even severalnucleotides away from one of the nineteen labeled adenosinesshould have been detected. It is therefore possible that thecross-linking site for p57 in fragment 1 is located in the upper5-bp hairpin of the second stem-loop. Alternatively, otherRNase digestion products of fragment 1 could exist, dependingon the completeness of digestion, which could be cross-linkedto p57 and labeled by [a-32P]UTP and [cx-32P]CTP, but not by[cx-32P]ATP. Cross-linking of p52 is weak but unaffected by thelabel used, showing that the inability to label p57 with[(x-32P]ATP is specific and not due to the particular prepara-tion of RNA.The difference in cross-linking intensities observed for frag-

ment 1, by simply changing the labeled nucleotide, illustratesthe limitations of cross-linking assays. Cross-linking assays donot directly measure binding affinity since the cross-linkingsignal is determined not only by the affinity of a protein for itsbinding target but also by the number of sites cross-linked, thelocation of the protein cross-linking site(s) relative to a labelednucleotide, the number of labeled nucleotides protectedagainst ribonuclease digestion by the cross-linked protein, andthe particular amino acid that contacts the RNA (since aro-matic and heterocyclic amino acids, as well as cysteine, are

especially photoreactive). In a previous study, the cross-linkingintensities and filter-binding affinities of IRES fragments topurified pPTB were found to generally correlate (57), anobservation suggesting that binding affinity has a strong influ-ence on cross-linking intensity. Several fragments, however,were found to cross-link more strongly or weakly than expected

TABLE 1. Relative cross-linking efficiencies of IRES RNA fragments

Relative intensity of cross-linking of the indicated protein to the indicated fragment with":

RNA" HeLa extract RRL extract

p52 p58 p7t) pOO p52 p57 p70 p72

IRES 55 37 0 0 33 100 0 40Fraction

1 5 100 2 22 7 100 2 272 38 23 13 80 59 16 19 03 3 110 0 7 5 130 0 334 10 8 0 8 3 12 0 05 17 0 0 17 3 0 0 06 160 1 0 0 33 0 0 07 150 2 0 0 23 0 0 08 49 0 0 5 9 6 0 09 13 0 5 57 6 2 0 010 8 26 2 27 10 22 0 711 100 0 0 3 28 0 0 012 120 0 0 0 27 0 0 013 77 11 18 7 85 22 31 014 34 19 2 38 18 19 7 015 51 4 11 18 72 5 17 016 72 24 15 200 48 33 18 017 8 1 1 3 0 0 0 018 0 0 0 0 0 0 0 019 9 0 0 31 9 0 0 020 9 3 3 8 20 1 5 021 110 8 49 51 142 8 36 0

aNumbers correspond to RNA fragments shown in Fig. 2, and IRES indicates the EMCV IRES from nt 260 to 837 shown in Fig. IA and B."Band intensities are relative to p57 cross-linking to fragment 1, which is defined as 100.

VOL. 68, 1994

4


A .0. B Cuu

ue'Cu UG.CUG-C 8-A-UUC RI&CuC

UG G

AACC -AeocC-G

C-G

0 ~~U GU U U

*U C-H C-G A UUCACG.A u Up-A A GU.A

uGU u UGAAGGA tCUU CGUU-GUG AG[32 PJ-UTP LABEL [32 P]-ATP LABEL

c uc u0G0G-G-

AAC-U-A

U-A C-GU

AU A U U-

A-G

~QUUG.GU UGUGAAGGA

D IL 0.

:) 0

p57

p52

2 3

132 P]-CTP LABEL

FIG. 4. UV cross-linking of fragment 1 by use of various nucleosidetriphosphate labels with RRL. The sequences and possible secondarystructures of fragment 1 synthesized in the presence of either[a-32P]UTP (A), [a-32P]ATP (B), or [a_32P]CTP (C) are shown.Complete RNase digestion after cross-linking transfers the 32p labelfrom the 5' end of the labeled nucleotide incorporated during tran-scription to the 3' end of its 5' neighbor. Nucleotides labeled with 32pafter UV cross-linking of fragment 1 and RRL and after completeRNase digestion are shown by black dots. (D) UV cross-linking offragment 1 labeled with either [aX-32P]UTP (lane 1), [a-32P]ATP (lane2), or [a-32P]CTP (lane 3) and RRL. Cross-linking assays were

performed as described for Fig. 3. Bands corresponding to p52 and p57are indicated.

on the basis of binding affinity alone (57). The limitations ofcross-linking assays must therefore be considered when com-

paring cross-linking intensities of vastly different sequences.Cross-linking of H-loop variants to HeLa extract and RRL

proteins. Cross-linking of p57 from HeLa extract and RRL tonine H-loop variants (fragments 2 to 10) are shown in Fig. 3Aand B and Table 1. The insertion of 18 nt into fragment 1yielded fragment 2 (see the asterisks of fragment 2 [Fig. 2]) andis expected to alter the secondary structure of the RNA,creating an internal loop and two additional base pairs in theupper stem of the second helix of fragment 1 (Fig. 2).Cross-linking of p57 to fragment 2 was greatly reduced com-

pared with fragment 1. Extending the second helix of fragment1 and deleting the three adjacent stem structures, to producefragment 3, had no effect on cross-linking intensity of p57.However, deletion of 17 nt from the 3' terminus of fragment 3,eliminating the lower 14 bp of the stem (fragment 4), reducedp57 cross-linking. Further 5', 3', and internal deletions offragment 4 (fragments 6, 7, and 8) resulted in RNAs unable tocross-link p57. These results suggest that sequences upstreamand downstream of the upper 13 bp of the second stem-loop offragment 1 contribute to p57 binding. A 2-nt substitution in theupper stem of fragment 4 gave fragment 5 (Fig. 2) andeliminated p57 cross-linking. This 2-nt substitution disrupted

the upper hairpin and bulge of the second stem-loop offragment 4, suggesting that either the upper 5-bp stem, the5-base loop, or the 8-base bulged loop is important for p57cross-linking. Deleting the upper 5-bp stem-loop and eightextrahelical nucleotides of fragment 1 (fragment 9) drasticallyaltered the RNA structure, also eliminating p57 cross-linking.Overall, these results suggest that cross-linking of p57 to theH-loop requires binding determinants (which are not neces-sarily cross-linking sites) in both the upper and lower stemregions of the second stem-loop in fragment 1. If the cross-linking site for p57 is located in the upper stem, as suggested bythe alternative label experiments described above, then thelack of cross-linking to fragment 9 could be due either toelimination of the cross-linking site or to reduced bindingaffinity. Since the proposed cross-linking site is present infragments 6, 7, and 8, the lack of cross-linking to thesefragments is most likely due to the absence of necessarybinding determinants, resulting in decreased binding affinity.Surprisingly, deletion of 52 nt from the 3' end of fragment 1(fragment 10) resulted in a drastically altered RNA structure(Fig. 2) that was still able to cross-link p57, although withreduced intensity. In general, p57 of HeLa and RRLs cross-link the H-loop variants with similar efficiencies.

All the H-loop variants except two were found to cross-linkHeLa extract p52 with at least moderate affinity (Fig. 3A andTable 1). The two fragments that cross-link p57 strongly(fragments 1 and 3) are unable to cross-link p52 well (Fig. 3Aand 4D). These results suggest that p52 and p57, in the mixtureof cytoplasmic proteins, compete for the same binding site infragments 1 and 3. The smallest fragment that cross-links p52is fragment 8, a stem-loop structure with a 5-bp helix and a5-base loop corresponding to the upper hairpin of the H-loop.Thus, it is likely that p52 and p57 compete for binding theupper hairpin of fragment 1 and fragment 3, consistent withthe proposal that the p57-cross-linking site, and therefore partof the p57-binding site, is in the upper hairpin of the secondstem-loop of fragment 1. The weak cross-linking observedbetween p52 and fragment 1 (Fig. 4D), including [ot-32P]ATP-labeled fragment 1 in which the upper hairpin is not labeled(Fig. 4B), may be due to nonspecific p52 binding. p52 fromRRL cross-linked H-loop variants with a specificity similar top52 from HeLa extract, but with reduced intensity (Fig. 3B andTable 1).An RRL-specific protein with a molecular mass of 72 kDa

was found to cross-link the EMCV IRES and IRES fragments1 and 3 (Fig. 3B, lanes 1 and 3, and Table 1), with weakercross-linking to fragment 10 (Figure 3B, lane 10, and Table 1).The cross-linking specificity of p72 thus correlates with p57cross-linking in RRL.A band with a slightly faster migration than p72, correspond-

ing to a 70-kDa polypeptide, was observed with RRL andHeLa extract to cross-link fragment 2 (Fig. 3A and B, lanes 2,and Table 1). Weak cross-linking to fragment 9 was alsodetected (Fig. 3A and B, lanes 9, and Table 1).

Several H-loop variants specifically cross-link a 100-kDaprotein found in HeLa extract, but not in RRL (Fig. 3A and Band Table 1). Jackson and coworkers (see reference 3a) haveidentified a 97-kDa protein (p97) present in HeLa extract, butnot in RRL, which can stimulate rhinovirus IRES-dependenttranslation. It is therefore likely that p97 and plO0, describedhere, are the same protein. RNA fragments 1, 2, 5, 9, and 10cross-link plO0 while fragments 3, 4, 6, 7, and 8 do not. Onecommon feature among RNA fragments that cross-link p100 isthe presence of an NGGY-GYC (N represents any nucleotideand Y represents either cytosine or uridine) helix sequence

J. VIROL.

EMCV IRES RNA-PROTEIN INTERACIIONS 3189

(shown boxed in Fig. 2), which is absent in fragments which donot cross-link plOO.

Cross-linking of D-, E-, and F-loop fragments to RRL andHeLa extracts. The similarities of the F-loop and the H-loop inthe EMCV IRES secondary structure (Fig. 1A) suggested thatthe F-loop may also bind p57 (22). Whereas both the F-loopand the H-loop are hairpins with the same loop sequence(compare fragment 1 and fragment 11 in Fig. 2), there are twomajor differences between the RNAs. The H-loop contains abulged upper helix and a closing GC base pair, while theF-loop has a perfect stem and a closing GU base pair. Thesedifferences may be the reason for the fact that the F-loop(fragment 11) did not cross-link p57 from either HeLa extractor RRL (Fig. 3A and B, lanes 11, and Table 1). To test whetherthe lack of cross-linking of p57 to fragment 11 was due to theweak closing GU base pair, resulting in a 7-base loop ratherthan a 5-base loop, fragment 12 was synthesized (Fig. 2). ThisRNA also did not cross-link p57 (Fig. 3A and B, lanes 12, andTable 1). Fragments 11 and 12 did, however, cross-link p52very well, whereas cross-linking of p70, p72, and plOO could notbe detected (Fig. 3A and B and Table 1). Similar results wereobtained with RRL by use of [32P]CTP- or [32P]ATP-labeledfragments (data not shown).

Cross-linking of p57 from HeLa extract and RRL to fourfragments derived from the very 5' end of the IRES (fragments13 to 16; Fig. 2) are shown in Fig. 3A and B, lanes 13 to 16, andTable 1. A fragment containing DEF-loops (fragment 13)cross-linked p57, while deletion of the F-loop from this frag-ment (fragment 14) had no effect on p57 cross-linking. Theresults from cross-linking experiments with fragments 11, 13,and 14 therefore suggest that the F-loop is neither sufficientnor necessary for p57 cross-linking. Replacement of 19 nt ofthe 24-nt 5' terminal cytosine-rich tract in fragment 13 withseven nucleotides of linker sequence (fragment 15) reducedp57 cross-linking, while the same replacement in fragment 14(fragment 16) had little or no effect on p57 cross-linking. Theseresults suggest that a second p57-binding site may exist at the5' terminus of the EMCV IRES and that fragments 13, 14, and16, along with fragments 1, 2, 3, and 10, contain a commonp57-binding site.p52 and p70 were able to cross-link all four 5' IRES

fragments (fragments 13, 14, 15, and 16), although withreduced cross-linking to fragment 14. The cross-linking signalof plOO to fragment 16 was extremely high, whereas fragment14 cross-linked the same polypeptide with moderate efficiencyand fragments 13 and 15 cross-linked with weak yet detectableefficiency. Each of fragments 13, 14, 15, and 16 contains a helixsequence that fits the NGGY-GYC pattern observed withfragments 2, 5, 9, and 10 (see the boxed sequences in Fig. 2).

Cross-linking of 3' IRES fragments to RRL and HeLaextracts. Fragment 17 and fragment 18 represent stem-loopsderived from the I-loop and the J-loop, respectively (Fig. 1Aand 2). Surprisingly, neither of these RNA fragments was ableto cross-link any protein from either HeLa extract or RRL(Fig. 3A and B, lanes 17 and 18, and Table 1). A runofftranscript (fragment 19, nt 422 to 740; Fig. 1B) containingIJ-loops did cross-link p52 and plOO but not p57 or p70 (Fig.3A and B, lanes 19, and Table 1), whereas a longer runofftranscript containing IJKLM-loops (fragment 20, nt 422 to 837;Fig. 1B) cross-linked all four proteins, albeit very weakly (Fig.3A and B, lanes 20, and Table 1). These results suggest that athird p57-binding site could exist between nt 740 and nt 837.To test this possibility, fragment 21 was synthesized and foundto cross-link strongly to p52, p70, and plOO, with moderatecross-linking to p57 (Fig. 3A and B, lanes 21, and Table 1).

Thus, p57 may also bind a third region of the EMCV IRES,near the 3'-terminus.

DISCUSSION

Three cellular proteins that cross-link fragments of variousIRES elements have been proposed to be important forcap-independent translation: p57 (16, 22); p52 (30); and p97(3a), which is likely the same as the plO0 protein describedhere. Only with p57, however, has a clear correlation betweenbinding to the EMCV IRES and translation been demon-strated (22). In this paper, we examined the UV cross-linkingbetween EMCV IRES-related RNAs and cytoplasmicpolypeptides of a HeLa cell extract or of RRL. Except for theirmigration in denaturing polyacrylamide gels, we did not at-tempt to further characterize the nature of these proteins. Themost important difference between the two cellular extractsemployed here was that RRL lacks plO0. Moreover, RRLappears to contain two cross-linking polypeptides of approxi-mately 70 and 72 kDa, whereas the cytoplasm of HeLa cellsshows only one protein migrating in this range of molecularmasses (designated as p70). Considering similarities in cross-linking specificity, the HeLa p70 polypeptide appears to cor-respond to the RRL p70 polypeptide. On the basis of electro-phoretic properties, we believe p57 to be pPTB (16) and p52 tobe La, an IRES-binding protein described by Meerovitch et al.(30). The nature of plO0 is, as yet, obscure.

It should be emphasized that UV cross-linking of proteinsfrom cellular extracts to the RNA fragments described in Fig.2 may yield quite artificial results. On the one hand, the RNAfragments may assume secondary or tertiary structures insolution that are different from those obtained by computeranalysis, and this may be particularly so for the full-lengthIRES RNA. It is also possible that the recognition features onthe IRES fragments are drastically different from those of thesame sequence within the context of the full-length IRES,because of differences in secondary structure or the addition ofvector-derived sequence to some fragments. On the otherhand, the binding of protein to RNA, as assayed by UVcross-linking, may not reveal all parameters of the interaction(57). These considerations are underscored by the observationthat p52, p57, and p72 cross-link to the full-length IRESwhereas p70 and plO0 do not, yet the latter two polypeptidesreadily cross-link fragments of the IRES. Moreover, it must bekept in mind that all conclusions drawn from cross-linkingresults have been obtained with protein mixtures of unknowncomposition and that the binding specificities of isolatedproteins may be quite different (57, 58). Nevertheless, webelieve that our attempt to deduce the cross-linking specificityand consensus binding site of each IRES-binding protein, asoutlined below, is useful for further studies of the function ofIRES-mediated translation.p57 was found to cross-link RNA fragments derived from

three regions of the EMCV IRES: the 5' end, the H-loop, andthe 3' end. The various p57-binding sites do not, however,share any obvious common primary sequence elements, includ-ing UUUC-containing sequences proposed by Luz and Beck(27) or pyrimidine-rich loops proposed by Borovjagin et al. (4).Indeed, UUUC-containing sequences and pyrimidine-richloops by themselves are not sufficient to confer p57 binding toan RNA (see fragments 5, 6, 7, and 8 [Fig. 2 and 3A and B]).Thus, p57 must bind a common secondary or tertiary structurethat is shared by the various sites. Results from the cross-linking of p57 to RNA fragments with different nucleosidetriphosphate labels suggest that the cross-linking site may belocalized to the upper 5-bp hairpin of the second stem-loop of

VOL. 68, 1994


fragment 1. Consistent with this result, removing the threeadjacent stem-loops and extending the second helix of frag-ment 1 (fragment 3) had no effect on p57 cross-linking. 5' and3' deletions of fragment 3, however, cross-linked with reducedintensity (fragment 4) or did not cross-link at all (fragments 6,7, and 8). Thus, p57-binding determinants extend beyond theproposed cross-linking site. Disrupting the bulge in the secondstem-loop of fragment 1, creating an internal loop, alsoreduced cross-linking (fragment 2). These results suggest thatthe p57-binding site is localized to the second stem-loopstructure of fragment 1, which corresponds to the H-loop ofthe EMCV IRES. It appears that the upper hairpin and bulgedhelix are most important for p57 binding, but that sequencesextending beyond the 13-bp bulged hairpin contribute favor-ably to the interaction (compare fragments 3, 4, and 6; Fig. 3Aand B). Bulged nucleotides have been found to be importantfor RNA binding of several proteins including the R17 coatprotein (61), ribosomal protein L10 (6), and human immuno-deficiency virus type 1 tat (8, 48, 54). Extrahelical nucleotidesare predicted to alter the structure of an RNA helix (3, 52, 55,56) by bending it 18 to 230 (47, 59, 60). Thus, p57 may contactboth the upper and the lower helix in the second hairpin offragments 1 and 3, with the 8-nt bulge optimizing binding byplacing the two helices in an orientation relative to each otherthat promotes p57 binding.Moderate to weak cross-linking of p57 to several other IRES

fragments was observed (fragments 10, 13, 14, 16, and 21).Each of these fragments, except fragment 10, contains helicesseparated by a single-stranded spacer. It is possible that thisspacer allows the two helices to rotate relative to each other,creating a structure that resembles a bent helix, which p57could recognize and stabilize upon binding. Fragment 10 alsolikely resembles a bent helix since it contains three helices thatare predicted to form a T structure. The bent structuresformed by these RNAs would, however, be unlikely to orientthe two helices in exactly the same way as an 8-nt bulged loopwould, thus reducing the binding affinity and explaining theweaker cross-linking relative to fragments 1 and 3. The pro-posed bent helix binding site for p57 is consistent with p57cross-linking to other fragments of the EMCV IRES (4, 22),foot-and-mouth disease virus IRES (27), and stem-loop VI ofthe poliovirus 5' NTR (1Sa) when these fragments are foldedinto the predicted thermodynamically most stable structure(structures not shown). The proposed binding site is alsoconsistent with the lack of p57 cross-linking to a mutatedstem-loop VI (26a) and stem-loop VII (29) of the poliovirusIRES (structures not shown).pPTB, which is very similar, if not identical, to p57 (16),

derived its name from the protein's affinity to a track ofpyrimidine residues upstream from 3' splice sites (11). Thebinding affinity of purified pPTB to homopolymers, however,has a Kd of >200 nM, which is low compared to the bindingaffinity of the protein to fragment 1 (Kd = 20 nM [57]). On thebasis of the binding specificity of purified pPTB, it wassuggested that pPTB greatly prefers to bind heteropolymericRNA with a helix-spacer-helix motif (57). The proposal thatpS7, within the context of cellular extracts, recognizes a benthelix (two helices separated by a single-stranded bulge) isconsistent with this proposal. Since previous studies suggestthat the binding specificity of pPTB is increased by thepresence of factors within HeLa extract (57), pure pPTB maybind any helix-spacer-helix motif while pPTB, in the presenceof cellular factors, may prefer to bind only one type ofhelix-spacer-helix motif, the bent helix. To what extent thisbinding specificity relates to the function of pPTB remains tobe elucidated. The cross-linking of p72 in RRL correlated with

p57 cross-linking. The relation between p72 and p57, however,is unclear.Most of the EMCV IRES fragments tested were found to

cross-link p52, an observation suggesting that it has lowbinding specificity. The smallest fragment that cross-links p52is fragment 8, which corresponds to the upper 5-bp hairpin ofthe H-loop. Other fragments that contain this. hairpin alsocross-link p52 (fragments 2, 4, 6, and 7), provided that p57 doesnot cross-link strongly to the same RNA (as with fragments 1and 3). This suggests that the p52- and p57-binding sitesoverlap, consistent with the proposal that the p57-cross-linkingsite, and therefore part of the p57-binding site, is in the upperhairpin of the second stem-loop of fragment 1. Other frag-ments containing hairpins with no sequence homology to theH-loop (fragments 13 to 16) also cross-link p52. A polypeptidewith a molecular mass of p52 kDa has also been observed tocross-link other EMCV IRES fragments (22) and stem-loop VIof poliovirus mRNA (1Sa). These results suggest that p52 iscapable of binding small stem-loop structures in a sequence-independent manner, an observation that may explain itslimited cross-linking specificity. A protein with a molecularmass of 52 kDa, recently identified as La (30), cross-linksstem-loop VII of the poliovirus IRES (29). Stem-loop VIIconsists of a small hairpin with a 5' single-stranded tail. Asingle-nucleotide substitution that disrupts the stem-loop VIIhelix has been found to reduce p52/La cross-linking (29). It islikely that the 52-kDa protein described here is the same asthat described by Meerovitch et al. (30). The proposal thatp52/La has some affinity for RNA helices is consistent with Labinding to other RNAs such as 4.5 I RNA (46), VA RNA (10),and EBER1 and EBER2 (14). Fragments 17 and 18, however,do not cross-link p52. It is possible that these fragments bindp52 but lack a cross-linking site 5' to the labeled nucleotide,making it difficult to detect binding. Alternatively, fragments17 and 18 may contain negative binding determinants, whichprevent p52 from binding (51).Many of the RNA fragments which cross-link the HeLa-

specific 100-kDa protein (fragments 1, 2, 5, 9, 10, 13, 14, 15, 16,and 21) were observed to contain GC-rich helices at either the5' (fragments 1, 2, 9, and 10) or 3' (fragments 14 and 16)terminus of the RNA (see the boxed regions in Fig. 2). Notethat the 5' GC-rich helices are present in several fragmentsbecause of T7 promoter restrictions and are not found in thefull-length IRES. Comparison of these GC-rich helices re-vealed similar helix sequences. Fragments 1 and 9 containGGGC-GUC helices, fragments 2 and 10 contain GGGC-GCC helices, and fragments 14 and 16 contain UGGC-GCChelices. Similar helix sequences were found in fragment 5(CGGU-GCC), fragments 13 and 15 (UGGC-GCC), andfragment 21 (AGGU-GUC) (see the boxed regions in Fig. 2).Thus, these RNAs have a common NGGY-GYC (N representsany nucleotide and Y represents either cytosine or uridine)helix sequence. This consensus sequence is lacking in all RNAfragments (fragments 3, 4, 6, 7, 8, 11, 12, 17, and 18) which donot cross-link plO0 (Fig. 3A). Fragment 16 may cross-link plO0better than fragment 14, and fragment 15 may cross-link plO0better than fragment 13 (Fig. 3A), because of the presence ofa second GC-rich helix at the 5' terminus of fragments 15 and16 with the sequence GGGC-GCU, closely resembling theNGGY-GYC helix sequence (Fig. 2). Alternatively, differencesin secondary structure between fragments 16 and 14 andbetween 15 and 13 may account for the observed differences inplO0 cross-linking. The NGGY-GYC helix sequence is alsopresent in the thermodynamically most favored structure of afragment derived from the poliovirus IRES stem-loop VI thatcross-links a protein of approximately 100 kDa (26a). The

J. VIROL.


primary sequence of the NGGY-GYC helix could providespecific functional groups in the minor groove for interactionwith plOO (37) or could alter the secondary structure of thehelix, positioning phosphates or 2'-OH groups in an optimalorientation (32) for recognition and binding by plOO.Both HeLa extract and RRL contain a polypeptide of

approximately 70 kDa that cross-links several EMCV IRESfragments (Fig. 3A and B and Table 1). Interestingly, p70 iscross-linked only to fragments which cross-link p52 (Fig. 3Aand B). Fragments which cross-link p70 strongly includefragments 2, 13, 15, 16, and 21, with weaker cross-linkingobserved for fragments 9 and 14. A common structural featureobserved among most of these fragments (fragments 2, 9, 13,14, and 21) is the presence of a stacked U-C mismatch with anadjacent 5' pyrimidine residue (5' YU-C). Although the ther-modynamically most favored structure of fragments 15 and 16lacks the 5' YU-C mismatch, suboptimal foldings of these twoRNAs, within 2 kcal (ca. 8 kJ) of the optimal structure, docontain the mismatch. The consensus p70-binding site is notfound in any of the optimal or suboptimal foldings of otherIRES fragments that do not cross-link p70, except fragment 17,which does not cross-link p52. It is therefore possible that p70RNA binding requires both the 5' YU-C mismatch and p52binding. Whether the U-C mismatch forms a non-Watson-Crick base pair is unknown. Non-Watson-Crick base pairshave, however, been shown to be important for human immu-nodeficiency virus type 1 rev binding (1).

Incubation of EMCV IRES RNA with a cell extract resultsin formation of a 20S RNP (termed the IRESome [22a]).Whether this particle, the composition of which has yet to bedetermined, has any role in IRES function is unknown. Theassembly of an IRESome is likely complex and requiresmultiple components, of which some may be the polypeptidesdescribed here. Even if plOO and p70 are unable to cross-linkthe full-length IRES when incubated with other polypeptides,they may still be components of the IRESome. The bindingspecificities of p70 and plOO could be altered upon formationof the IRESome with the full-length IRES, thus inhibiting p70and plOO binding, analogous to the binding and release of U4small nuclear RNP during spliceosome assembly (25). Changesin binding specificity and solution properties of the R17 coatprotein for its binding target have also been observed uponformation of an RNP containing the R17 coat protein (2, 58).

Since different proteins from RRL and HeLa extract cross-link IRES fragments, it is possible that each extract forms aslightly different RNP. Assembly of the RRL RNP couldrequire p52, p57, p70, and p72, whereas assembly of the HeLaRNP could require p52, p57, p7O, and plOO. The possibilitythat different RNPs are formed with different extracts isconsistent with the observation that the translational efficien-cies of poliovirus mRNA and EMCV mRNA differ in HeLaextracts and in RRL (20, 36).

ACKNOWLEDGMENTS

We are indebted to C. Schultz-Witherell for technical assistance, A.Jacobson for help in computer-aided RNA folding, J. Dunn forproviding T7 RNA polymerase, and C. Helmke for photographic work.

This work was supported by National Institutes of Health GrantsAI-15122 and AI-32100 to E.W. and by National Institutes of HealthPostdoctoral Fellowship AI-08482 to G.W.W.

REFERENCES1. Bartel, D. P., M. L. Zapp, M. R. Green, and J. W. Szostak. 1991.

HIV-1 rev regulation involves recognition of non-Watson-Crickbase pairs in viral RNA. Cell 67:529-536.

2. Beckett, D., H. N. Wu, and 0. C. Uhlenbeck. 1988. Roles of

operator and non-operator RNA sequences in bacteriophage R17capsid assembly. J. Mol. Biol. 204:939-947.

3. Bhattacharyya, A., A. I. H. Murchie, and D. M. J. Lilley. 1990.RNA bulges and the helical periodicity of double stranded RNA.Nature (London) 343:484-487.

3a.Borman, A., M. T. Howell, J. G. Patton, and R. J. Jackson. 1993.The involvement of a spliceosome component in internal initiationof human rhinovirus RNA translation. J. Gen. Virol. 74:1775-1788.

4. Borovjagin, A. V., M. V. Ezrokhi, V. M. Rostapshov, T. Y. Ugarova,T. F. Bystrova, and I. N. Shatsky. 1991. RNA-protein interactionswithin the internal translation initiation region of encephalomyo-carditis virus RNA. Nucleic Acids Res. 19:4999-5105.

5. Brown, E. A., S. P. Day, R. W. Jansen, and S. M. Lemon. 1991. The5' nontranslated region of hepatitis A virus RNA: secondarystructure and elements required for translation in vitro. J. Virol.65:5828-5838.

6. Climie, S. C., and J. D. Friesen. 1987. Feedback regulation of therplJL-rpoBC ribosomal protein operon of Escherichia coli re-quires a region of mRNA secondary structure. J. Mol. Biol.198:371-381.

7. Dildine, S. L., and B. L. Semler. 1992. Conservation of RNA-protein interactions among picornaviruses. J. Virol. 66:4364-4376.

8. Dingwall, C., I. Ernberg, M. J. Gait, S. M. Green, S. Heaphy, J.Karn, A. D. Lowe, M. Singh, and M. A. Skinner. 1990. HIV-1 tatprotein stimulates transcription by binding to a U-rich bulge in thestem of the TAR RNA structure. EMBO J. 9:4145-4153.

9. Duke, G. M., M. A. Hoffman, and A. C. Palmenberg. 1992.Sequence and structural elements that contribute to efficientencephalomyocarditis virus RNA translation. J. Virol. 66:1602-1609.

10. Francoeur, A. M., and M. B. Mathews. 1982. Interaction betweenVA RNA and the lupus antigen La: formation of a ribonucleo-protein particle in vitro. Proc. Natl. Acad. Sci. USA 79:6772-6776.

11. Garcia-Blanco, M. A., S. F. Jamison, and P. A. Sharp. 1989.Identification and purification of a 62,000-dalton protein thatbinds specifically to the polypyrimidine tract of introns. GenesDev. 3:1874-1886.

12. Ghetti, A., S. Pinol-Roma, W. M. Michael, C. Morandi, and G.Dreyfuss. 1992. hnRNPI, the polypyrimidine tract-binding protein:distinct nuclear localization and association with hnRNAs. NucleicAcids Res. 20:3671-3678.

13. Gil, A., P. A. Sharp, S. F. Jamison, and M. A. Garcia-Blanco. 1991.Characterization of cDNAs encoding the polypyrimidine tract-binding protein. Genes Dev. 5:1224-1236.

14. Glickman, J. N., J. G. Howe, and J. A. Steitz. 1988. Structuralanalyses of EBER1 and EBER2 ribonucleoprotein particlespresent in Epstein-Barr virus-infected cells. J. Virol. 62:902-911.

15. Gottlieb, E., and J. A. Steitz. 1989. The RNA binding protein Lainfluences both the accuracy and the efficiency of RNA pol IIItranscription in vivo. EMBO J. 8:841-850.

15a.Hellen, C. U. T., T. V. Pestova, M. Litterst, and E. Wimmer. 1994.The cellular polypeptide p57 (pyrimidine tract-binding protein)binds to multiple sites in the poliovirus 5' nontranslated region. J.Virol. 68:941-950.

16. Hellen, C. U. T., G. W. Witherell, M. Schmid, S. H. Shin, T. V.Pestova, A. Gill, and E. Wimmer. 1992. pPTB and p57 areidentical RNA binding proteins involved in nuclear splicing andcytoplasmic translation. Proc. Natl. Acad. Sci. USA 90:7642-7646.

17. Jaeger, J. A., D. H. Turner, and M. Zuker. 1989. Improvedpredictions of secondary structures for RNA. Proc. Natl. Acad.Sci. USA 86:7706-7710.

18. Jaeger, J. A., D. H. Turner, and M. Zuker. 1990. Predictingoptimal and suboptimal secondary structures for RNA. MethodsEnzymol. 183:281-306.

19. Jang, S. K., M. V. Davies, R. J. Kaufman, and E. Wimmer. 1989.Initiation of protein synthesis by internal entry of ribosomes intothe 5' nontranslated region of encephalomyocarditis virus RNA invivo. J. Virol. 63:1651-1660.

20. Jang, S. K., H. G. Kriiusslich, M. J. H. Nicklin, G. M. Duke, A. C.Palmenberg, and E. Wimmer. 1988. A segment of the 5' nontrans-lated region of encephalomyocarditis virus RNA directs internal

VOL. 68, 1994


entry of ribosomes during in vitro translation. J. Virol. 62:2636-2643.

21. Jang, S. K., T. Pestova, C. U. T. Hellen, G. W. Witherell, and E.Wimmer. 1990. Cap-independent translation of picornavirusRNAs: structure and function of the internal ribosomal entry site.Enzyme 44:292-309.

22. Jang, S. K., and E. Wimmer. 1990. Cap-independent translation ofencephalomyocarditis virus RNA: structural elements of the inter-nal ribosomal entry site and involvement of a cellular 57-kDaRNA-binding protein. Genes Dev. 4:1560-1572.

22a.jang, S. K., and E. Wimmer. Unpublished data.23. Kuhn, R., N. Luz, and E. Beck. 1990. Functional analysis of the

internal translation initiation site of foot-and-mouth disease virus.J. Virol. 64:4625-4631.

24. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

25. Lamond, A. I., M. M. Konarska, P. J. Grabowski, and P. A. Sharp.1988. Spliceosome assembly involves the binding and release ofU4 small nuclear ribonucleoprotein. Proc. Natl. Acad. Sci. USA85:411-415.

26. Le, S.-Y., and M. Zuker. 1990. Common structures of the 5'non-coding RNA in enteroviruses and rhinoviruses. J. Mol. Biol.216:729-741.

26a.Litterst, M., and E. Wimmer. Unpublished data.27. Luz, N., and E. Beck. 1991. Interaction of a cellular 57-kilodalton

protein with the internal translation initiation site of foot-and-mouth disease virus. J. Virol. 65:6486-6494.

28. Macejak, D. G., and P. Sarnow. 1991. Internal initiation oftranslation mediated by the 5' leader of a cellular mRNA. Nature(London) 353:90-94.

29. Meerovitch, K., J. Pelletier, and N. Sonenberg. 1989. A cellularprotein that binds to the 5'-noncoding region of poliovirus RNA:implications for internal translation initiation. Genes Dev. 3:1026-1034.

30. Meerovitch, K., Y. V. Svitkin, H. S. Lee, F. Lejbkowicz, D. J.Kenan, E. K. L. Chan, V. I. Agol, J. D. Keene, and N. Sonenberg.1993. La autoantigen enhances and corrects aberrant translationof poliovirus RNA in reticulocyte lysate. J. Virol. 67:3798-3807.

31. Milligan, J. F., D. R. Groebe, G. W. Witherell, and 0. C.Uhlenbeck. 1987. Oligoribonucleotide synthesis using T7 RNApolymerase and synthetic DNA templates. Nucleic Acids Res.15:8783-8798.

32. Milligan, J. F., and 0. C. Uhlenbeclk 1989. Determination ofRNA-protein contacts using thiophosphate substitutions. Bio-chemistry 28:2849-2855.

33. Molla, A., S. K. Jang, A. V. Paul, Q. Reuer, and E. Wimmer. 1992.Cardioviral internal ribosomal entry site is functional in a geneti-cally engineered dicistronic poliovirus. Nature (London) 356:255-257.

34. Molla, A., A. V. Paul, and E. Wimmer. 1991. Cell-free, de nova

synthesis of poliovirus. Science 254:1647-1651.35. Mulligan, G. J., W. Guo, S. Wormsley, and D. M. Helfman. 1992.

Polypyrimidine tract binding protein interacts with sequences

involved in alternative splicing of 3-tropomyosin pre-mRNA. J.Biol. Chem. 267:25480-25487.

36. Nicklin, M. J. H., H. G. Krausslich, H. Toyoda, J. J. Dunn, and E.Wimmer. 1987. Poliovirus polypeptide precursors: expression invitro and processing by exogenous 3C and 2A proteinases. Proc.Natl. Acad. Sci. USA 84:4002-4006.

37. Pace, N. R. 1984. Protein-polynucleotide recognition and the RNAprocessing nucleases in prokaryotes, p. 1-34. In D. Apirion (ed.),Processing of RNA. CRC Press, Boca Raton, Fla.

38. Patton, J. G., S. A. Mayer, P. Tempst, and B. Nadal-Ginard. 1991.Characterization and molecular cloning of polypyrimidine tract-binding protein: a component of a complex necessary for pre-

mRNA splicing. Genes Dev. 5:1237-1251.39. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of trans-

lation of eukaryotic mRNA directed by a sequence derived frompoliovirus RNA. Nature (London) 334:320-325.

40. Pelletier, J., and N. Sonenberg. 1989. Internal binding of eucary-

otic ribosomes on poliovirus RNA: translation in HeLa cell

extracts. J. Virol. 63:441-444.41. Pestova, T. V., C. U. T. Hellen, and E. Wimmer. 1991. Translation

of poliovirus RNA: role of an essential cis-acting oligopyrimidineelement within the 5' nontranslated region and involvement of acellular 57-kilodalton protein. J. Virol. 65:6194-6204.

42. Pilipenko, E. V., V. M. Blinov, B. K. Chernov, T. M. Dmitrieva,and V. I. Agol. 1989. Conservation of the secondary structureelements of the 5'-untranslated region of cardio- and aphthovirusRNAs. Nucleic Acids Res. 17:5701-5711.

43. Pilipenko, E. V., V. M. Blinov, L. I. Romanova, A. N. Sinyakov,S. V. Maslova, and V. I. Agol. 1989. Conserved structural domainsin the 5'-untranslated region of picornaviral genomes: an analysisof the segment controlling translation and neurovirulence. Virol-ogy 168:201-209.

44. Pilipenko, E. V., A. P. Gmyl, S. V. Masiova, Y. V. Svitkin, A. N.Sinyakov, and V. I. Agol. 1992. Prokaryotic-like cis elements in thecap-independent internal initiation of translation on picornavirusRNA. Cell 68:1-20.

45. Raleigh, E. A., N. E. Murray, H. Revel, R. M. Blumenthal, D.Westaway, A. D. Reith, P. W. J. Rigby, J. Elhai, and D. Hanahan.1988. McrA and McrB restriction phenotype of some E. colistrains and implications for gene cloning. Nucleic Acids Res.16:1563-1575.

46. Reddy, R., D. Henning, E. Tan, and H. Busch. 1983. Identificationof a La Protein Binding Site in a RNA polymerase III transcript(4.5 I RNA). J. Biol. Chem. 258:8352-8356.

47. Rice, J. A., and D. M. Crothers. 1989. DNA bending by the bulgedefect. Biochemistry. 28:4512-4516.

48. Roy, S., U. Delling, C. H. Chen, C. A. Rosen, and N. Sonenberg.1990. A bulge structure in HIV-1 TAR RNA is required for tatbinding and tat-mediated trans-activation. Genes Dev. 4:1365-1373.

49. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-ratory, Cold Spring Harbor, N.Y.

50. Sampson, J. R., and 0. C. UhlenbeckL 1988. Biochemical andphysical characterization of an unmodified yeast phenylalaninetransfer RNA transcribed in vitro. Proc. Natl. Acad. Sci. USA85:1033-1037.

51. Schimmel, P. 1989. Parameters for the molecular recognition oftransfer RNAs. Biochemistry 28:2747-2759.

51a.Schmidt, M., and E. Wimmer. Unpublished data.52. Tang, R. X., and D. E. Draper. 1990. Bulge loops used to measure

the helical twist of RNA in solution. Biochemistry 29:5232-5237.53. Tsukiyama-Kohara, K., N. lizuka, M. Kohara, and A. Nomoto.

1992. Internal ribosome entry site within hepatitis C virus RNA. J.Virol. 66:1476-1483.

54. Weeks, K. M., C. Ampe, S. C. Schultz, T. A. Steitz, and D. M.Crothers. 1990. Fragments of the HIV-1 tat protein specificallybind TAR RNA. Science 249:1281-1285.

55. Weeks, K. M., and D. M. Crothers. 1991. RNA recognition bytat-derived peptides: interaction in the major groove? Cell 66:577-588.

56. White, S. A., and D. E. Draper. 1989. Effects of single-base bulgeson intercalator binding to small RNA and DNA hairpins and aribosomal RNA fragment. Biochemistry 28:1892-1897.

57. Witherell, G. W., A. Gil, and E. Wimmer. 1993. Interaction ofpolypyrimidine tract binding protein and encephalomyocarditisvirus internal ribosomal entry site. Biochemistry 32:8268-8275.

58. Witherell, G. W., H. N. Wu, and 0. C. Uhlenbeck. 1990. Cooper-ative binding of R17 coat protein to RNA. Biochemistry 29:11052-11057.

59. Woodson, S. A., and D. M. Crothers. 1988. Structural model for anoligonucleotide containing a bulged guanosine by NMR andenergy minimization. Biochemistry 27:3130-3141.

60. Woodson, S. A., and D. M. Crothers. 1989. Conformation of abulge containing oligomer from a hot spot sequence by NMR andenergy minimization. Biopolymers 28:1149-1177.

61. Wu, H. N., and 0. C. Uhlenbeck 1987. Role of a bulged A residuein a specific RNA-protein interaction. Biochemistry 26:8221-8227.

62. Zuker, M. 1989. On finding all suboptimal foldings of an RNAmolecule. Science 244:48-52.

J. VIROL.

encephalomyocarditis virus internal ribosomal entry site rna

Documents