enzymatic mechanism of human apurinic/apyrimidinic endonuclease against a thf ap site model...

Download Enzymatic Mechanism of Human Apurinic/Apyrimidinic Endonuclease against a THF AP Site Model Substrate
               †

Post on 01-Feb-2017

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • Enzymatic Mechanism of Human Apurinic/Apyrimidinic Endonuclease against aTHF AP Site Model Substrate

    Sophia T. Mundle, James C. Delaney, John M. Essigmann, and Phyllis R. Strauss*,

    Department of Biology, Northeastern UniVersity, Boston, Massachusetts 02115, and Departments of Biological Engineering andChemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

    ReceiVed August 26, 2008; ReVised Manuscript ReceiVed NoVember 10, 2008

    ABSTRACT: The endonucleolytic activity of human apurinic/apyrimidinic endonuclease (AP endo) is amajor factor in the maintenance of the integrity of the human genome. There are estimates that this enzymeis responsible for eliminating as many as 105 potentially mutagenic and genotoxic lesions from the genomeof each cell every day. Furthermore, inhibition of AP endonuclease may be effective in decreasing thedose requirements of chemotherapeutics used in the treatment of cancer as well as other diseases. Therefore,it is essential to accurately and directly characterize the enzymatic mechanism of AP endo. Here wedescribe specifically designed double-stranded DNA oligomers containing tetrahydrofuran (THF) with a5-phosphorothioate linkage as the abasic site substrate. Using H218O during the cleavage reaction andleveraging the stereochemical preferences of AP endo and T4 DNA ligase for phosphorothioate substrates,we show that AP endo acts by a one-step associative phosphoryl transfer mechanism on a THF-containingsubstrate.

    Human apurinic/apyrimidinic endonuclease (AP endo,1

    HAP1, Apex, Ref1) is a DNA base excision repair enzymewith a wide variety of functions, including AP endonuclease[cleaving an AP site 5 to a deoxyribose phosphate (dRP)moiety], 3 exonuclease, 3 phosphodiesterase, 3 phos-phatase, RNaseH, and 5 endonuclease activities (reviewedin refs 1 and 2). The characterization of the human enzymeoccurred several years after the Escherichia coli functionalhomologue (ExoIII) was found to have AP endonucleaseactivity (3-10). In addition to the wide variety of functions,mammalian AP endo has been shown to act on many typesof DNA substrate molecules but demonstrates the most robustactivity when acting as a class II AP endonuclease. Theturnover number for 5 cleavage of a reduced AP site is 10s-1 (11), even faster than the highly effective DNA repairenzyme uracil DNA glycosylase (UDG), which has aturnover number for uracil excision of 5 s-1 (12).

    A variety of AP site analogues have been tested in probingthe 5 AP site nicking activity of AP endo (11, 13-15). Ofparticular interest here is the fact that replacement of anonbridging phosphorus oxygen 5 to the AP site with sulfurhas major consequences on enzymatic activity. In 1995,Wilson et al. showed that incision activity on the Sp isomerof a phosphorothioate by the human AP endo is 10000-fold

    reduced while incision on the Rp isomer is only 20-foldreduced (14). Therefore, in a mixture of Sp and Rp stereoi-somers of AP endo substrate, the enzyme will have a vastpreference for cleavage of the Rp stereoisomer.

    We recently proposed a two-step enzymatic mechanismin which Tyr171 acts directly as the attacking nucleophile (16).One way to evaluate this proposal involves use of substrateDNA containing a phosphorothioate linkage. Phosphorothio-ate RNA and DNA have been used in a wide variety ofapplications [reviewed by Summerton (17)], including RNA-mediated interference (RNAi) (18) and as drugs targetedtoward specific pathogenic proteins, as in the case of themalarial topoisomerase II (19). By far, the most specific useof phosphorothioate oligonucleotides has been in the inves-tigationofthestereochemicalcourseofenzymaticreactions(20-23).

    DNA cleavage reactions performed on phosphorothioateDNA in the presence of H218O generate product DNA witha 5 terminal chiral thiophosphate (21). The chirality of theproduct DNA is dependent on both the stereochemistry ofthe starting material (Sp or Rp) and the nature of the enzymaticreaction (one-step reaction with inversion of configurationof the scissile phosphate or two-step reaction, which occurswith no net inversion of configuration). Product DNAgenerated in this manner can then be configurationallydefined using the well-documented stereochemistry of theT4 DNA ligase reaction, through which the pro-R oxygenfrom the 5 terminal thiophosphate donor is always lost toAMP during the course of the ligase reaction (21) (Figure1). Knowing that T4 DNA ligase is able to ligate DNAefficiently when a 5 dRP group is present at the terminusof the donor DNA (24) enabled us to follow the fate of 18Oafter AP endo cleavage of the Rp stereoisomer of substrateDNA, and subsequent ligation of the product DNA with apartner oligonucleotide. We could thus discriminate between

    Supported by National Institutes of Health Grant CA 72702 (toP.R.S.) and NIH Grant CA80024 and NIEHS Grant P30 ES002109(to J.M.E.).

    * To whom correspondence should be addressed. Telephone: (617)373-3492. Fax: (617) 373-2138. E-mail: p.strauss@neu.edu.

    Northeastern University. Massachusetts Institute of Technology.1 Abbreviations: AP endo, apurinic/apyrimidinic endonuclease; AP,

    abasic; BER, base excision repair; dRP, deoxyribose phosphate; ESI-TOF MS, electrospray ionization time-of-flight mass spectrometry; THF,tetrahydrofuran.

    Biochemistry 2009, 48, 1926 19

    10.1021/bi8016137 CCC: $40.75 2009 American Chemical SocietyPublished on Web 12/10/2008

  • a one-step (Figure 1A) and a two-step (Figure 1B) hydrolyticmechanism.

    EXPERIMENTAL PROCEDURES

    Three oligonucleotides were designed such that the APendo reaction site or ligation site was flanked by HaeIIIrestriction sites (underlined). The tetrahydrofuran AP siteanalogue containing a 5 phosphorothioate linkage is repre-sented by sF, while the analogous phosphodiester control isabbreviated as pF: STM5, 5 CCATGCCTGCACGAsFTG-GCCGAATTCTTC 3; STM6, 5 GAAGAATTCGGC-CAGTCGTGCAGGCATGG 3; and STM7, 5 GAAGAAT-TCGGCCAGAGGCCAAGAGCGCGCTTTTGCGCGCTCTTGGCCT3.

    These oligomers were synthesized Trityl-OFF by GeneLink(Hawthorne, NY). DNA oligonucleotide STM5 was gener-ated by automated DNA synthesis (Expedite 8909 DNASynthesizer, PerSeptive Biosystems, Inc., Framingham, MA)and standard phosphoramidite chemistry. The phosphorothio-ate linkage was introduced using the Beaucage (25) sulfu-rizing reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide) (GlenResearch, Sterling, VA), which yields 96% phosphorothio-

    ate linkages. The stable AP site (THF, F) was introducedinto the DNA oligomer using dSpacer CE phosphoramidite{5-O-dimethoxytrityl-1,2-dideoxyribose-3-[(2-cyanoeth-yl)(N,N-diisopropyl)]phosphoramidite} (Glen Research). At-tempts to resolve the Sp and Rp diastereomers by HPLC usingreversed-phase columns and the many conditions describedby Subach et al. (26) for our sequences were unsuccessful.Therefore, the AP endo reaction was performed on a mixtureof diastereomers. DNA samples were PAGE-purified froman 18% preparative gel. All oligomers were greater than 95%pure as determined by 5 32P end labeling with polynucleotidekinase (New England Biolabs, Beverly, MA), resolution onan 18% denaturing polyacrylamide gel, and PhosphorImageranalysis. After PAGE purification, desalted oligomers weredissolved in either sterile H2O or sterile H218O (CambridgeIsotope Laboratories, Inc., Cambridge, MA). The subsequentenzymatic reactions were performed in either 100% H2O orH218O (at 96% isotopic abundance).

    The overall experimental scheme is depicted in Figure 2.The substrate for the AP endo reaction was generated byannealing STM5 and STM6 in equimolar quantities (finalDNA concentration of 4 M). This was accomplished by

    FIGURE 1: Stereochemical course of the reactions described in the text. Panel A shows the fate of 18O (b) in a one-step hydrolytic mechanism.Panel B shows the fate of 18O (b) in a two-step hydrolytic mechanism. Since it is known that AP endonuclease appreciably cleaves onlythe Rp diastereomer, the reaction is depicted using the Rp stereoisomer as the starting material. In a one-step hydrolysis, 18O is transferredto the pro-R oxygen of the cleaved oligomer product but is then lost to AMP during the stereospecific T4 DNA ligase reaction (58). In atwo-step hydrolysis, the heavy oxygen is transferred to the pro-S oxygen of the cleaved product DNA and is retained during the stereospecificT4 DNA ligase reaction. Bond order and charge about the phosphorus were omitted for the sake of stereochemical clarity.

    20 Biochemistry, Vol. 48, No. 1, 2009 Mundle et al.

  • heating the mixture to 70 C and allowing it to cool slowlyto room temperature in either H2O or H218O. The mixturefor the AP endo reaction, performed in a total volume of800 L, contained 750 nM double-stranded substrate DNAand 100 nM AP endo in 50 mM Hepes/NaOH (pH 7.5), 0.1mM EDTA, 65 mM NaCl, 10% glycerol, and 5 mM MgCl2.Initially, a time course (0-3 h) was performed using a totalreaction volume of 5 L and 5 32P end-labeled substrateDNA, which determined that 3 h was an appropriate endpoint for the reaction (Figure 3). Reaction mixtures wereincubated for 3 h at 22 C, and then reactions were terminatedby addition of EDTA to a final concentration of 100 mM.The reaction mixture was desalted using illustra MicroSpinG-25 columns (GE Healthcare, Buckinghamshire, U.K.),phenol-extracted, and ethanol-precipitated in the presence of0.3 M sodium acetate. To ensure that 18O was incorporatedinto the reaction product, a sample was analyzed by massspectrometry as described in Results.

    Following processing of the AP endo reaction product,all subsequent steps were performed in sterile, nonisotopi-cally enriched H2O. Ligation reactions were performed in atotal volume of 100 L. Eight thousand picomoles (8-fold

    molar ratio) STM7 hairpin DNA was mixed with the APendo reaction product. The DNA mixture was heated to