epigene’cand transcriptome)analysis)of)the)switchgrass ...epigene’cand...
TRANSCRIPT
Epigene'c and Transcriptome Analysis of the Switchgrass (Panicum virgatum) – Anthracnose (Colletotrichum navitas) Interac'on
Deidrhe Clayton1,4, Elizabeth Fiedler2, Vasudevan Ayyappan2, Venu (Kal) Kalavacharla2,3
1Department of Biological Sciences, University of Southern California, Los Angeles, CA 90089
2Molecular GeneBcs and EpiGenomics Laboratory, Delaware State University, Dover, DE 19901 3Center for Integrated Biological and Environmental Research (CIBER), Delaware State University, Dover, DE 19901
4Northeast Woody/Warm-‐season Biomass ConsorBum (NEWBio), Delaware State University, Dover, DE 19901
In the U.S. the rising demand for sustainable renewable energy has led to the development of a variety of bioenergy feedstocks. Currently, switchgrass is being reviewed as an energy crop for its poten'al use as a biofuel. The development of switchgrass as a leading bioenergy feedstock will require the successful propaga'on of the crop in both favorable and adverse condi'ons, including exposure to disease. Recent outbreaks of anthracnose, caused by Colletotrichum navitas, poses a threat to the crop's energy produc'on poten'al. Developing methods to improve disease resistance in switchgrass is impera've to increasing the crop's yield and overall poten'al as an energy producing crop. Understanding switchgrass genes involved in anthracnose resistance may be useful in the long-‐term. In this project we intend to use the epigene'c markers H3K9me2 and H4K12ac as tools in iden'fying genes within switchgrass that render the plant suscep'ble or resistant to C.navitas. More specifically, we will iden'fy differences in epigene'c modifica'ons between infected and uninfected plants of the AP13 and VS16 switchgrass genotypes. Having mastered techniques used in the iden'fica'on of these epigene'c modifica'ons within the common bean genotypes and fungal rust infected common bean (an ongoing project within our lab), we hope to iden'fy these markers -‐ and their associated genes -‐ within the aforemen'oned genotypes. Determina'on of these genes may serve as a pla[orm to develop anthracnose-‐resistant switchgrass genotypes.
ABSTRACT
INTRODUCTION
OBJECTIVES
LABORATORY TECHNIQUES CONT.
RESULTS
DISCUSSION
CONCLUSION AND FUTURE DIRECTIONS
REFERENCES
ACKNOWLEDGMENTS This study was supported in part by the Northeast Woody/Warm-‐season Biomass Consor'um (NEWBio), funded by the Na'onal Ins'tute of Food and Agriculture (NIFA) and the Center for Integrated Biological and Environment Research (CIBER) at DSU. I would also like to personally thank the MGE Lab and each of the staff, graduate and undergraduate students that have helped me throughout my research efforts this summer.
McLaughlin, S.B., and L.A. Kszos, Development of switchgrass (Pancium virgatum) as a bioenergy feedstock in the United States. Biomass and Bioenergy, 2005. 28: p. 515-‐535. Crouch, J., Beirn, L.A., et al., Anthracnose disease of switchgrass caused by the novel fungal species Colletrtrichum navitas. Mycological Research, 2009. 113: p. 1411-‐1421. Wang, Z., Gerstein, M., and M. Snyder, RNA-‐Seq: a revolu'onary tool for transcriptomics. Nature Review Gene'cs, 2009. 10(1): p. 57-‐63.
In this project we intend to iden'fy differences in epigene'c modifica'ons between anthracnose infected and uninfected switchgrass. The epigene'c markers that we are searching for include the histone modifica'ons H3K9me2 and H4K12ac. The histone modifica'on H3K9me2 consists of dimethyla'on of lysine 9 on histone core H3. This modifica'on is commonly found in heterochroma'n and is associated with repression of gene expression. The histone modifica'on H4K12ac consists of acetlya'on of lysine 12 on histone core H4. Addi'on of an acetyl group to posi'vely charged lysine neutralizes electrosta'c alrac'on between the histone protein and the DNA molecule. This neutraliza'on causes the DNA to unwind and enter into a euchroma'n state of which DNA is ac'vely transcribed (ac'va'on of gene expression). Epigene'c modifica'ons have the ability to alter the flow of gene'c informa'on and by using the histone modifiers H3K9me2 and H4K12ac as epigene'c markers, we will be able to trace gene expression palerns within anthracnose infected and uninfected switchgrass. Furthermore, iden'fica'on of these genes involved in the switchgrass – anthracnose interac'on may be useful in the development of anthracnose resistant plants.
LABORATORY TECHNIQUES
• Develop a fungal infected and uninfected catalog (or library) of epigene'c modifica'ons present within switchgrass.
• Iden'fy the epigene'c markers H3K9me2 and H4K12ac and their associated DNA sequences within anthracnose infected and uninfected switchgrass.
Used to profile DNA binding proteins and their respec've DNA sequences Dot blot prior to ChIP: iden'fica'on of proteins present • Step 1: Lyse cells and fragment DNA and associated proteins • Step 2: Spot sample onto dot blot membrane • Step 3: Assay dots with H3K9me2 and H4K12ac an'bodies • Step 4: Confirm presence of H3K9me2 or H4K12ac ChIP • Step 1: Lyse cells and fragment DNA and associated proteins • Step 2: Probe DNA and associated proteins with H3K9me2 and
H4K12ac an'bodies • Step 3: Incubate samples with magne'c beads and perform
several washes to reverse DNA and protein/an'body cross-‐link • Step 4: Purify isolated DNA
Chroma'n Immunoprecipita'on (ChIP)
Polymerase Chain Reac'on (PCR)
Used to amplify DNA isolated from ChIP protocol. • Step 1: DNA
denatura'on • Step 2: Primers
anneal with target DNA sequence
• Step 3: Extension Primer List:
Figure 1. ChIP-‐seq protocol (Google images)
Figure 1. PCR protocol (Google images)
Name Descrip'on Primer Sequence Product Size (bp)
AP13CTG11779 Protein involved in Chr segrega8on
F-‐AAGAGTTGAGGAAGCGCCAA R-‐ATGGATCCTGCTTATGGCCG
140
AP13ISTG58107 Heat stress transcrip8on factor
F-‐AGCTCGCTAGCTAGGCTTTG R-‐TTCGATTCATCCATGCACGC
141
AP13CTG62773 Trans Ini8 factor TFIID F-‐TTGTGGAGCACTACCTCGGA R-‐TACTACCCTGGCCTTGCAGT
137
Kan1CTG35354 Biosyn sec metabolites F-‐GGACGTGTCATCGTCAGACA R-‐TTGACCACAGCTCACCACAA
107
Kan1SGLT49941 Plant-‐pathogen interac8on
F-‐GCAATAGGGGTGGCAACAATG R-‐GAAAACCGCACAGAAGGCAA
101
Kan1CTG33578 Plant transposon protein
F-‐CACGATTGTGGAAGCGCAAG R-‐GTCAACATGGATGGTCGCCT
107
Kan1SGLT51359 Mem transporter protein
F-‐CCATGATCCTGGCCTACGG R-‐GTTCATGACGTAGGGGTTGC
146
Kan1CTG05612 Puta8ve methyl transferase
F-‐ACGCTCTTGACCTTCACCAG R-‐GGATTCGGTGTTCACCCTGT
135
Kan1SGLT53307 Plant mobile domain 9transposons)
F-‐CGTGCAAAGGACAAACGGAG R-‐TGTTTCGACCCAGGTGACAG
149
AP13CTG24496 Response during disease
F-‐CGATGCTCTGCAGTTTCGTG R-‐ATGCTGATGCGATCAAAGCAC
99
Table 1. List of primers used for PCR
• DNA probed with H3K9me2 an'body, H4K12ac an'body, and with no an'body was successfully amplified using primer set 1 (see figure 3). • This test was used to show that each of the DNA
types (used with an'body probe or with no probe) could be amplified.
• Primer sets 1-‐2 and 4-‐10 successfully amplified input DNA (see figure 4). • This test was used to show that each of the 10
primer sets could be used to amplify isolated switchgrass ChIP DNA.
• Primer set 3 was unsuccessful in its amplifica'on of input DNA.
• Now that we have verified switchgrass DNA amplifica'on using the described primers, we can send samples for DNA sequencing.
• Developing reference and fungal infected switchgrass epigenomes will help us to reveal differences in gene expression pathways between anthracnose infected and uninfected switchgrass hosts.
• Understanding these gene expression pathways can provide a basis for developing switchgrass species that are gene'cally resistant to Colletotrichum navitas.
• Gene'cally resistant switchgrass would further increase switchgrass’s poten'al as a bioenergy crop.
Next steps using AP13 and VS16 genotypes: • Perform ChIP on fungal infected and uninfected AP13
and VS16 genotypes. • Verify the presence of the H3K9me2 and H4K12ac
epigene'c modifica'ons within the AP13 and VS16 genotypes.
• Amplify isolated ChIP DNA of the AP13 and VS16 genotypes and send for sequencing.
Figure 3. PCR Analysis: H3, H4, and Input DNA with 11779 primer set
Figure 4. PCR Analysis: Input DNA with 10 different primer sets
PCR Product Analysis
Key: Primer 1 -‐ 11779 Primer 2 -‐ 58107 Primer 3 -‐ 62773 Primer 4 -‐ 35354 Primer 5 -‐ 49941 Primer 6 -‐ 33578 Primer 7 -‐ 51359 Primer 8 -‐ 05612 Primer 9 -‐ 53307 Primer 10 -‐ 24496
Key: (IP) Input – Switchgrass DNA with no probe H3 – Switchgrass DNA with H3K9me2 probe H4 – Switchgrass DNA with H4K12ac probe (+) -‐ Posi've control (Wheat DNA with ac'n primer) (-‐) – Nega've control (Ac'n primer with no DNA)
+
H3-‐1 w/Primer 1
H3-‐2 w/Primer 1
H4-‐1 w/Primer 1
H4-‐2 w/Primer 1
H4-‐3 w/Primer 1
IP-‐1 w/Primer 1
IP-‐2 w/Primer 1
IP-‐3 w/Primer 1
-‐
+
-‐ IP-‐1 w/Primer 1
IP-‐1 w/Primer 2
IP-‐1 w/Primer 3
IP-‐1 w/Primer 4
IP-‐1 w/Primer 5
IP-‐1 w/Primer 6
IP-‐1 w/Primer 7
IP-‐1 w/Primer 8
IP-‐1 w/Primer 9
IP-‐1 w/Primer 10
Ladder
Ladder