79

Molecular and Cellular Biochemistry 194: 79–91, 1999.© 1999 Kluwer Academic Publishers. Printed in the Netherlands.

Epigenetic inhibition of lysyl oxidase transcriptionafter transformation by ras oncogene

Sara Contente, Kaylene Kenyon, Priya Sriraman, Savitri Subramanyanand Robert M. FriedmanDepartment of Pathology, Uniformed Services University of the Health Sciences, Bethesda, Maryland, USA

Received 16 January 1998; accepted 23 April 1998

Abstract

Lysyl oxidase is an extracellular enzyme involved in connective tissue maturation that also acts as a phenotypic suppressor ofthe ras oncogene. To understand how this suppressor is controlled, gene transcription was studied and the promoter wascharacterized. Nuclear runoff transcription assays indicated that the markedly reduced amounts of lysyl oxidase message detectedafter ras transformation resulted from inhibition of lysyl oxidase transcription. Interferon-mediated phenotypic reversion ofras transformed cells, in which the ras oncogene continued to be expressed, was accompanied by the restoration of lysyl oxidasetranscription. Reporter gene assay of a transfected mouse lysyl oxidase promoter indicated that it was active in the transformedbackground, despite the silencing of the endogenous lysyl oxidase promoter. The detection of comparable amounts of mRNAfor transcription factors IRF-1 and IRF-2 in normal and ras-transformed cell lines suggests that the differential transcription oflysyl oxidase was not due to regulation of IRFs. Lysyl oxidase promoter activity was localized to a 126 bp region that includestwo consensus TATA boxes with associated confirmed cap signals. Analysis of a human lysyl oxidase promoter sequenceindicated similar promoter elements and extensive sequence identity with the mouse promoter. The binding of transcriptionfactor AP2 to sites predicted in the control region was confirmed by DNase footprinting. Lysyl oxidase transcription wasstimulated by dexamethasone treatment of cells, but this effect could not be assigned within the ~3 kb region tested in reportergene constructs. The promoter activity of the lysyl oxidase reporter gene construct was completely abolished by in vitro DNAmethylation, suggesting that the transcriptional suppression after transformation by the ras oncogene may involve DNAmethylation. (Mol Cell Biochem 194: 79–91, 1999)

Key words: lysyl oxidase, ras, tumor suppressor, transcription, methylation

Present address: P. Sriraman, Waksman Institute, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854-8010 USA.Address for offprints: S. Contente, Department of Pathology, USUHS, 4301 Jones Bridge Road, Bethesda, MD 20814-4799 USA

Introduction

Lysyl oxidase was identified as a phenotypic suppressor of theras oncogene [1, 2] in mouse cells during studies of thedifferential gene expression between NIH 3T3 cells trans-formed by LTR-c-H-ras, and an interferonβ-induced, persistentrevertant clonal line of those cells [3–5]. This persistentrevertant (PR4) remained morphologically normal and non-tumorigenic after interferonβ treatment ceased, despite theresumption of ras overexpression. Lysyl oxidase messagewas abundant in parental NIH 3T3 cells and in the persistent

revertant, but steady-state message was barely detected in theras-transformed line. Introduction of an antisense lysyloxidase expression construct into the revertant resulted inretransformation [1], indicating that lysyl oxidase plays asignificant role in maintenance of the non-transformed stateof the revertant. Lysyl oxidase is an extracellular, copper-dependent enzyme that catalyzes the oxidative deaminationof lysine residues in collagen and elastin. Spontaneouscondensation of the aldehydes formed in this reaction convertsoluble monomers of collagen or elastin into the cross linked,insoluble fibers characteristic of mature connective tissue [6].

80

Lysyl oxidase activity is crucial for the formation andmaintenance of the extracellular matrix. The pattern of lossof lysyl oxidase expression after ras transformation andrestoration after reversion was also found in azatyrosine-induced revertants [7], in spontaneous revertants of EJras-transformed rat fibroblasts [8], in EJ ras-transformed ratfibroblasts reverted by transfer of a human gene [9, 10], andin EJ ras-transformed mouse fibroblasts reverted by treatmentwith interferon γ [10, 11].

The mechanism by which lysyl oxidase suppresses thetransforming effect of the ras oncogene is not known. Tounderstand how cellular transformation of NIH 3T3 byhuman c-H-ras results in decreased amounts of lysyl oxidasemessage, we examined the transcriptional activity of thegene after cellular transformation by ras and after reversionby interferonβ, and analyzed the predicted promoter region[12], as well as sequences further upstream. Lysyl oxidasewas recently identified as a target gene of transcription factorIRF- 1, and its role as a tumor suppressor in ras-transformedcells was confirmed [13]. Since IRF-1 expression modulatedlysyl oxidase expression, the contribution of IRF-1 and IRF-2to the control of lysyl oxidase expression in this system wasalso examined. Gene expression also can be modulated byDNA methylation. The inactivation of several tumor sup-pressor genes has been shown to be a result of methylationof CpG dinucleotides in normally unmethylated transcriptioncontrol regions [14–19]. The present work indicates that thelysyl oxidase promoter may be regulated by hypermethylationin oncogene-transformed cells.

Material and methods

Plasmid construction

An 888 bp Hind III - Ava I fragment derived from mousegenomic clone L11 [12], which contained the putative lysyloxidase promoter region, was subcloned into pCatBasic(Promega) as follows. A 1.6 kb Hind III fragment of plasmidsubclone p11-5.4 was subcloned into pCatBasic and theresulting clone restricted at Ava I sites (present in the lysyloxidase gene) and at a Sal I site (present in the vector). Thisremoved sequences containing the lysyl oxidase start codonand exonic sequences downstream. The remaining 5.2 kblinear plasmid fragment was isolated on a gel, protruding5′ termini were filled, and the molecule self-ligated to generatepB1S. The filled-in Ava I and Sal I ends recreated a Sal I siteupon ligation. pGKM1 was constructed by re-cloning the 888bp Hind III - Sal I fragment of pB1S into vector pGKOCAT[20] to take advantage of additional restriction sites in thatvector. Unique restriction enzyme sites within the promoterfragment and vector were utilized to create promoter con-structs shortened from either end. The 2 kb Hind III fragment

immediately 5′ of the putative promoter region in genomicclone L11 was inserted into the unique Hind III site in pB1S,in both orientations, to study the contribution of this regionto transcription control. This fragment was also cloned intopCatBasic and pCatPromoter vectors (Promega) .

Cell culture and DNA transfection

NIH 3T3 is a Swiss mouse fibroblast cell line; the subcloneused here is non-tumorigenic and displays a flat morphology.RS485 is a ras-transformed, tumorigenic line [21] derived bytransfection of that NIH 3T3 subclone with LTR-linkedc-H-ras. These two cell lines were originally obtained fromDr. Esther Chang and Dr. Douglas Lowy. PR4 is a non-tumorigenic, phenotypic revertant of RS485 that was isolatedafter long term treatment with interferonβ [3, 4]. The PR4revertant does not require the addition of interferon to remainreverted, and this cell line expresses the transfected rasmRNA and protein at levels comparable to those observedin RS485. Cells were grown in Dulbecco’s modified Eagle’smedium with 4.5 g/L glucose, 10% bovine calf serum(Hazelton), 2 mM glutamine at 37°C, 5% CO

2. Dexametha-

sone (Sigma) was added to the culture medium at 1 µM whenrequired. For transient transfection, 3–4 × 105 cells wereplated in a 60 mm dish and incubated 18 h at 37°C, 5% CO

2.

Three µg of a CAT reporter construct mixed with 3 µg ofpSVβgal (Promega) were transfected using 25 µl of Lipo-fectin (Life Technologies), or 30 µl of SuperFect (Qiagen)according to the manufacturer’s instructions. Complexeswere removed after 5 or 3 h, and the cells re-fed. Cell extractswere prepared at 48 h after transfection by scraping cell layerswashed twice with phosphate-buffered saline (PBS) into 1 mlof PBS. Pelleted cells were resuspended in 150 µl of 0.25 MTris-HCl, pH 8.0, and subjected to three cycles of freezingin dry ice, quick thawing at 37°C, and vortexing. The extractwas centrifuged for 10 min, and 60 µl removed for β-galactosidase assay. The remainder of the extract was heatedat 60°C for 10 min to inactivate endogenous acetylase, andcentrifuged an additional 10 min. The supernatant wastransferred to a fresh tube and stored at –80°C if not usedimmediately for CAT assay.

Reporter gene assays

β-galactosidase activity was assayed by incubating 30 µlextract diluted to 50 µl with 0.25 M Tris-HCl, pH 8.0, and50 µl 2× assay buffer (200 mM sodium phosphate, pH 7.3, 2mM MgCl

2, 100 mM β-mercaptoethanol, 1.33 mg/ml o-

nitrophenyl-β-D-galactopyranoside) in a 96 well microtiterplate for 15–30 min at 37°C. Reactions were stopped with150 µl of 1 M sodium carbonate, and the OD

414 determined

81

using a TiterTek Multiskan plate reader (Flow Laboratories).CAT activity was determined by incubating 30 µl extract with0.1 µCi 14C-chloramphenicol (DuPont/NEN) and 25 µgn-butyryl coenzyme A (Sigma) in a total volume of 125 µlfor 2 h at 37°C. Butyrylated chloramphenicol was thenextracted with 0.5 ml ethyl acetate, evaporated to dryness, andresuspended in 30 µl ethyl acetate. Ten µl of each extractionwas applied to a silica gel thin layer chromatography (TLC)plate (Baker). TLC plates were developed in 95% chloroform,5% methanol and imaged and quantitated using an Instant-Imager (Packard). CAT activity levels were normalized toβ-galactoside activity to account for differences in trans-fection efficiency. Transformations were performed induplicate or triplicate, with at least one repeat. Cell extractswere assayed in duplicate and averaged.

Nuclear runoff transcription

Nuclei were isolated after Nonidet P-40 lysis of cells asdescribed [22] and counted using a hemocytometer. Equalnumbers of nuclei in 90 µl of glycerol storage buffer (50 mMTris-HCl, pH 8.3, 5 mM MgCl

2, 0.1 mM EDTA) in a 1.5 ml

microcentrifuge tube were mixed with 10 µl of 32P-UTP (3000Ci/mmol, DuPont/NEN) and 100 µl of 2 × transcription mix(10 mM Tris-HCl, pH 8.0, 5 mM MgCl

2, 0.3 M KCl, 1 mM

ATP, 1 mM CTP, 1 mM GTP, 5 mM dithiothreitol (DTT)),and gently rotated at room temperature for 15 min. RNA wasisolated from radiolabeled nuclei using 0.8 ml of RNA Stat-60(Tel-Test) and 0.2 ml chloroform, processed according to themanufacturer’s directions. The RNA pellet was resuspendedin 100 µl of RNase-free water, and the radioactivity in 1 µlwas determined by scintillation counting. The remainder wasused for hybridization. 0.1–1.0 ng of gel-isolated lysyloxidase cDNA or c-H-ras coding exon was used as templatein a PCR reaction to generate vector-free material for slotblots. PCR products were required because gel-isolated DNAfragments, which always contain some residual vectorsequences, hybridized non-specifically with the runoffproducts of the RS485 and PR4 cell lines. RS485 wascreated by integration of c-H-ras cloned in a pBR322 vector[21], and PR4 was derived from RS485, so that both theirgenomes contained plasmid DNA that was transcribed.Hybridization of radiolabeled plasmid vector with a slot blotprepared using gel-isolated cDNAs resulted in signal in allslots, confirming that the spurious signals were due tocontaminating plasmid DNA. Slot blots prepared from PCRproducts (~0.1 ng of gel-isolated template as starting ma-terial), did not hybridize with radiolabeled plasmid vectorDNA. For lysyl oxidase, an 862 bp product was amplifiedusing plus primer tgttcgccctggcacgactc and minus primerttcttccgcagcgcatctcag. For ras, a 1255 bp product wasamplified using plus primer gcctgttggacatcctggataccg and

minus primer acttgcagctcatgcagccgg. Control glyceraldehyde-3-phosphate dehydrogenase (G3PDH) PCR product wasprepared using commercial primers (Clontech). After a 5 minincubation at 94°C, Taq DNA polymerase (Life Technologies)was added and reactions were subjected to 35 cycles of 45 secat 94°C, 45 sec at 55°C, 2 min at 72°C. A sample of eachreaction was electrophoresed on a 2.5% agarose gel to verifyproduct sizes. PCR products and pSP72 plasmid (useddirectly as a control) were denatured for 10 min at 100°C in0.4 N NaOH, 10 mM EDTA, and then applied to a chargednylon membrane (Qiagen) using a vacuum slot-blot apparatus(Schleicher & Schuell). Blots were hybridized with radio-labeled runoff RNA for 36 h at 65°C in 1 ml of hybridizationmix (10 mM N-tris(hydroxymethyl)methyl-2aminoethane-sulfonic acid (TES), pH 7.4, 10 mM EDTA, 0.2% sodiumdodecyl sulfate (SDS), 0.6 M NaCl, 5 × Denhardt’s solution(0. 1% Ficoll 400, 0.1% polyvinylpyrrolidone, 0.1% bovineserum albumin)), and washed once for 15 min at 37°C in 1 ×SSPE (0.18 M NaCl, 10 mM NaH

2PO

4, 1 mM EDTA, pH

7.7), 0.1% SDS, and twice for 30 min at 65°C in 0.1 × SSPE,0.1% SDS. Blots were imaged and quantitated on a Betascope603 Blot Analyzer (Betagen).

RT-PCR

Total cell RNA from NIH 3T3, RS485, and PR4 was isolatedas described above. One µg of each RNA was reversetranscribed in a total of 30 µl using random nonamer primers(Stratagene) and SuperScript (Life Technologies) accordingto the manufacturer’s instructions. For PCR, 3 µl of each firststrand reaction was cycled in a 50 µl reaction using eitherG3PDH primers (Clontech) or IRF-1 or IRF-2 primers [23](gift of Dr. Stephanie Vogel, USUHS). dNTPs were fromPharmacia; Taq DNA polymerase and buffers were from LifeTechnologies. Following denaturation for 5 min at 94°C, 25cycles of 94°C, 1 min, 55°C, 1 min, 72°C, 2 min wereperformed, with a final cycle of 72°C, 7 min. Ten µl of eachPCR reaction was electrophoresed on a 2.5% agarose gel,stained with ethidium bromide, and photographed. Theexpected sizes of the PCR products were approximately 200bp for IRF-1 and IRF-2, and approximately 1 kb for G3PDH.

Northern blot analysis

Total cell RNA was extracted using Trizol (Life Technologies)according to the manufacturer’s instructions. Ten µg of RNAwere electrophoresed with buffer recirculation on a 1.2%agarose gel in 10 mM sodium phosphate, pH 6.8, containing0.1 µg/ml of ethidium bromide [24]. Gels were transferredin 20 × SSPE by capillary blotting overnight to a chargednylon membrane (Qiagen). 32P-labeled probes, prepared by

82

random primer labeling, were hybridized at 42°C in 50%formamide, 5 × SSPE, 5 × Denhardt’s solution, 0.1% SDS,100 µg/ml denatured herring sperm DNA, for 18 h. Blotswere washed twice for 15 min at room temperature in 2 ×SSPE, 0.1% SDS, and twice for 30 min at 50°C in 0.1 × SSPE,0.1% SDS, and imaged on a Packard InstantImager. Probesfor IRF-1 and IRF-2 were cloned 200 bp PCR fragments [23]isolated by restriction and gel purification. G3PDH DNA wasgenerated by PCR using commercial primers (Clontech).

DNase footprinting

Fragments of the lysyl oxidase promoter region were excisedfrom pGKMI using Taq I and Sal I, or Nsi I and Sal I, andisolated from gels. Three hundred ng of DNA was end labeledwith 5 µCi of γ-32P ATP (6000 Ci/mmol, Dupont/NEN) using10 units of T4 polynucleotide kinase in 50 mM Tris-HCl, pH7.5, 5 mM DTT, 10 mM MgCl

2 for 1 h at 37°C. Labeling at

one end only was achieved by treatment of the DNA withalkaline phosphatase after digestion with the first restrictionenzyme. The Core Footprinting System (Promega) was usedto determine the binding of AP2 extract and purified humanSp1 factor (Promega) to the radiolabeled fragments. Fifteenng of end-labeled fragment was incubated in a 50 µl reactionof binding buffer (50 mM Tris-HCl, pH 8.0, 100 mM KCl,12.5 mM MgCl

2, 1 mM EDTA, 1 mM DTT, 20% glycerol)

and 1 footprinting unit of protein at 4°C for 1 h. For bindingat decreased stringencies, binding buffers containing 50 mMor 33 mM KCl were prepared. For DNase treatment, 50 µlof 5 mm CaCl

2, 10 mm MgCl

2 at room temperature was

added, and after 1 min, 0.16 units of DNase were added andincubated 30 sec at room temperature. Reactions werestopped by the addition of 90 µl of stop solution (200 mMNaCl, 30 mM EDTA, 1% SDS, 100 µg/ml yeast tRNA),prewarmed to 37°C. After purification of DNA by extrac-tion with phenol and chloroform, and precipitation withethanol, the DNA was analyzed on a 6% polyacrylamide-urea sequencing gel. A sequencing reaction of a knownDNA sequence was loaded alongside the footprinted DNAsto serve as a size reference. Footprinting reactions were alsoperformed without added protein, and were also electro-phoresed alongside.

Human genomic clones

A human B cell genomic library in lambda DASH II vector(gift of Dr. David Cohen, NIH) was screened with a humanlysyl oxidase cDNA previously isolated from a normal humanfibroblast library in lambda gt11 (gift of Dr. Esther Chang,Georgetown University). Phage hybridizing with the 32P-labeled human lysyl oxidase probe were rescreened until pure

phage populations were obtained. Three phage clones withunique restriction patterns were identified, restriction mapped,subcloned in pBCSK+ vector (Stratagene), and sequenced bythe dideoxy method. One of the genomic phage clones, φ 7,contained a 2.7 kb internal EcoRI - Not I fragment thatincluded the 5′ end of lysyl oxidase exon 1 and about 2 kb ofupstream sequence.

Nucleotide sequence accession numbers

Mouse lysyl oxidase genomic DNA: L04264. Human lysyloxidase cDNA: AF039291. Human lysyl oxidase genomicDNA: AF039290.

Results

Transformation by ras inhibits lysyl oxidase transcription.

The lack of steady-state lysyl oxidase mRNA previouslyobserved in c-H-ras-transformed mouse cells could beascribed to decreases either in message stability or in tran-scriptional activity. To distinguish between these, radio-labeled RNA from nuclear runoffs using NIH 3T3, RS485(ras-transformed), or PR4 (interferonβ reverted) nuclei wereused to probe the membrane bound lysyl oxidase and c-H-rasDNA. Glyceraldehyde-3-phosphate dehydrogenase (G3PDH)PCR product and plasmid DNA from pSP72 vector wereincluded on blots as controls. Lysyl oxidase transcriptionlevels in NIH 3T3 (Fig. 1) were 32% of G3PDH transcriptionlevels, and no transcription of ras or plasmid sequences wasdetected. Mouse endogenous ras transcripts are not detectedby the human H-ras probe used here [5, 21, 25]. In RS485,lysyl oxidase transcription was undetectable or barelydetected, while ras transcription levels were 409% of G3PDHlevels in N1H 3T3. The transcription of G3PDH in RS485was variable in several independent nuclear runoff assays. Wehave observed the same variability in northern analyses. Inthe PR4 revertant cell line, lysyl oxidase transcription wasrestored, with levels comparable to those observed in NIH3T3. The transfected ras oncogene continued to be expressedat very high levels in the revertant, as is characteristic of thiscell line. The reduced amounts of lysyl oxidase mRNAobserved after ras-transformation were therefore caused bychanges in gene transcription, not message stability or RNAprocessing.

Lysyl oxidase promoter subclone is active inras-transformed background

The region immediately 5′ of the mouse lysyl oxidasetranscription start site appeared to have the features charac-

83

teristic of a eukaryotic promoter, with two predicted TATAboxes and associated CA transcription start sites that wereverified by transcript mapping [12]. A DNA fragmentspanning this region was inserted in a CAT reporter vector(clone pB1S) and assayed for reporter gene transcription inboth NIH 3T3 and RS485 cells. The level of activity of thelysyl oxidase promoter varied among separate experiments(Table 1A), however, in any given experiment, the lysyloxidase promoter activity levels were always equivalentbetween the two cell backgrounds. A 2 kb Hind III fragmentlocated immediately upstream of the lysyl oxidase promoterwas tested in the pB1S construct to determine the contributionof this sequence to the transcriptional inhibition observed inthe ras-transformed cell line. This DNA fragment had nodifferential effect on lysyl oxidase promoter activity in thetwo cell backgrounds, but depressed activity in both cell lines(Table 1A). This 2 kb fragment exhibited no endogenouspromoter activity and it did not silence SV40 promoteractivity (Table 1B). The negative effect of this 2 kb fragmenton the lysyl oxidase promoter may be specific for thatpromoter.

Deletion analysis of lysyl oxidase promoter

To define specifically the sequence elements required forlysyl oxidase transcription, promoter deletions were prepared.For ease of manipulation, the 888 bp promoter region frompB1S was inserted into pGK0CAT [20]. The CAT activity ofthe resulting clone, pGKM1, was comparable to that mea-sured for pB1S. Deletions from both the 5′ and 3′ ends of theGKM1 insert were prepared and assayed in NIH 3T3 for CATenzyme activity (Fig. 2). Deletion of 342 bp from the 3′ endof GKM1 (‘HB32') completely abolished promoter activity,while deletion of 217 bp from the 3′ end (‘HF29’) resultedin CAT activity that was significantly greater than that inGKM1. The 126 bp region present in HF29 and missing inHB32, which includes the two predicted TATA boxes and two

Fig. 1. Nuclear runoff transcription. 32P-labeled runoff transcripts fromeach cell line were hybridized with slot blots containing PCR amplifiedcDNA from lysyl oxidase (LO); c-H-ras, (ras); or glyceraldehyde-3-phosphate dehydrogenase (G3PDH); and plasmid vector (pSP72).

Table 1. CAT activity of lysyl oxidase promoter constructs.

A. CAT Activity*Cell Line NIH 3T3 RS485

ConstructSV40Cat 1.00 1.00pB1S 0.17, 0.15, 0.57 0.17, 0.16, 0.50pB1S+2kb Hind III (S) 0.03 0.01pB1S+2kb Hind III (AS) 0.05 0.03Mock 0 0

B. CAT Activity*Cell Line NIH 3T3

ConstructSV40Cat 1.00pCatBasic +2 kb Hind III (S) 0.01pCatBasic +2 kb Hind III (AS) 0.01pCatPromoter 1.00pCatPromoter + 2 kb Hind III (S) 1.06Mock 0

*Each dish of cells was co-transfected with pSVβgal DNA, and CAT activityvalues were normalized to β-galactosidase activity to account for variationsin transfection efficiency and normalized to SV40Cat activity values.Transformations were performed in duplicate or triplicate, with at leastone repeat. Cell extracts were assayed in duplicate and averaged. S – senseorientation; AS – antisense orientation.

of the previously mapped transcription start sites [12],therefore constitutes a promoter. Furthermore, since HF29was more active than pGKM1, the 217 bp downstream of thepromoter may exert a negative effect on transcription.Deletions made from the 5′ end of the fragment (‘N2’ and‘T18’) also resulted in promoter activity higher than thestarting clone, indicating that negative control elements maybe present upstream of the promoter as well. The activity ofdeletion A3, which retained both TATA boxes, was notsignificantly different from deletion M14, which includedonly the downstream TATA box, indicating that only oneTATA element may be required, and that the two elementsdo not interfere with one another. Both TATA boxes appearto be functional, since transcription start sites were previouslymapped downstream of each [12]. Deletion of part of theremaining downstream TATA box (not including the coreconsensus) (‘D7’) gave activity comparable to that measuredfor construct ‘FS53’, in which no RNA polymerase IIpromoter elements were detected. The CAT activity measuredfor the pGK0Cat vector alone (not shown) was similar to thatmeasured for D7 and FS53, so that these activities may reflecta non-specific promotion derived from upstream vectorsequences. The CAT activity of the entire set of deletionconstructs was also determined in the RS485 background.There were no significant differences in the activity of thedeletion constructs between the normal and ras-transformedlines (data not shown).

84

To determine if these promoter elements were conservedacross species, human genomic clones for lysyl oxidase wereisolated and sequenced. There is a 79% sequence identitybetween the human and mouse sequences in the approximately1 kb of sequence upstream of the translation start codon.Using PC/GENE software, a scan for promoter elements inthe 5' flanking region of lysyl oxidase in human clone φ7was performed. Four TATA boxes, three of which correlatedwith cap signals, were identified (Fig. 3). Of the three TATAboxes with correlated cap signals, one was also correlatedwith two GC box elements. This TATA box in the humansequence corresponds to the mouse TATA box furthestdownstream, with an identical DNA sequence and position(Fig. 3).

IRF-1 and IRF-2 expression is not significantly altered byras-transformation or reversion

The pB1S construct assayed above includes the IRF-Ebinding site, shown to bind transcription factor IRF-1. IRF-1is a positive effector of lysyl oxidase, and IRF-1 deficientprimary embryo fibroblasts do not express lysyl oxidase [13].Since pB1S was active in the RS485 background, this sug-gested that functional IRF-1 was present, and that thedecrease in cellular lysyl oxidase transcription observed inRS485 was not due to a lack of IRF-1. Overexpression ofIRF-2 in NIH 3T3 resulted in loss of lysyl oxidase expres-sion [13]. Similarly, if overexpressed IRF-2 were responsible

for the suppression of lysyl oxidase transcription in RS485,then the lysyl oxidase reporter gene construct should alsohave been inactive. To confirm that IRF-1 was present, andthat IRF-2 was not overexpressed, reverse transcriptase-PCRwith total cell RNA and IRF-1 or IRF-2 primers was per-formed. Message for each gene was present in NIH 3T3 andRS485, as well as in the PR4 revertant (Fig. 4A). This wasverified by northern analysis of cellular RNA (Fig. 4B). BothIRF-1 and IRF-2 messages were present in NIH 3T3 andRS485; the ras-transformed line actually contained somewhatlarger amounts of each message. RS485 does appear tocontain functional IRF-1 protein, since mRNAs detected byRT-PCR for three other IRF-1-inducible genes (FcRγ, iNOS,and IP- 10) were present at levels equal to or higher than thosefound in NIH 3T3 (M. Fultz, personal communication).

Lysyl oxidase promoter region binds transcription factorAP2

Based on published consenses, several AP2 binding siteswere predicted in the sequence 5′ to the lysyl oxidasetranslation start site [12]; there was a partial Sp1 binding siteconsensus as well. DNA footprint analysis of promoterfragments N2 and T18 (Fig. 2), which include all but one ofthe predicted AP2 binding sites, was performed with tran-scription factors AP2 and Sp1. A 310 bp fragment of theSV40 early promoter/enhancer region, which binds bothfactors, was used as a positive control. There was no DNaseI protection, nor any perturbation of the DNase I ladder thatmight indicate some protein binding, when purified humanSp1 transcription factor was incubated with either the T18or N2 fragment. Assays repeated at decreased bindingstringencies did not result in any DNase I protection of thelysyl oxidase promoter fragments by Sp1. Four areas wereprotected after binding of AP2 protein extract (Fig. 5).Regions A and B were detected using the 5′-labeled N2fragment. Each of these regions includes a predicted con-sensus AP2 binding site. Protection of the predicted AP2site near the 5′ end of the N2 fragment could not be deter-mined. Four protected regions were identified using the 5′labeled T18 fragment. The largest of these, region F,included all of binding site B. Region E included threepredicted AP2 sites. Region D was smaller than the mini-mum 20 bases protected by AP2, and may be an artefact ormay be part of region C. Footprint analysis of the T18fragment labeled at the 3′ end revealed no additional AP2binding sites in the region from –27 to –325. Region A,which is flanked by regions C and E, may not have beendetected in fragment T18 due to the formation of secondarystructure in the fragment that prevented some binding.Similarly, steric constraints in N2 may have allowed bindingat regions C and E, but not A.

Fig. 2. Deletion analysis of lysyl oxidase promoter region. Deletionconstructs were transfected into NIH 3T3 and assayed for CAT reportergene activity. Each dish of cells was cotransfected with pSVβgal DNA.*CAT activity values were normalized to β-galactosidase activity to accountfor variations in transfection efficiency. Activity is presented as a proportionof SV40 Cat activity (set to 1).

85

Dexamethasone stimulates lysyl oxidase messageproduction

NIH 3T3 cells cultured in the presence of dexamethasone(1 µM) as a control for experiments involving glucocorticoid-inducible plasmids contained an increased amount of steady-state lysyl oxidase message. Similar treatment of RS485 cellsresulted in the appearance of lysyl oxidase message (Fig. 6A),and the treated RS485 cells in culture appeared flatter, larger,and were more contact-inhibited than untreated controls.Lysyl oxidase message appeared in the RS485 cells between4 and 6 h after dexamethasone treatment was started (Fig. 6B).There was no effect on the amount of ras message present inRS485 (Fig. 6B). To investigate if the effect of dexamethasoneinvolved the lysyl oxidase promoter, NIH 3T3 cells weretransfected with pB1S and treated with 1 µM dexamethasonefor 48 h beginning 3 h post-transfection (Table 2). Dexa-methasone did not have any effect on the reporter activity ofthis promoter subclone, and clones containing an additional

2 kb of upstream sequence were similarly unaffected. Todetermine if dexamethasone increased the transcription of thecellular lysyl oxidase gene, nuclear runoff assays wereperformed on NIH 3T3 and RS485 nuclei prepared from cellscultured for 66–72 h in the presence of dexamethasone (Fig6C). Increased transcription of lysyl oxidase was observedin NIH 3T3. However, although in these nuclear runoffexperiments there was a faint, but discernable, signal for lysyloxidase message in RS485, this signal was not increased asa result of the dexamethasone treatment.

Methylation affects lysyl oxidase promoter activity

The PR4 revertant became retransformed after short-termtreatment with the demethylating agent 5-aza-2-deoxycytidineor 5-azacytidine [5, 26]. More than half of the cell populationappeared transformed within 3–6 cell doublings after treat-ment. Similar treatment of NIH 3T3 was not transforming,

Fig. 3. Comparison of predicted promoter elements in human and mouse lysyl oxidase. Two regions of the human (H) lysyl oxidase promoter, showing thepredicted TATA boxes and cap signals as reverse highlights, are aligned with the mouse (M) promoter sequence. Overlapping GC boxes in the humansequence are overlined. Numbering for each sequence begins upstream of the ATG start codon.

86

A B

Fig. 4. (A) RT-PCR for IRF-1 and IRF-2. RNA extracted from NIH 3T3, RS485, and PR4 was reverse transcribed with random nonamers, amplified withprimer sets for IRF-1, IRF-2, or G3PDH, and electrophoresed on a 3.5% agarose gel containing ethidium bromide. (B) Northern blot of NIH 3T3 and RS485RNA hybridized with 32P-labeled IRF-1, IRF-2 or G3PDH.

Fig. 5. Regions of AP2 binding. DNA sequence of the mouse lysyl oxidase promoter region showing regions (A–F) protected from DNase digestion by AP2protein extract. Fragments assayed were Nsi I - Ava I (N2) and Taq I - Ava I (T18). TATA boxes and CA transcription start sites (cap signals) are reverse-highlighted.The two predicted AP-2 sites that were not tested are labeled and underlined. CpG dinucleotides are double underlined. +1 indicates the translation start site.

87

even though the cell DNA was demethylated. Analysis ofRNA from the retransformed cell line, PR4-aza, showed thatretransformation by demethylation was accompanied by theloss of steady-state lysyl oxidase message (Fig. 7). It seemedunlikely that methylation of the lysyl oxidase promoter wasrequired for transcriptional activity, since the unmethylatedpromoter-CAT constructs were active when assayed. How-ever, it was possible that methylation would enhance lysyloxidase promoter activity. To test this, pSV40CatControland pB1S DNAs were methylated in vitro by incubationwith Sss I methylase, which methylates all CpG residues.Control DNAs were incubated in methylation buffer withoutmethylase. The completeness of CpG methylation wasinferred from the insensitivity of the vector portion of thereporter gene constructs to restriction endonuclease Hpa II.

The one Hpa II site in the lysyl oxidase upstream regioncontained in pB1S is located at position –57 (Fig. 5), and isoutside of the defined promoter. The DNAs were assayed forCAT activity in both NIH 3T3 and PR4. The activity of theuntreated lysyl oxidase construct was 50–57% of the activityof the untreated SV40 control plasmid. After treatment withSss I methylase, the activity of the SV40 control constructwas decreased to between 10 and 34% of the untreated SV40control. After treatment with Sss I methylase, the lysyloxidase promoter construct was completely inactive in boththe NIH 3T3 and RS485 cell backgrounds.

Discussion

Because lysyl oxidase plays a role in suppressing ras inducedcellular transformation, an understanding of the mechanismby which lysyl oxidase expression is controlled may allowus to develop future strategies for intervention in or preven-tion of cancer. Decreased transcription of lysyl oxidase wasobserved in a group of transformed human cell lines thatincluded a melanoma, a choriocarcinoma and an SV40 virustransformed line [27], and in cloned rat embryo fibroblaststransformed with H-ras oncogene [28]. We show here thatthe markedly decreased amount of steady-state lysyl oxidasemessage observed after cellular transformation of mouse NIH3T3 fibroblasts by LTR-c-H-ras also occurs as a result ofdecreased gene transcription. In addition, gene transcriptionwas restored following interferonβ treatment and reversionto normal growth and nontumorigenicity. This system of celllines is therefore useful to study both the mechanism oftranscriptional loss and that of ras suppression by lysyloxidase.

The undiminished activity of lysyl oxidase reporter geneconstructs in the ras-transformed cell line, in which the

Fig. 6. Effect of dexamethasone on lysyl oxidase expression. (A) Northernblot of steady state RNA from NIH 3T3 and RS485 cultured with andwithout 1 µM dexamethasone, hybridized with 32P-labeled lysyl oxidase(LO) cDNA. Lysyl oxidase messages are ~4.8 and ~3.8 kb. Equal amountsof RNA in all lanes were verified by reprobing with mouse β-actin. (B)Northern blot showing induction of lysyl oxidase message in RS485 withincreasing time of treatment, and control ras message. (C) Nuclear runoffassay in NIH 3T3 and RS485 cultured with and without dexamethasone.LO – lysyl oxidase; ras – c-H-ras; G3 – glyceraldehyde-3-phosphatedehydrogenase; pSP – plasmid vector pSP72.

Table 2. Effect of dexamethasone on lysyl oxidase promoter activity.

CAT Activity* Cell Line: NIH 3T3 RS485 Dexamethasone: – + – +

ConstructSV40Cat 1.00 1.60 1.00 1.05pB1S 0.12 0.16 0.09 0.10pB1S + 2 kb Hind III (S) 0.02 0.04 nd ndpB1S + 2 kb Hind III (AS) 0.03 0.04 nd ndMock 0 0 0 0

*Each dish of cells was co-transfected with pSVβgal DNA, and CAT activityvalues were normalized to β-galactosidase activity to account for variationsin transfection efficiency and normalized to SV40Cat activity values.Transformations were performed in duplicate or triplicate, with at leastone repeat. Cell extracts were assayed in duplicate and averaged. S – senseorientation; AS – antisense orientation; nd – not determined.

88

endogenous gene is silenced, indicated that the binding of anegative regulator, at least in the 3 kb of upstream sequencetested, was not responsible for the transcription suppressionobserved after ras transformation. The IRF-E binding site[13] for transcription factors IRF-1 and IRF-2 [29, 30]appears in this reporter construct. Both the IRF-1 and IRF-2genes appear to be transcriptionally active in the transformedline. If functional proteins are produced, they appear neitherto stimulate the endogenous lysyl oxidase gene (IRF-1), norsuppress the introduced reporter gene construct (IRF-2).Messenger RNA for FcRγ, iNOS, and IP-10, which are IRF-1-inducible genes, was expressed in RS485 at levels com-parable to or greater than those in NIH 3T3 (M. Fultz,personal communication), suggesting that functional IRF-1protein is present.

There are 36 CpG dinucleotides present in the mouse lysyloxidase promoter region analyzed here (Fig. 5, doubleunderlined). CpG dinucleotides are normally under repre-sented in mammalian DNA, occurring at less than 10% of theexpected frequency. The observed/expected ratio of CpG di-nucleotides in this 888 bp region is 0.56, which is characteristicof a CpG island. Such islands are often found upstream ofhousekeeping genes, and are usually under methylated.Methylation of cytosines in vitro in the p53 promoter resultedin down regulation of transcriptional activity in a CATreporter plasmid [31] and suggested a role for methylationin the control of this tumor suppressor. The loss of tran-scription observed after in vitro methylation of the lysyloxidase reporter gene construct is similarly suggestive, andis consistent with the transcription loss associated with genemethylation that has been observed for other tumor sup-pressor genes [14–19]. The inactivation of the lysyl oxidasepromoter in vivo by ras transformation might therefore be theresult of the loss of expression of a DNA binding protein thatprotects CpG islands from the action of cytosine methylases.Since demethylation of ras-expressing revertants with5-azacytidine resulted in retransformation [5, 26], it ispossible that gene methylation is required for the expressionof this proposed DNA binding protein. The interferon-mediated reversion, which is unaffected by the continuedexpression of the ras oncogene, could operate by restoring

the transcription of this DNA binding protein. This issuggested by the inactivity of the methylated lysyl oxidasereporter gene construct in the interferon-induced revertant:if the nature of the reversion involved a compensatory activitythat overcame an existing inhibition due to methylation, themethylated construct would have been expected to be activein the ras-expressing, lysyl oxidase-expressing revertant.

A positive transcription activator was localized herein toa 126 bp region that begins 244 bp upstream of the translationstart codon. Transcription factor AP2 was demonstrated tobind with several sites, within and upstream of this region,that had been predicted to bind this transcription factor.Therefore, this region conforms with the criteria for afunctional promoter. The loss of AP2 binding sites in theseries of promoter deletions did not appear to have a signi-ficant effect on promoter activity: the activity of deletion M14(Fig. 2), which lacks all but 6 bp of binding site F (Fig. 5)was comparable to N2, which retains all AP2 binding regions.The original pB1S construct and each of the deletions wereequally active in NIH 3T3 and RS485, making it unlikely thatdifferential levels of transcription factor AP2 can account fordifferences in transcription of the cellular gene. In studiesusing a mouse myofibroblast-like cell line [32], promoteractivity was localized to a 224 bp region beginning 584 bpupstream of the ATG start codon. That entire region iscontained within the clone HB32, and this construct wascompletely inactive as a promoter when transfected intomouse NIH 3T3 fibroblasts (Fig. 2). These diverse findingsindicate that the lysyl oxidase gene may be controlled bydifferent promoter elements in different cell types. A tran-scription site start site was mapped in NIH 3T3 just upstreamof the first active TATA box [12] (Fig. 5), and this site didnot correlate with any other predicted promoter elements inthe available mouse sequence. This site is in a differentlocation to the start site mapped in myofibroblasts [32], andcould derive from another promoter further upstream,perhaps the COL1A1 promoter-like sequence previouslydescribed [32].

Lysyl oxidase promoter activity in cultured human fibro-blasts was localized to a 651 bp region beginning 274 bpupstream of the ATG start codon [33]. This location is similarto the mouse promoter defined here, and indicates thattranscription control in fibroblasts probably derives from thesame elements in both mouse and human. Although putativeTATA box sequences were reported not to be present for thathuman sequence [33], computer analysis of the humansequence reported here indicated four putative TATA boxes.One of these, at –302 (Fig. 3), is identical in sequence andposition to an active mouse element, and may be active inhuman cells as well. Of the two other human TATA boxes thatalso have correlated cap signals, one, at position –874 (Fig.3), is also identical to a previously predicted mouse promoterelement [12]. This element did not appear to be active in

Fig. 7. Effect of 5-azacytidine on lysyl oxidase message expression.Northern blot of total cell RNA hybridized with 32P-labeled lysyl oxidase(LO) cDNA. 1. NIH 3T3; 2. NIH 3T3 + IFNβ; 3. RS485; 4. revertant clone4C3 + IFNβ; 5. PR4; 6. PR4 + 5-azacytidine. Revertant clone 4C3 is theprecursor of PR4, grown in the presence of interferon.

89

mouse fibroblasts (this report), and is located outside theregions defined as positive regulators in either mousemyofibroblasts [32] or human fibroblasts [33]. This elementmay be functional in yet another cell type that expresses lysyloxidase.

Several studies have shown that lysyl oxidase activity ismodulated by hormones and glucocorticoids. In rat skin,activity was decreased after glucocorticoid treatment [34].Enzyme activity was found to be increased in mouse cervixby estradiol or dehydroepiandrosterone [35, 36], and in-creased enzyme activity was also observed in bovine smoothmuscle cells after testosterone treatment [37]. The activity ofthe lysyl oxidase promoter in NIH 3T3, as measured bynuclear runoff, was increased by treatment with dexa-methasone. This effect was not observed with reporter geneconstructs that included approximately 3 kb of sequenceupstream of the translational start, indicating that the se-quences determining the glucocorticoid response lie outsidethe regions tested, or that the effect is mediated throughanother gene product. The reporter gene constructs testedincluded a glucocorticoid response element (GRE) half-site(TGTTCT) at position –488. The sequence upstream of thiselement does not match any of the consenses for the otherGRE half-site. Although there are reports of glucocorticoidbinding to such downstream half-sites even with no con-sensus upstream half-site [38–40], this lysyl oxidase GREhalf-site does not appear to be functional. While dexa-methasone treatment of ras-transformed cells resulted in theaccumulation of steady state lysyl oxidase message, and thiswas accompanied by a more normal cell morphology, theincrease in message amount could not be attributed to astimulation of gene transcription. Therefore, the inactivationof the lysyl oxidase promoter in ras-transformed cells,perhaps due to methylation, is not overcome by gluco-corticoid stimulation. It is possible that these agents increasethe stability of the very small amounts of message that areproduced in the ras-transformed cells, similar to TGF-β1,which has been shown to enhance lysyl oxidase expressionin smooth muscle cells by message stabilization [41].

The existence of several diversely controlled promoterelements within the lysyl oxidase gene, whose functionalitymay depend upon cell type, could reflect differing roles forthis protein in different cell types. The only recognizedfunction of lysyl oxidase at present is the extracellularoxidation of lysines in collagen and elastin, resulting inmature connective tissue after cross linking. However, the celllines in which we first identified the antioncogenic effect oflysyl oxidase do not contain significant amounts of connec-tive tissue elements, making it appear unlikely that theobserved effect was exerted via extracellular matrix. It ispossible that the role of lysyl oxidase in this system involvesan intracellular function, as yet unrecognized, for thiswell-characterized extracellular enzyme. An intracellular role

for lysyl oxidase is also suggested by the finding of thisprotein associated with intracellular structures [42], and asintracellular immunoreactive granules in several cell types[43]. Cellular proteins with basic isoelectric points, includinghistone H1, have been shown to be in vitro substrates for lysyloxidase [44, 45], and lysyl oxidase was shown to be presentand catalytically active in the nuclei of aorta smooth musclecells [46]. In addition, lysyl oxidase message is expressed incells that do not normally synthesize collagen: pre-B cells [1],breast ductal epithelium and colonic epithelium (SaraContente, unpublished data), and prostate epithelium andneurons (Robert M. Friedman, unpublished data). Thesefindings, coupled with the observed loss of lysyl oxidaseexpression after oncogene transformation, and its reappearanceupon reversion, strongly indicate that lysyl oxidase plays acentral role in the maintenance of normal cell growth, apartfrom its extracellular function. Studies that will aid indetermining how intracellular lysyl oxidase may exert aneffect on cell growth are in progress. This information mayassist in developing new ways to treat or prevent cancers.

Acknowledgements

We thank Mary Lou Cutler and Hallgeir Rui for their criticalreading of the manuscript. This work was supported by PublicHealth Service grant CA37351 from the National CancerInstitute.

References

1. Contente S, Kenyon K, Rimoldi D, Friedman RM: Expression of generrg is associated with reversion of NIH 3T3 transformed by LTR-c-H-ras. Science 249: 796–798, 1990

2. Kenyon K, Contente S, Trackman PC, Tang J, Kagan HM, FriedmanRM: Lysyl oxidase and rrg messenger RNA. Science 253: 802,1991

3. Samid D, Chang EH, Friedman RM: Biochemical correlates ofphenotypic reversion in interferon-treated mouse cells transformedby a human oncogene. Biochem Biophys Res Commun 119: 21–28,1984

4. Samid D, Chang EH, Friedman RM, Schaff Z, Greene JJ: Biologicaland morphological characteristics of phenotypic revertants appearingin interferon-treated mouse cells transformed by a human oncogene. JExp Pathol 2: 211–222, 1985

5. Samid D, Flessate DM, Friedman RM: Interferon-induced revertantsof ras-transformed cells: Resistance to transformation by specificoncogenes and retransformation by 5-azacytidine. Mol Cell Biol 7:2196–2200, 1987

6. Pinnell SR, Martin GR: The cross-linking of collagen and elastin:Enzymatic conversion of lysine in peptide linkage to α-aminoadipic-δ-semialdehyde (allysine) by an extract from bone. Proc Natl AcadSci USA 61: 708–716, 1968

7. Krzyzosiak WJ, Shindo-Okada N, Teshima H, Nakajima K, NishimuraS: Isolation of genes specifically expressed in flat revertant cells

90

derived from activated ras transformed NIH 3T3 cells by treatmentwith azatyrosine. Proc Natl Acad Sci USA 89: 4879–4883, 1992

8. Hajnal, A, Klemenz, R and Schafer, R: Up-regulation of lysyl oxidasein spontaneous revertants of H-ras-transformed rat fibroblasts. CancerRes 53: 4670–4675, 1993

9. Shaefer R, Iyer J, Iten E, Nirkko A: Partial reversion of the transformedphenotype in HRAS-transfected tumorigenic cells by transfer of ahuman gene. Proc Natl Acad Sci USA 85: 1590–1594,1988

10. Oberhuber H, Seliger B, Schafer R: Partial restoration of pre-transformation levels of lysyl oxidase and transin mRNAs in pheno-typic ras revertants. Mol Carcinog 12: 198–204, 1995

11. Seliger B, Pfizenmaier K, Schäfer R: Short-term treatment with gammainterferon induces stable reversion of ras-transformed mouse fibro-blasts. J Virology 65: 6307–6311, 1991

12. Contente S, Csiszar K, Kenyon K, Friedman RM: Structure of themouse lysyl oxidase gene. Genomics 16: 395–400, 1993

13. Tan RS, Taniguchi T, Harada H: Identification of the lysyl oxidasegene as target of the antioncogenic transcription factor, IRF-1, and itspossible role in turnor suppression. Cancer Res 56: 2417–2421, 1996

14. Rideout WM 3rd, Eversole-Cire P, Spruck CH 3rd, Hustad CM,Coetzee GA, Gonzales FA, Jones PA: Progressive increases in themethylation status and heterochromatinization of the myoD CpG islandduring oncogenic transformation. Mol Cell Biol 14: 6143–6152, 1994

15. Sakai T, Toguchida J, Ohtani N, Yandell DW, Rapaport JM, Dryja TP:Allele specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am J Hum Genet 48: 880–888, 1991

16. Herman JG, Latif F, Weng Y, Lerman MI, Zbar B, Liu S, Samid D,Duan DS, Gnarra JR, Linehan WM, et al: Silencing of the VHLtumor-suppressor gene by DNA methylation in renal carcinoma. ProcNatl Acad Sci USA 91: 9700–9704, 1994

17. Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC, BaylinSB, Sidransky D: 5′ island methylation is associated with transcrip-tional silencing of the tumour suppressor p16/CDKN2/MTS1 in humancancers [see comments]. Nat Med 1: 686–692, 1995

18. Gonzalez-Zulueta M, Bender CM, Yang AS, Nguyen T, Beart RW,Van Tornout JM, Jones PA: Methylation of the 5′CpG island of thep16/CDKN2 tumor suppressor gene in normal and transformed humantissues correlates with gene silencing. Cancer Res 55: 4531–4535,1995

19. Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, HirohashiS: Silencing of the E-cadherin invasion-suppressor gene by CpGmethylation in human carcinomas. Proc Natl Acad Sci USA 92: 7416–7419, 1995

20. Kumar G: Two cat expression vectors for cloning and generation of3′- and 5′-deletion mutants. Gene 110: 101–103, 1992

21. Chang EH, Furth ME, Scolnick EM, Lowy DR: Tumorigenic trans-formation of mammalian cells induced by a normal human genehomologous to the oncogene of Harvey murine sarcoma virus. Nature297: 479–483, 1982

22. Greenberg ME, Bender TP: Identification of newly transcribed RNA.In: F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman,J.A. Smith, K. Struhl (eds), Current Protocols in Molecular Biology.John Wiley & Sons, New York, 1994, pp. 4.10.1–4.10.5.

23. Barber SA, Fultz MJ, Salkowski CA, Vogel SN: Differential expressionof interferon regulatory factor 1 (IRF-1), IRF-2, and interferonconsensus sequence binding protein genes in lipopolysaccharide(LPS)-responsive and LPS-hyporesponsive macrophages. InfectImmun 63: 601–608, 1995

24. Pelle R, Murphy NB: Northern hybridization: Rapid and simpleelectrophoretic conditions. Nucleic Acids Res 21: 2783–2784, 1993

25. Friedman RM, Yeh A, Gutman P, Contente S, Kenyon K: Reversionby deletion of transforming oncogene following interferon-beta andretinoic acid treatment. J Interferon Cytokine Res 17: 647–651, 1997

26. Rimoldi D, Srikantan V, Wilson VL, Bassin RH, Samid D: Increasedsensitivity of nontumorigenic fibroblasts expressing ras or myconcogenes to malignant transformation induced by 5-Aza-2′-deoxycytidine. Cancer Res 51: 324–330, 1991

27. Hamalainen ER, Kemppainen R, Kuivaniemi H, Tromp G, Vaheri A,Pihlajaniemi T, Kivirikko KI: Quantitative polymerase chain reactionof lysyl oxidase mRNA in malignantly transformed human cell linesdemonstrates that their low lysyl oxidase activity is due to lowquantities of its mRNA and low levels of transcription of the respectivegene. J Biol Chem 270: 21590–21593, 1995

28. Su Z-Z, Yemul S, Estabrook A, Friedman RM, Zimmer SG, FisherPB: Transcriptional switching model for the regulation of tumori-genesis and metastasis by the Ha-ras oncogene: transcriptional changesin the Ha-ras tumor suppressor gene lysyl oxidase. Int J Oncol 7: 1279–1284, 1995

29. Harada H, Fujita T, Miyamoto M, Kimura Y, Maruyama M, Furia A,Miyata T, Taniguchi T: Structurally similar but functionally distinctfactors, IRF-1 and IRF-2, bind to the same regulatory elements ofIFN and IFN-inducible genes. Cell 58: 729–739, 1989

30. Harada H, Kitagawa M, Tanaka N, Yamamoto H, Harada K, IshiharaM, Taniguchi T: Anti-oncogenic and oncogenic potentials of interferonregulatory factors-1 and -2. Science 259: 971–974, 1993

31. Schroeder M, Mass MJ: CpG methylation inactivates the transcriptionalactivity of the promoter of the human p53 tumor suppressor gene.Biochem Biophys Res Commun 235: 403–406, 1997

32. Jourdan-Le Saux C, Gleyzal C, Raccurt, Sommer P: Functional analysisof the lysyl oxidase promoter in myofibroblast-like clones of 3T6fibroblast. J Cell Biochem 64: 328–341, 1997

33. Csiszar K, Entersz I, Trackman PC, Samid D, Boyd CD: Functionalanalysis of the promoter and first intron of the human lysyl oxidasegene. Mol Biol Rep 23: 97–108, 1996

34. Counts DF, Shull S, Cutroneo KR: Skin lysyl oxidase activity is notrate limiting for collagen crosslinking in the glucocorticoid-treatedrat. Connect Tissue Res 14: 237–243, 1986

35. Ozasa H, Tominaga T, Nishimura T, Takeda T: Lysyl oxidase activityin the mouse uterine cervix is physiologically regulated by estrogen.Endocrinology 109: 618–621, 1981

36. Ozasa H, Tominaga T, Takeda T: Evidence of an estrogen-like effectof dehydroepiandrosterone on lysyl oxidase activity in the mousecervix. Acta Obstet Gynecol Scand 65: 543–545, 1986

37. Bronson RE, Calaman SD, Traish AM, Kagan HM: Stimulation oflysyl oxidase (EC 1.4.3.13) activity by testosterone and characterizationof androgen receptors in cultured calf aorta smooth-muscle cells.Biochem J 244: 317–323, 1987

38. Lee GC, Yang IM, Kim BJ, Woo JT, Kim SW, Kim JW, Kim YS, ChoiYK: Identification of glucocorticoid response element of the rat TRHgene. Korean J Intern Med 11: 138–144, 1996

39. Schuetz JD, Schuetz EG, Thottassery JV, Guzelian PS, Strom S, SunD: Identification of a novel dexamethasone responsive enhancer inthe human CYP3A5 gene and its activation in human and rat livercells. Mol Pharmacol 49: 63–72, 1996

40. Del Monaco M, Covello SP, Kennedy SH, Gilinger G, Litwack G,Uitto J: Identification of novel glucocorticoid-response elements inhuman elastin promoter and demonstration of nucleotide sequencespecificity of the receptor binding. J Invest Dermatol 108: 938–942,1997

41. Gacheru SN, Thomas KM, Murray SA, Csiszar K, Smith-Mungo LI,Kagan HM: Transcriptional and post-transcriptional control of lysyloxidase expression in vascular smooth muscle cells: Effects ofTGF-beta 1 and serum deprivation. J Cell Biochem 65: 395–407, 1997

42. Wakasaki H, Ooshima A: Immunohistochemical localization oflysyl oxidase with monoclonal antibodies. Lab Invest 63: 377–384,1990

91

43. Kobayashi H, Ishii M, Chanoki M, Yashiro N, Fushida H, Fukai K,Kono T, Hamada T, Wakasaki H, Ooshima A: Immunohistochemicallocalization of lysyl oxidase in normal human skin. Br J Dermatol131: 325–330, 1994

44. Kagan HM, Williams MA, Calaman SD, Berkowitz EM: Histone HI is asubstrate for lysyl oxidase and contains endogenous sodium borotritide-reducible residues. Biochem Biophys Res Commun 115: 186–192, 1983

45. Kagan HM, Williams MA, Williamson PR, Anderson JM: Influenceof sequence and charge on the specificity of lysyl oxidase towardprotein and synthetic peptide substrates. J Biol Chem 259: 11203–11207, 1984

46. Li W, Nellaiappan K, Strassmaier T, Graham L, Thomas KM, KaganHM: Localization and activity of lysyl oxidase within nuclei offibrogenic cells. Proc Natl Acad Sci USA 94: 12817–12822, 1997

92