of April 10, 2019.This information is current as

Human Monocyte-Derived Dendritic Cellsbut Not Peptidoglycan-Induced Activation ofLipopolysaccharide- or Poly(I:C)-Induced Erythromycin Differentially Inhibits

Mitsufumi MayumiYamada, Hiromichi Iwasaki, Yoshimasa Urasaki and Motoko Yasutomi, Yusei Ohshima, Nemuko Omata, Akiko

http://www.jimmunol.org/content/175/12/8069doi: 10.4049/jimmunol.175.12.8069

2005; 175:8069-8076; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/175/12/8069.full#ref-list-1

, 24 of which you can access for free at: cites 50 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2005 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

Erythromycin Differentially Inhibits Lipopolysaccharide- orPoly(I:C)-Induced but Not Peptidoglycan-Induced Activation ofHuman Monocyte-Derived Dendritic Cells1

Motoko Yasutomi,* Yusei Ohshima,2* Nemuko Omata,* Akiko Yamada,* Hiromichi Iwasaki,†

Yoshimasa Urasaki,† and Mitsufumi Mayumi*

Erythromycin (EM) has attracted attention because of its anti-inflammatory effect. Because dendritic cells (DCs) are the mostpotent APCs involved in numerous pathologic processes including innate immunity, we examined effects of EM on the activationof human DCs by pathogen-derived stimuli. Monocyte-derived DCs were pretreated with EM and subsequently stimulated withpeptidoglycan, polyriboinosinic:polyribocytidylic acid (poly(I:C)), or LPS. The activation of DCs was assessed by surface moleculeexpression and cytokine production. To reveal the signaling pathways affected by EM, TLR expression, NF-�B, IFN regulatoryfactor-3, and AP-1 activation were examined. EM inhibited costimulatory molecule expression and cytokine production that wasinduced by poly(I:C) and LPS but not by peptidoglycan. EM pretreatment down- and up-regulated mRNA levels of TLR3 andTLR2, respectively, but did not affect that of TLR4. EM suppressed IFN regulatory factor-3 activation and IFN-� production butnot AP-1 activation induced by poly(I:C) and LPS. The inhibitory effect of EM on NF-�B activation was observed only inpoly(I:C)-stimulated DCs. EM selectively suppressed activation of DCs induced by LPS and poly(I:C) in different ways, suggestingthat the immuno-modulating effects of EM depend on the nature of pathogens. These results might explain why EM prevents thevirus-induced exacerbation in the chronic inflammatory respiratory diseases and give us the clue to design new drugs to treat thesediseases. The Journal of Immunology, 2005, 175: 8069–8076.

T he role of macrolide antibiotics in the treatment of upperand lower respiratory tract infections is well established.Independent of their potent antimicrobial activity, 14-

membered and 15-membered macrolides possess anti-inflammatory properties that may contribute to the clinical benefitsobserved in patients with chronic infectious airway inflammation(1, 2). Macrolide antibiotics have been shown to affect a number ofprocesses involved in inflammation, including migration of neu-trophils, the oxidative burst in phagocytes, and the production ofvarious cytokines by bronchial epithelial cells, lymphocytes, andmonocytes (1, 3–6). Although it is presumed that NF-�B andAP-1, which are crucial regulators of proinflammatory gene ex-pression (4, 5, 7, 8), are potentially the most important targets forat least some anti-inflammatory effects of macrolides, the precisemechanisms remain to be clarified.

The innate immune system has dual roles in host defense, pro-viding a direct and immediate response against microbial invadersas well as playing an instructive role, influencing the nature ofadaptive immunity. This instructive role of the innate immune sys-

tem is served mainly by dendritic cells (DCs)3 (9). DCs can rec-ognize microbial components using various pattern recognition re-ceptors such as TLRs (10). Different TLRs expressed on DCs candiscriminate distinct pathogen-associated molecular patterns andinitiate signaling pathways to induce DC maturation and activation(11, 12). After exposure to pathogens, DCs respond by producingimmunostimulatory cytokines such as IL-12 and by up-regulatingMHC class I, MHC class II, and costimulatory molecules. DCsthen mature into efficient APCs. This microbial-induced DC mat-uration provides crucial elements required for directing the adap-tive T cell response toward either a Th1 or Th2 pattern (9) (13, 14).

To date, 11 TLRs have been identified in humans (15). EachTLR recognizes a distinct microbial component; for example, pep-tidoglycan (PGN), the major Gram-positive bacterial cell wallcomponent, uses TLR2, whereas LPS, a Gram-negative cell wallcomponent, stimulates DCs through TLR4. Double-stranded RNAof viral origin and polyriboinosinic:polyribocytidylic acid (poly(I:C)), a synthetic analog of dsRNA, are recognized by TLR3. Stim-ulation of TLRs by these ligands activates several signaling cas-cades, including NF-�B and MAPK, leading to the production ofproinflammatory cytokines and the induction of DC maturation(11, 12, 16–18). Erythromycin (EM), a prototype of the 14-mem-bered macrolides, has been shown to inhibit the activation ofNF-�B and AP-1 (5–7). In this study, therefore, we examined theimmuno-modulating effect of EM on human monocyte-derivedDCs and the molecular targets of EM in the TLR signaling path-ways. We show here that EM selectively suppresses activation ofDCs induced by poly(I:C) and LPS. Furthermore, we discuss the

*Department of Pediatrics, Faculty of Medical Sciences, University of Fukui, Fukui,Japan; and †Division of Transfusion Medicine, Fukui Medical University Hospital,Fukui, Japan

Received for publication September 27, 2004. Accepted for publication October10, 2005.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by grants from the Pollution-related Health Damage Com-pensation and Prevention Association and the 21st Century Center of Excellenceprogram.2 Address correspondence and reprint requests to Dr. Yusei Ohshima, Departmentof Pediatrics, Faculty of Medical Sciences, University of Fukui, 23-3 Shi-moaizuki, Matsuoka-cho, Yoshida-gun, Fukui 910-1193, Japan. E-mail address:yohshima@fmsrsa.fukui-med.ac.jp

3 Abbreviations used in this paper: DC, dendritic cell; PGN, peptidoglycan; poly(I:C),polyriboinosinic:polyribocytidylic acid; EM, erythromycin; IRF-3, IFN regulatoryfactor-3; IRAK, IL-1R-associated kinase; TRIF, Toll/IL-1R domain-containing adap-tor-inducing IFN-�; TICAM-1, Toll/IL–1R domain–containing adaptor molecule-1.

The Journal of Immunology

Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

possibility that EM mainly affects the MyD88-independentpathway.

Materials and MethodsReagents and culture medium

Human recombinant GM-CSF and IL-4 were provided by Kirin BeverageCompany and Ono Pharmaceutical Company, respectively. FITC-conju-gated mAbs specific for CD83, CD86, CD54, or MHC class II and anti-TLR2, -TLR3, and -TLR4 mAbs were purchased from eBioscience. PE-conjugated mAbs specific for CD14 or IL-4 and FITC-conjugated IFN-�mAb and anti-CD1a mAb were purchased from BD Biosciences. AIM-Vmedium was from Invitrogen. LPS from Escherichia coli 0111:B4 purifiedby phenol extraction and gel filtration chromatography and Ultra-pure LPSfrom Salmonella minnesota R 595 (Re) were obtained from Sigma-Aldrichand Calbiochem-Novabiochem, respectively. Staphylococcus aureus PGNwas from Fluka. Poly(I:C) (gamma-irradiated) and EM were fromSigma-Aldrich.

Cell purification and culture conditions

Highly purified monocytes (�95% CD14�) were obtained from buffy coatsof healthy volunteers as described previously (19). Briefly, PBMCs wereseparated by Ficoll-Paque Plus (Amersham Bioscience. Monocytes wereenriched by cold aggregation and deprived of T and NK cells by rosettingwith 2-aminoethylisothiouronium bromide-treated (Sigma-Aldrich) sheepRBCs. Enriched monocytes (5 � 106 cells/well) were cultured in plastic6-well plates (Falcon) for 30 min followed by removal of trace numbers ofnonadherent cells. The adherent cells were cultured in 1 ml of AIM-Vmedium (Invitrogen) supplemented with 40 ng/ml GM-CSF and 40 ng/mlIL-4 at 37°C with 5% CO2. One milliliter of fresh AIM-V medium con-taining GM-CSF and IL-4 was added on day 2 and nonadherent cells wereharvested on day 5 as immature DCs. Microscopic analysis showed that�98% of the nonadherent cells had cellular projections. Analysis by flowcytometry revealed that the preparations consisted of a homogenous (�96%) population of CD2�, CD14low/�, CD16�, CD40�, CD54�, CD86low,CD83low/�, and HLA-DR� large cells, and �1% of CD3�, CD19�, orCD56� cells could be detected. The immature DCs (1 � 106 cells/ml) wereextensively washed, preincubated in the presence or absence of EM (100�g/ml) for 3 h, and then stimulated with 10 �g/ml PGN, 20 �g/ml poly(I:C), or 2 �g/ml LPS. After 48 h of stimulation, the supernatants were col-lected and stored at �20°C until they could be assayed for cytokines. Forthe measurement of IFN-� production, the supernatants were collectedafter 24 h.

T lymphocytes and allogenic MLR

CD4�CD45RA� naive T cells were negatively selected from PBMCs byusing the MACS CD4� T cell isolation kit and CD45RO MicroBeadsaccording to the protocol recommended by the supplier (Miltenyi Biotec).The purity of naive CD4� T cells was shown to be �98% by flow cytom-etry using anti-CD4 and anti-CD45RA mAbs (eBioscience). The DCs pre-cultured with PGN, poly(I:C), or LPS in the presence or absence of EM for2 days were washed and then cocultured with allogenic naive T cells in96-well round-bottom plates in 200 �l/well (2 � 104 DCs/2 � 105 T cells).Three days after coculture, cell proliferation was assessed by adding 1�Ci/well [methyl-3H]thymidine (10 Ci/mmol; Amersham Biosciences)during the last 16 h of culture. Triplicate cultures were then harvested ontoglass fiber filters, and radioactivity was counted using liquid scintillation.Before the thymidine pulse, supernatants were collected and cytokine con-tent was determined. For intracellular cytokine analysis, 5 days after co-culture, T cells were washed and restimulated with PMA (50 ng/ml) and iono-mycin (250 ng/ml) for 8 h. GolgiStop (BD Biosciences) was added during thelast 4 h. The cells were stained with PE-conjugated anti-IL-4 and FITC-con-jugated anti-IFN-� using BD Cytofix/Cytoperm (BD Biosciences).

Cytokine measurements

IL-12p70, IL-6, IL-10, IL-13, and IFN-� were measured by ELISA. Abpairs and standard recombinant human cytokines for the ELISA were pur-chased from Pierce Biotechnology and PeproTech, respectively. IFN-�,IL-1�, and TNF-� were measured by an IFN-� ELISA kit (TFB), an IL-1�ELISA kit, and a TNF-� ELISA kit (BioSource), respectively. The detec-tion limits for IL-12p70, IL-6, IL-10, IL-13, IFN-�, IFN-�, IL-1�, andTNF-� were 15 pg/ml, 31 pg/ml, 15 pg/ml, 250 pg/ml, 15 pg/ml, 2.5 IU/ml,3.9 pg/ml, and 3.9 pg/ml, respectively.

Analysis of TLR mRNA expression

Immature DCs were lysed after 6 h of culture with 100 �g/ml EM, and totalRNAs were isolated using the RNeasy kit (Qiagen). First-strand cDNA wassynthesized from 1 �g of the total amount of RNA using Super Script IIreverse transcriptase (Invitrogen Life Technologies). PCR amplification ofTLR2, TLR3, TLR4, and �-actin was conducted using specific primers(10). The primer sequences were as follows: for TLR2, GGCCAGCAAATTACCTGTGTG (sense) and CCAGGTAGGTCTTGGTGTTCA(antisense); for TLR3, ATTGGGTCTGGGAACATTTCTCTTC (sense)and GTGAGATTTAAACATTCCTCTTCGC (antisense); for TLR4, CTGCAATGGATCAAGGACCA (sense) and TCCCACTCCAGGTAAGTGTT (antisense); for �-actin, GATCAGCAAGCAGGAGTATG (sense)and ACACGAAAGCAATGCTATCA (antisense). The mRNA levels werequantified by real-time quantitative PCR on an ABI PRISM7000 sequencedetector (Applied Biosystems) using TaqMan Pre-Developed Assay Re-agents according to manufacturer’s instructions. For each sample, the dif-ference in threshold cycles between the target gene and �-actin gives thestandardized expression level (�Ct). Subtracting the �Ct of the controlfrom the �Ct of an EM-treated sample yielded the ��Ct value that wasused to calculate relative expression levels in EM-treated samples accord-ing to the formula 2���Ct.

Flow cytometry

The cells were incubated with the indicated mAbs, together with humanIgG (10 �g) for 30 min on ice in FACS buffer (PBS containing 0.5% BSAand 0.01% sodium azide). After the cells were washed, the FITC-conju-gated F(ab�)2 of goat anti-mouse Ig (DakoCytomation) was added and fur-ther incubated for 30 min. For intracellular staining of TLR3, the cells werepretreated with BD Cytofix/Cytoperm (BD Biosciences). The cells werethen analyzed on a FACSCalibur (BD Biosciences). The specific meanfluorescence intensities were calculated by subtracting the isotype-matchedcontrol Ab fluorescence.

Calorimetric analysis for NF-�B activation

Nuclear extracts were prepared from immature DCs that were pretreatedwith 100 �g/ml EM and subsequently stimulated with LPS or poly(I:C) forthe indicated time periods, using a Nuclear Extract kit (Active Motif).Binding of NF-�B subunits to the NF-�B binding consensus sequences wasmeasured with the ELISA-based Trans-AM NF-�B family transcriptionfactor assay kits (Active Motif), respectively, according to the protocolrecommended by the supplier. The active forms of NF-�B subunits innuclear extracts can be detected using Abs specific for an epitope that isaccessible only when the subunit is activated and bound to its target DNA.

Western blotting

To detect IFN regulatory factor-3 (IRF-3) dimerization, the cells werelysed with 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1%Nonidet P-40, 1 mM sodium orthovanadate, 0.1 mg/ml leupeptine, and 1mM PMSF. The whole cell lysates were prepared by centrifugation andsubjected to native PAGE (10 �g of protein/lane). Native PAGE was per-formed using a 7.5% acrylamide gel (0.375 M Tris-Cl (pH 8.8); no SDS),and the proteins were transferred to polyvinylidene difluoride membrane(Millipore) as described previously (20). The immunoreactive proteinswere detected using rabbit anti-human IRF-3 rabbit polyclonal Ab (IBL)and the ECL-Plus detection system (Amersham Biosciences). The wholecell lysates (�10–30 �g of protein/lane) were also electrophoresed bySDS-PAGE, transferred, and immunoblotted with specific primary Abs:rabbit polyclonal Abs to c-Fos, c-Jun, or I�B-�; a mAb to phosphorylatedc-Jun (Ser63) from Santa Cruz Biotechnology; a rabbit polyclonal Ab toIL-1R-associated kinase (IRAK) from Upstate Biotechnology; and a rabbitpolyclonal Ab to actin (Sigma-Aldrich). Blots were then incubated with theappropriate HRP-conjugated secondary Abs and bands were revealed usingthe ECL-Plus detection system.

EMSA

Nuclear extraction was performed using NE-PER Nuclear and CytoplasmicExtraction Reagents according to the manufacturer’s instructions (Pierce).The AP-1 probe was prepared by biotin-labeling the double-stranded AP-1consensus sequence (Santa Cruz Biotechnology) using the Biotin 3�-EndDNA Labeling Kit (Pierce). Nuclear protein-DNA binding reactions wereconducted for 20 min at room temperature in a 20-�l volume containing 10mM Tris, 50 mM KCl, 1 mM DTT, 2.5% glycerol, 5 mM MgCl2, 1 �g/�lpoly(I:C), 1% Nonidet P-40, (all the reagents are included in the LightShiftChemiluminescent EMSA Kit; Pierce), 100 fM biotin-labeled AP-1 probe,and 5 �g of nuclear protein. Binding reactions were analyzed using 5%native PAGE. After blotting to a nylon membrane, labeled oligonucleotides

8070 ERYTHROMYCIN MODULATES DC FUNCTION

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

were detected with the LightShift Chemiluminescent EMSA Kit followingthe instructions of the manufacturer (Pierce).

Statistical analysis

All data are expressed as mean SEM. Differences between groups wereexamined for statistical significance using the Wilcoxon matched-pairssigned-ranks test. A p value �0.05 denoted a statistically significantdifference.

ResultsEffects of EM on the differentiation of monocytes into DCs

Immature DCs were derived from monocyte precursors isolatedfrom peripheral blood by culturing with GM-CSF and IL-4. By day5, a homogenous population of immature DCs was recovered,based upon expression of defining surface markers including highamounts of MHC class II, CD54, and CD1a, low levels of CD86,and practically no CD14 or CD83. The expression levels of thesurface molecules, including lineage markers such as CD1a andCD14, were not changed by exposure to EM, irrespective of theduration (Fig. 1 and data not shown), suggesting that EM did notalter the differentiation of monocytes into immature DCs, at leastin terms of surface marker phenotypes.

EM selectively inhibited the cytokine production of DCsstimulated with various TLR ligands

We next evaluated the capacity of EM-treated DCs to producecytokines in response to various TLR ligands. Immature DCs werepretreated with increasing concentrations of EM for 3 h and weresubsequently stimulated with PGN, poly(I:C), or LPS for 48 h inthe presence of EM. As shown in Fig. 2, there were striking dif-ferences in the cytokine-producing patterns of DCs that were ex-posed to the different stimuli; poly(I:C) and PGN preferentiallyinduced IL-12p70 and proinflammatory cytokine production, re-spectively, whereas LPS induced production of all cytokinestested, including IL-10, an anti-inflammatory cytokine (Fig. 2 andTable I). It is of note that treatment with EM did not affect the cellviability, but all cytokine production in response to poly(I:C) wassuppressed by EM in a concentration-dependent manner (Fig. 2and Table I). EM pretreatment also marginally but consistentlyinhibited LPS-mediated IL-12p70, IL-1�, and IL-10 production.However, EM did not show any inhibitory effects on PGN-medi-ated cytokine production.

EM selectively suppressed up-regulation of CD54 and CD86 onDCs induced by poly(I:C) and LPS but not by PGN

To examine the effect of EM on phenotypic maturation of DCsstimulated via different TLRs, the expression of CD83, CD86, andCD54 on DCs was analyzed by means of flow cytometry. All ofthe stimuli examined up-regulated the expression of CD83, CD86,and CD54 on DCs (Fig. 3). Interestingly, EM selectively inhibitedup-regulation of CD54 and CD86 induced by poly(I:C) or LPS butnot by PGN. These results support the notion that EM preferen-tially inhibits TLR3- and TLR4-mediated signaling pathwaysin DCs.

EM selectively impaired APC function of poly(I:C)-primed DCs

Different TLR ligands have been shown to differentially biashelper T cell responses by inducing distinct cytokine and costimu-latory molecules in DCs (13, 14, 21). We wondered whether EMaffects helper T cell differentiation indirectly through modulatingthe functional maturation of DCs. To this end, DCs were primedwith TLR ligands in the presence or absence of EM and then werecocultured with allogenic naive CD4� T cells without adding EM.As shown in Fig. 4A, the DCs primed with TLR ligands inducedproliferation of naive T cells, and pretreatment with EM did notaffect the T cell proliferation. However, EM pretreatment signifi-cantly decreased IFN-� production by naive T cells upon stimu-lation with poly(I:C)-primed DCs ( p � 0.05) and also tended tosuppress IFN-� upon stimulation with LPS-primed DCs ( p 0.06) (Fig. 4B). In contrast, EM treatment had no effect on IL-13production from naive T cells under any culture conditions (Fig.4C). In parallel with the results from the primary coculture, intra-cellular cytokine staining demonstrated that the pretreatment ofDCs with EM hampered the development of IFN-�-producing

FIGURE 1. Effects of EM on expression of surface markers of mono-cyte-derived DCs. Monocyte-derived DCs were prepared by culturing withGM-CSF and IL-4 for 5 days. The cells were treated with EM (100 �g/ml)for 24 h. Surface phenotypes of EM-treated DCs (thick lines) and non-treated ones (thin lines) were assessed by flow cytometry using specificmAbs (solid lines) or isotype control mAbs (dotted lines).

FIGURE 2. EM selectively suppressed cytokine production of DCsstimulated with poly(I:C) and LPS but not with PGN. Monocyte-derivedDCs were pretreated with the indicated concentrations of EM for 3 h andwere then stimulated with PGN (E), poly(I:C) (f), or LPS (F) or withoutany (�). After 48 h of stimulation, supernatants were tested by ELISA todetermine the production of IL-12p70, IL-10, and IL-6. Shown are themean SEM of five experiments. �, p � 0.05; ��, p � 0.03.

8071The Journal of Immunology

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

helper T cells, which had been induced by poly(I:C)- or LPS-primed DCs (Fig. 4D). IL-10 production was not detected eitherupon the primary coculture or upon restimulation (data not shown).

EM-modulated TLR expression on DCs

To reveal the inhibitory mechanisms of EM, we first examined themRNA expression of the TLRs by RT-PCR. As shown in Fig. 5,A and B, 6 h of EM treatment up- and down-regulated the mRNAexpression of TLR2 (97% increase) and of TLR3 (60% decrease),respectively, whereas EM did not affect the level of TLR4 mRNA.Next, the effects of EM on the protein expression levels of TLRswere analyzed by flow cytometry. Concordant with other reports(22–24), we detected little, if any TLR2 and TLR4 proteins onDCs, confirming that they were not up-regulated by EM treatment(data not shown). In contrast, TLR3 was detected only by intra-cellular staining and, consistent with the message levels, EMdown-regulated intracellular TLR3 expression at the protein level(Fig. 5C).

EM suppressed poly(I:C) induced NF-�B activation

Because the activity of NF-�B is controlled by I�B, we examinedwhether EM influenced the degradation of I�B-� by means ofWestern blot analysis (25). As shown in Fig. 6A, PGN, poly(I:C),and LPS reduced the amount of total I�B-�, indicating its degra-dation. EM pretreatment before stimulation with poly(I:C) pre-vented I�B-� degradation. However, I�B-� degradation inducedby PGN and LPS was not affected by EM. A multi-well colori-metric assay to quantify DNA binding activity of the transcriptionfactors showed that stimulation with PGN, poly(I:C), and LPSpreferentially up-regulated the activities of NF-�B p65 and p50(Fig. 6B). Inhibitory effects of EM were detected only in the

poly(I:C)-induced up-regulation of NF-�B p65 and in the p50activities.

Effects of EM on AP-1 activation

Induction of AP-1 activity generally requires phosphorylation ofc-Jun by JNK and transcriptional induction of the c-fos gene (26).We examined whether EM influenced the phosphorylation of c-Junand the accumulation of c-Fos proteins. As shown in Fig. 7, A andB, phosphorylation of c-Jun induced by poly(I:C) or LPS was notaffected by EM. LPS induced the accumulation of c-Fos protein,whereas poly(I:C) did little, if any (Fig. 7, C and D). EM pretreat-ment did not affect the c-Fos expression after stimulation withpoly(I:C), but it slightly enhanced the LPS-induced up-regulationof c-Fos.

Next, the modulation of DNA-binding activities of AP-1 com-plex by EM was tested by EMSA. Substantial induction of AP-1DNA-binding activity was found in the nuclear extracts from DCsstimulated with poly(I:C) or LPS. Consistent with the results ofWestern blot analysis, EM pretreatment did not inhibit or ratherenhanced the AP-1 DNA binding activities (data not show).

Effects of EM on IRF-3 activation and IFN-� productioninduced by poly(I:C) and LPS

TLR signaling pathways are separated into two groups: a MyD88-dependent pathway that leads to the activation of IRAK and aMyD88-independent pathway associated with the activation ofIRF-3 and subsequent induction of IFN-�. The latter pathway isinvolved in TLR3 and TLR4 signaling but not in TLR2 signaling(27–29). Consistent with these findings, DCs accumulated theIRF-3 phosphodimer, an active form of IRF-3, and producedIFN-� in response to poly(I:C) or LPS but not PGN (Fig. 8, A and

FIGURE 3. EM selectively inhibited the up-regula-tion of costimulatory molecules on DCs stimulated withpoly(I:C) and LPS but not with PGN. Monocyte-derivedDCs were pretreated with EM (100 �g/ml) for 3 h andwere then stimulated with PGN, poly(I:C), or LPS. After48 h of stimulation, the surface phenotypes of EM-treated DCs (thick lines) and nontreated DCs (thin lines)were assessed by flow cytometry using specific mAbs(solid lines) or by isotype control mAbs (dotted lines).Values represent the specific mean fluorescence inten-sity of the EM-treated DCs (top) and that of nontreatedDCs (bottom) (A). The specific mean fluorescence in-tensity (�MFI) of CD86 (B) and CD54 (C) of EM-treated DCs (f) and nontreated DCs (�) was calculatedby subtracting the isotype-matched control Ab fluores-cence. Shown are the mean SEM of five experiments.�, p � 0.05.

Table I. Effects of EM on proinflammatory cytokine productiona

EM pretreatment

TNF-� (ng/ml) IL-1� (pg/ml)

(�) (�) (�) (�)

Nil ND ND ND NDPGN 22.5 11.0 26.5 9.4 43.4 8.2 45.0 5.7Poly(I:C) 0.28 0.08 0.20 0.05� ND NDLPS 16.9 3.2 14.3 1.9 92.1 13.3 52.6 10.6�

a Monocyte-derived DCs were pretreated with 100 �g/ml EM for 3 h and were then stimulated. After 48 h of stimulation,supernatants were tested by ELISA. Shown are the mean SEM of five experiments. �, P � 0.05

8072 ERYTHROMYCIN MODULATES DC FUNCTION

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

B, and data not shown). EM pretreatment consistently inhibited theIRF-3 phosphodimer formation induced by poly(I:C) and LPSstimuli and suppressed IFN-� production.

Activation of the MyD88-dependent pathway is known to causeactivation of IRAK, as indicated by autophosphorylation and sub-sequent degradation of IRAK (30). EM-pretreated DCs showedLPS-induced IRAK-1 degradation similar to that of nontreatedcells (Fig. 8C), suggesting that TLR-mediated MyD88-dependentsignaling was not inhibited by EM. Considering these results

FIGURE 5. Effects of priming with EM on the expression of TLRs ofDCs. A, Total RNA was purified from monocyte-derived DCs treated withEM (100 �g/ml) for 6 h, and the expression of TLR2, TLR3, and TLR4mRNAs was determined by RT-PCR. The PCR products were electropho-resed in 1.5% agarose gels. Results represent six experiments. B, Expres-sion levels of TLR2, TLR3, and TLR4 mRNAs were determined by real-time quantitative PCR and were standardized by measuring expression of�-actin mRNA. The indicated relative expression levels were calculatedwith the formula 2���Ct. C, Intracellular levels of TLR3 in EM-treatedDCs (thick lines) and in nontreated DCs (thin lines) were assessed by flowcytometry using specific mAbs (solid lines) or isotype control mAbs (dot-ted lines). Values represent the specific mean fluorescence intensity of theEM-treated DCs (bottom) and that of nontreated DCs (top). Results rep-resent three experiments.

A

B

IκB-αActin

IκB-α

IκB-α

PGN

LPS

poly (I:C)

0 30 120 (min)

-

-

-

Actin

Actin

*

p50

PGN Poly(I:C)

LPS

EM 0 minNil 0 min

EM 30 minNil 30 min

EM120 min Nil 120 min

p65

0PGN Poly

(I:C) LPS

1

2

3

OD

450

OD

450

*

0

1

2

3

0

1

2

3

EM-pre-treatment

FIGURE 6. EM selectively suppressed NF-�B activation induced bypoly(I:C) but not by PGN. Monocyte-derived DCs were pretreated withEM and were then stimulated with PGN, poly(I:C), or LPS for the indi-cated periods of time. A, Equal amounts of whole cell lysates (10 �g) wereseparated on SDS-PAGE, and Western blots were performed as indicatedto evaluate degradation of I�B-�. Blots were stripped and reblotted toevaluate actin. Results represent three experiments. B, Nuclear extracts (7�g) were tested for binding of the activated NF-�B subunits to an NF-�Bconsensus sequence using the Trans-AM NF-�B family transcription factorassay kit. Shown are the mean SEM of three experiments.

FIGURE 4. Effects of EM on the acquisition of T cellstimulatory activity of TLR ligand-primed DCs. Mono-cyte-derived DCs were pretreated with (f) or without(�) EM (100 �g/ml) for 3 h and were then primed withPGN, poly(I:C), or LPS for 48 h. Cells were then ex-tensively washed and were cocultured with allogenic na-ive CD4� T cells (DCs, 2 � 104 cells/well; naive Tcells, 2 � 105 cells/well). Cell proliferation was deter-mined by thymidine uptake (A). IFN-� (B) and IL-13(C) production was measured in the supernatants of thecoculture. Shown are the mean SEM of five experi-ments. �, p � 0.05. After 5 days of the coculture, in-tracellular cytokine profiles of the T cells were analyzedby flow cytometry (D). The percentages of the respec-tive cytokine-producing T cells are indicated. Resultsrepresent four experiments.

8073The Journal of Immunology

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

collectively, it appears that EM may affect the MyD88-indepen-dent/IRF-3-mediated pathway.

DiscussionThere is now emerging evidence that NF-�B and AP-1 are in-volved in the immunomodulating effects of macrolide antibiotics(4, 5, 8). However, it remains unclear where the molecular basisfor the effects lies in the signaling pathway for transcription factoractivation. TLR signaling pathways have been shown to consist, atleast, of a MyD88-dependent pathway that seems to be common toall TLRs and a MyD88-independent pathway that is peculiar to theTLR3 and TLR4 signaling pathways (15, 29–32). Because to dateno interaction between MyD88 and TLR3 upon poly(I:C) stimu-lation has been observed, TLR3 signaling appears to dependmainly on the MyD88-independent pathway (30). TLR2 signalinghas been shown to completely depend on MyD88, whereas LPS-induced TLR4 signaling diverges into two signaling cascades: aMyD88-dependent pathway that leads to the production of proin-flammatory cytokines with quick activation of NF-�B and MAPKand a MyD88-independent pathway associated with the activationof IRF-3, subsequent induction of IFN-�, and maturation of DCs,with delayed activation of NF-�B and MAPK (16, 29, 33–35). Inthis study, EM selectively inhibited TLR3- and TLR4-mediatedcytokine production and up-regulation of costimulatory molecules

on monocyte-derived DCs but not on TLR2-mediated ones. Thisindicates that interaction of EM either with NF-�B proteins per seor with transcription factor binding sites could not account for theinhibitory activity of EM. It is conceivable that a pathway commonto TLR3 and TLR4 signaling, but not shared with TLR2 signaling,might be a target for the action of EM.

The recent analysis of Toll/IL-1R domain-containing adaptor-inducing IFN-� (TRIF)/Toll/IL–1R domain–containing adaptormolecule-1 (TICAM-1)-deficient mice showed the essential role ofTRIF/TICAM-1 in the MyD88-independent pathways of TLR3and TLR4 signaling (29, 33, 34). TRIF/TICAM-1-deficient micewere defective in TLR3-mediated NF-�B and IRF-3 activation, aswell as TLR4-mediated IRF-3 activation. Interestingly, TRIF-defi-cient mice had a diminished response to LPS in terms of producingcytokines whose production was considered to be mediated by theMyD88-dependent pathway. In contrast, all TLR4-mediated re-sponses were abrogated only in TRIF/TICAM-1-MyD88 double-de-ficient cells. These findings indicate that the inhibitory activity of EMon cytokine production may be the result of a suppressed TRIF/TI-CAM-1 cascade. To support this notion, IRF-3 activation and IFN-�production, which occur downstream of TRIF/TICAM-1 signaling,were decreased by EM, but I�B-� degradation, which occurs 10 minafter stimulation with LPS and is related to early NF-�B activation

FIGURE 8. EM inhibited activation of IRF-3 andIFN-� production in response to poly(I:C) and LPS.Monocyte-derived DCs were pretreated with (f) orwithout (�) EM and were then stimulated with PGN,poly(I:C), or LPS for the indicated periods of time.Equal amounts of whole cell lysates (10 �g) were sep-arated on native-PAGE and SDS-PAGE. Western blotswere performed to evaluate phosphodimerization ofIRF-3 (A) and IRAK (C). Blots were stripped and re-blotted to evaluate total actin. The histogram representsthe density of the phosphodimer IRF-3 bands (A) and ofthe IRAK bands (C). B, After 24 h of stimulation, cul-ture supernatants were tested by ELISA to determine theproduction of IFN-�. Shown are the mean SEM offive experiments. n.d., Not detectable; �, p � 0.05; ��,p � 0.01.

FIGURE 7. Effects of EM on activation of AP-1.Monocyte-derived DCs were pretreated with or withoutEM and were then stimulated with poly(I:C) (A and C)or LPS (B and D) for the indicated periods of time.Equal amounts of whole cell lysates (30 �g) were sep-arated on SDS-PAGE, and Western blots were per-formed as indicated to evaluate phosphorylated c-Jun (Aand B) and c-Fos (C and D). Blots were stripped andreblotted to evaluate total c-Jun (A and B) and total actin(C and D). Results represent four experiments.

8074 ERYTHROMYCIN MODULATES DC FUNCTION

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

through the MyD88-dependent pathway, was not affected by EMtreatment (data not shown). The faint inhibitory effect of EM on LPS-induced IL-12 production might be explained by compensatoryNF-�B activation from MyD88-dependent signaling.

It is known that the interaction of LPS with TLR4 on DCs leadsto phosphorylation and activation of three major MAPKs, i.e.,ERK, JNK, and p38 MAPK (36). The ERK and p38 MAPK path-ways are shown to have opposite effects on DC maturation inresponse to LPS (37). However, the relationships and interactionamong these MAPKs and TRIF/IRF-3 signaling pathways are notfully understood. A p38 MAPK inhibitor restores the activity ofERK suppressed by LPS during the differentiation of monocytesinto DCs (38). Anthrax lethal toxin inhibits LPS-mediated IRF-3activation and subsequent cytokine production by interfering theactivation of p38 MAPK (39). Of the various MAPK pathways, thep38 MAPK signaling cascade seems to have the most importantrole in the generation of type I IFN-mediated signals (40). BecauseEM inhibited LPS-mediated IRF-3 activation and IFN-� produc-tion, EM might also inhibit p38 MAPK activation, resulting in areciprocal up-regulation of ERK activity. The expression of c-Fosis induced by ternary complex factors, which are activated throughphosphorylation by ERK (41). It is conceivable that the enhancedAP-1 activity in EM-pretreated cells was the result of the enhancedERK/c-Fos cascade (Fig. 7).

It has been reported that TLR2 and TLR4 mRNA are coordi-nately expressed in DCs stimulated by inflammatory signals,whereas TLR3 mRNA expression is regulated independently (23,42). Type I IFN is known to up-regulate TLR3 mRNA in DCs(43). EM inhibited IFN-� production of DCs in response topoly(I:C) and selectively suppressed the constitutive TLR3 expres-sion at the mRNA and protein levels. Thus, the suppression ofIFN-�-driven TLR3 expression as well as the constitutive onemight partially account for the inhibitory effects of EM on poly(I:C)-induced activation of DCs.

It has been shown that different TLR ligands instruct DCs toinduce distinct Th responses via modulation of cytokine-producingability and costimulatory molecule expression (13, 14, 21). Con-sistent with this notion, naive T cells stimulated with allogenicDCs that were primed with different TLR ligands exhibit a distinctcytokine-producing profile: poly(I:C)-primed DCs induced naive Tcells to produce higher IFN-� and lower IL-13 than did PGN-primed DCs. EM pretreatment significantly decreased IFN-� pro-duction and Th1 differentiation of naive T cells, when they werestimulated with poly(I:C)- or LPS-primed DCs. Contrarily, EMpretreatment did not affect the cytokine production profile of naiveT cells stimulated with PGN-primed DCs. Because IL-12 is a Th1-promoting cytokine and CD54-mediated costimulation enhancesthe acquisition of IFN-�-producing ability, the selective effects ofEM on IL-12 and CD54 expression could partially account for theimpaired ability of TLR-primed DCs to induce IFN-�-producing Tcells (44, 45). Thus, EM might attenuate Th1-type immune re-sponses in RNA virus infection and endotoxin exposure by mod-ulating DC activation. Several studies have shown that respiratoryvirus infections and colonization of Pseudomonas aeruginosa, aGram-negative bacteria, are associated with the exacerbation ofchronic obstructive pulmonary diseases and diffuse panbronchiol-itis, respectively (46, 47). The modulation of Th1 responses by EMmay serve as one explanation for the beneficial effects of macro-lides in patients with these Th1-mediated chronic pulmonary dis-eases (48, 49). In fact, the IFN-� level in the bronchoalveolarlavage fluid from patients with diffuse panbronchiolitis is signifi-cantly decreased after long-term EM treatment (49).

In conclusion, EM selectively suppressed TLR-mediated cyto-kine production, including an anti-inflammatory cytokine, IL-10,and altered T cell responses through modulating DC function.Thus, EM acts as an immunomodulator rather than a simple anti-biotic. Because accumulating evidence supports the idea that DCsare deeply involved in chronic airway inflammation, the immuno-modulating effect of EM on DCs may be beneficial to control thesediseases (50). Our findings may provide clues for designing newdrugs to treat chronic airway inflammation, such as that seen inpatients with diffuse panbronchiolitis or chronic obstructive pul-monary diseases.

DisclosuresThe authors have no financial conflict of interest.

References1. Culic, O., V. Erakovic, and M. J. Parnham. 2001. Anti-inflammatory effects of

macrolide antibiotics. Eur. J. Pharmacol. 429: 209–229.2. Rubin, B. K., and M. O. Henke. 2004. Immunomodulatory activity and effec-

tiveness of macrolides in chronic airway disease. Chest 125: 70S–78S.3. Jaffe, A., and A. Bush. 2001. Anti-inflammatory effects of macrolides in lung

disease. Pediatr. Pulmonol. 31: 464–473.4. Ichiyama, T., M. Nishikawa, T. Yoshitomi, S. Hasegawa, T. Matsubara,

T. Hayashi, and S. Furukawa. 2001. Clarithromycin inhibits NF-�B activation inhuman peripheral blood mononuclear cells and pulmonary epithelial cells. Anti-microb. Agents Chemother. 45: 44–47.

5. Aoki, Y., and P. N. Kao. 1999. Erythromycin inhibits transcriptional activation ofNF-�B, but not NFAT, through calcineurin-independent signaling in T cells.Antimicrob. Agents Chemother. 43: 2678–2684.

6. Takizawa, H., M. Desaki, T. Ohtoshi, S. Kawasaki, T. Kohyama, M. Sato,M. Tanaka, T. Kasama, K. Kobayashi, J. Nakajima, and K. Ito. 1997. Erythro-mycin modulates IL-8 expression in normal and inflamed human bronchial epi-thelial cells. Am. J. Respir. Crit. Care Med. 156: 266–271.

7. Desaki, M., H. Takizawa, T. Ohtoshi, T. Kasama, K. Kobayashi, T. Sunazuka,S. Omura, K. Yamamoto, and K. Ito. 2000. Erythromycin suppresses nuclearfactor-�B and activator protein-1 activation in human bronchial epithelial cells.Biochem. Biophys. Res. Commun. 267: 124–128.

8. Desaki, M., H. Okazaki, T. Sunazuka, S. Omura, K. Yamamoto, andH. Takizawa. 2004. Molecular mechanisms of anti-inflammatory action of eryth-romycin in human bronchial epithelial cells: possible role in the signaling path-way that regulates nuclear factor-�B activation. Antimicrob. Agents Chemother.48: 1581–1585.

9. Kapsenberg, M. L. 2003. Dendritic-cell control of pathogen-driven T-cell polar-ization. Nat. Rev. Immunol. 3: 984–993.

10. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan,and Y. J. Liu. 2001. Subsets of human dendritic cell precursors express differentToll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:863–869.

11. Re, F., and J. L. Strominger. 2001. Toll-like receptor 2 (TLR2) and TLR4 dif-ferentially activate human dendritic cells. J. Biol. Chem. 276: 37692–37699.

12. Reis e Sousa, C. 2004. Toll-like receptors and dendritic cells: for whom the bugtolls. Semin. Immunol. 16: 27–34.

13. Agrawal, S., A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, T. Van Dyke, andB. Pulendran. 2003. Cutting edge: different Toll-like receptor agonists instructdendritic cells to induce distinct Th responses via differential modulation of ex-tracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos.J. Immunol. 171: 4984–4989.

14. Dillon, S., A. Agrawal, T. Van Dyke, G. Landreth, L. McCauley, A. Koh,C. Maliszewski, S. Akira, and B. Pulendran. 2004. A Toll-like receptor 2 ligandstimulates Th2 responses in vivo, via induction of extracellular signal-regulatedkinase mitogen-activated protein kinase and c-Fos in dendritic cells. J. Immunol.172: 4733–4743.

15. Takeda, K., and S. Akira. 2005. Toll-like receptors in innate immunity. Int. Im-munol. 17: 1–14.

16. Kaisho, T., O. Takeuchi, T. Kawai, K. Hoshino, and S. Akira. 2001. Endotoxin-induced maturation of MyD88-deficient dendritic cells. J. Immunol. 166:5688–5694.

17. Kobayashi, T., P. T. Walsh, M. C. Walsh, K. M. Speirs, E. Chiffoleau,C. G. King, W. W. Hancock, J. H. Caamano, C. A. Hunter, P. Scott, L. A. Turka,and Y. Choi. 2003. TRAF6 is a critical factor for dendritic cell maturation anddevelopment. Immunity 19: 353–363.

18. Hoshino, K., T. Kaisho, T. Iwabe, O. Takeuchi, and S. Akira. 2002. Differentialinvolvement of IFN-� in Toll-like receptor-stimulated dendritic cell activation.Int. Immunol. 14: 1225–1231.

19. Omata, N., M. Yasutomi, A. Yamada, H. Iwasaki, M. Mayumi, and Y. Ohshima.2002. Monocyte chemoattractant protein-1 selectively inhibits the acquisition ofCD40 ligand-dependent IL-12-producing capacity of monocyte-derived dendriticcells and modulates Th1 immune response. J. Immunol. 169: 4861–4866.

20. Iwamura, T., M. Yoneyama, K. Yamaguchi, W. Suhara, W. Mori, K. Shiota,Y. Okabe, H. Namiki, and T. Fujita. 2001. Induction of IRF-3/-7 kinase andNF-�B in response to double-stranded RNA and virus infection: common andunique pathways. Genes Cells 6: 375–388.

8075The Journal of Immunology

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

21. Redecke, V., H. Hacker, S. K. Datta, A. Fermin, P. M. Pitha, D. H. Broide, andE. Raz. 2004. Activation of Toll-like receptor 2 induces a Th2 immune responseand promotes experimental asthma. J. Immunol. 172: 2739–2743.

22. Hertz, C. J., S. M. Kiertscher, P. J. Godowski, D. A. Bouis, M. V. Norgard,M. D. Roth, and R. L. Modlin. 2001. Microbial lipopeptides stimulate dendriticcell maturation via Toll-like receptor 2. J. Immunol. 166: 2444–2450.

23. Visintin, A., A. Mazzoni, J. H. Spitzer, D. H. Wyllie, S. K. Dower, andD. M. Segal. 2001. Regulation of Toll-like receptors in human monocytes anddendritic cells. J. Immunol. 166: 249–255.

24. Matsumoto, M., K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto,A. Yamamoto, and T. Seya. 2003. Subcellular localization of Toll-like receptor3 in human dendritic cells. J. Immunol. 171: 3154–3162.

25. Li, Q., and I. M. Verma. 2002. NF-�B regulation in the immune system. Nat. Rev.Immunol. 2: 725–734.

26. Shaulian, E., and M. Karin. 2002. AP-1 as a regulator of cell life and death. Nat.Cell. Biol. 4: E131–E136.

27. Doyle, S. E., S. A. Vaidya, R. O’Connell, H. Dadgostar, P. W. Dempsey, T.-T.Wu, G. Rao, R. Sun, M. E. Haberland, R. L. Modlin, and G. Cheng. 2002. IRF3mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17: 251–263.

28. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang,B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, and S. N. Vogel. 2002.TLR4, but not TLR2, mediates IFN-�-induced STAT1�/�-dependent gene ex-pression in macrophages. Nat. Immunol. 3: 392–398.

29. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo,O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role ofadaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway.Science 301: 640–643.

30. Jiang, Z., M. Zamanian-Daryoush, H. Nie, A. M. Silva, B. R. Williams, andX. Li. 2003. Poly(I-C)-induced Toll-like receptor 3 (TLR3)-mediated activationof NF�B and MAP kinase is through an interleukin-1 receptor-associated kinase(IRAK)-independent pathway employing the signaling components TLR3-TRAF6-TAK1-TAB2-PKR. J. Biol. Chem. 278: 16713–16719.

31. Oshiumi, H., M. Sasai, K. Shida, T. Fujita, M. Matsumoto, and T. Seya. 2003.TIR-containing adapter molecule (TICAM)-2, a bridging adapter recruiting toToll-like receptor 4 TICAM-1 that induces interferon-�. J. Biol. Chem. 278:49751–49762.

32. Yamamoto, M., S. Sato, H. Hemmi, S. Uematsu, K. Hoshino, T. Kaisho,O. Takeuchi, K. Takeda, and S. Akira. 2003. TRAM is specifically involved inthe Toll-like receptor 4-mediated MyD88-independent signaling pathway. Nat.Immunol. 4: 1144–1150.

33. Oshiumi, H., M. Matsumoto, K. Funami, T. Akazawa, and T. Seya. 2003. TI-CAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediatedinterferon-� induction. Nat. Immunol. 4: 161–167.

34. Hoebe, K., X. Du, P. Georgel, E. Janssen, K. Tabeta, S. O. Kim, J. Goode, P. Lin,N. Mann, S. Mudd, et al. 2003. Identification of Lps2 as a key transducer ofMyD88-independent TIR signalling. Nature 424: 743–748.

35. Wang, Q., R. Dziarski, C. J. Kirschning, M. Muzio, and D. Gupta. 2001. Micro-cocci and peptidoglycan activate TLR23MyD883 IRAK3TRAF3

NIK3 IKK3NF-�B signal transduction pathway that induces transcription ofinterleukin-8. Infect. Immun. 69: 2270–2276.

36. Arrighi, J. F., M. Rebsamen, F. Rousset, V. Kindler, and C. Hauser. 2001. Acritical role for p38 mitogen-activated protein kinase in the maturation of humanblood-derived dendritic cells induced by lipopolysaccharide, TNF-�, and contactsensitizers. J. Immunol. 166: 3837–3845.

37. Puig-Kroger, A., M. Relloso, O. Fernandez-Capetillo, A. Zubiaga, A. Silva,C. Bernabeu, and A. L. Corbi. 2001. Extracellular signal-regulated protein kinasesignaling pathway negatively regulates the phenotypic and functional maturationof monocyte-derived human dendritic cells. Blood 98: 2175–2182.

38. Xie, J., J. Qian, S. Wang, M. E. Freeman, III, J. Epstein, and Q. Yi. 2003. Noveland detrimental effects of lipopolysaccharide on in vitro generation of immaturedendritic cells: involvement of mitogen-activated protein kinase p38. J. Immunol.171: 4792–4800.

39. Dang, O., L. Navarro, K. Anderson, and M. David. 2004. Cutting edge: anthraxlethal toxin inhibits activation of IFN-regulatory factor 3 by lipopolysaccharide.J. Immunol. 172: 747–751.

40. Platanias, L. C. 2005. Mechanisms of type-I- and type-II-interferon-mediatedsignalling. Nat. Rev. Immunol. 5: 375–386.

41. Eferl, R., and E. F. Wagner. 2003. AP-1: a double-edged sword in tumorigenesis.Nat. Rev. Cancer 3: 859–868.

42. Muzio, M., D. Bosisio, N. Polentarutti, G. D’Amico, A. Stoppacciaro,R. Mancinelli, C. van’t Veer, G. Penton-Rol, L. P. Ruco, P. Allavena, andA. Mantovani. 2000. Differential expression and regulation of Toll-like receptors(TLR) in human leukocytes: selective expression of TLR3 in dendritic cells.J. Immunol. 164: 5998–6004.

43. Heinz, S., V. Haehnel, M. Karaghiosoff, L. Schwarzfischer, M. Muller,S. W. Krause, and M. Rehli. 2003. Species-specific regulation of Toll-like re-ceptor 3 genes in men and mice. J. Biol. Chem. 278: 21502–21509.

44. Moser, M., and K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2development. Nat. Immunol. 1: 199–205.

45. Smits, H. H., E. C. de Jong, J. H. Schuitemaker, T. B. Geijtenbeek, Y. van Kooyk,M. L. Kapsenberg, and E. A. Wierenga. 2002. Intercellular adhesion molecule-1/LFA-1 ligation favors human Th1 development. J. Immunol. 168: 1710–1716.

46. Suzuki, T., M. Yanai, M. Yamaya, T. Satoh-Nakagawa, K. Sekizawa, S. Ishida,and H. Sasaki. 2001. Erythromycin and common cold in COPD. Chest 120:730–733.

47. Schultz, M. J. 2004. Macrolide acitivties beyond their antimicrobial effects: mac-rolides in diffuse panbronchiolitis and cystic fibrosis. J. Antimicrob. Chemother.54: 21–28.

48. Barnes, P. J., and M. G. Cosio. 2004. Characterization of T lymphocytes inchronic obstructive pulmonary disease. PLoS Med. 1:e20.

49. Park, S. J., Y. C. Lee, Y. K. Rhee, and H. B. Lee. 2002. The effect of long-termtreatment with erythromycin on Th1 and Th2 cytokines in diffuse panbronchiol-itis. Biochem. Biophys. Res. Commun. 324: 114–117.

50. Todate, A., K. Chida, T. Suda, S. Imokawa, J. Sato, K. Ide, T. Tsuchiya, N. Inui,Y. Nakamura, K. Asada, H. Hayakawa, and H. Nakamura. 2000. Increased num-bers of dendritic cells in the bronchiolar tissues of diffuse panbronchiolitis.Am. J. Respir. Crit. Care Med. 162: 148–153.

8076 ERYTHROMYCIN MODULATES DC FUNCTION

by guest on April 10, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from