evaluation of four phloem-specific promoters in...

© The Author 2012. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]

Tree Physiology 32, 83–93doi:10.1093/treephys/tpr130

Evaluation of four phloem-specific promoters in vegetative tissues of transgenic citrus plants

M. Dutt, G. Ananthakrishnan, M.K. Jaromin, R.H. Brlansky and J.W. Grosser1

Citrus Research and Education Center, University of Florida-IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850, USA; 1Corresponding author ([email protected])

Received July 8, 2011; accepted November 15, 2011; published online January 6, 2012; handling Editor Chunyang Li

‘Mexican’ lime (Citrus aurantifolia Swingle) was transformed with constructs that contained chimeric promoter-gus gene fusions of phloem-specific rolC promoter of Agrobacterium rhizogenes, Arabidopsis thaliana sucrose-H+ symporter (AtSUC2) gene promoter of Arabidopsis thaliana, rice tungro bacilliform virus (RTBV) promoter and sucrose synthase l (RSs1) gene promoter of Oryza sativa (rice). Histochemical β-glucuronidase (GUS) analysis revealed vascular-specific expression of the GUS protein in citrus. The RTBV promoter was the most efficient promoter in this study while the RSs1 promoter could drive low levels of gus gene expression in citrus. These results were further validated by reverse transcription real-time polymerase chain reaction and northern blotting. Southern blot analysis confirmed stable transgene integration, which ranged from a single insertion to four copies per genome. The use of phloem-specific promoters in citrus will allow targeted transgene expression of antibacterial constructs designed to battle huanglongbing disease (HLB or citrus greening disease), associated with a phloem-limited Gram-negative bacterium.

Keywords: Agrobacterium tumefaciens, AtSUC2, citrus, GUS, Mexican lime, rolC, RSs1, RTBV, transformation.

Introduction

In plant transformation studies, constitutive promoters are commonly used to target gene expression throughout the plant. These promoters can be obtained from numerous sources such as viruses (the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al. 1985) or figwort mosaic virus (FMV) promoter (Maiti et al. 1997)); bacteria (the Agrobacterium tumefaciens Ti plasmid mannopine synthetase (mas) promoter (DiRita and Gelvin, 1987) or nopaline synthase (NOS) pro-moter (Bevan et al. 1983)); or plants (the Arabidopsis thaliana Act 2 promoter (An et al. 1996) or Medicago truncatula MtHP promoter (Xiao et al. 2005)). In certain cases constitutive expression of a transgene may not be necessary, especially in cases where gene expression in a particular organ is sufficient to obtain desired results. Targeting transgenes in vascular organs for example is sufficient to express defense-related proteins and/or peptides which could potentially con-fer resistance to pathogens that attack the vascular tissues (Guo et al. 2004).

Several promoters that target phloem-specific gene expres-sion have been described. These promoter elements are gener-ally associated with genes that express specifically in phloem cells or from organisms that are phloem limited. The sucrose syn-thase protein has been observed to be localized in phloem cells (Nolte and Koch 1993) and its expression has been closely linked with vascular bundles (Hawker and Hatch 1965). Several promoters derived from sucrose synthase genes such as sucrose synthase l of rice (Wang et al. 1992) or maize (Yang and Russell, 1990) have been shown to be active in heterologous systems (Yang and Russell 1990; Shi et al. 1994). In addition, the Arabidopsis sucrose-H+ symporter AtSUC2 has been described to be a phloem-loading transporter (Sauer and Stolz 1994) and has been observed to target phloem-specific gene expression in Arabidopsis, tobacco and strawberry (Truernit and Sauer 1995, Imlau et al. 1999, Zhao et al. 2004). The Glycine max sucrose-binding protein (GmSBP2) promoter and the Robinia pseudoaca-cia inner-bark lectin promoter also expressed β-glucuronidase (GUS) in the phloem of transgenic tobacco (Yoshida et al. 2002,

Research paper

at University of Florida on February 18, 2012

http://treephys.oxfordjournals.org/D

ownloaded from

http://treephys.oxfordjournals.org/

Tree Physiology Volume 32, 2012

Waclawovsky et al. 2006). The phloem protein 2 is a major pro-tein present in most plant species (for a review, see Dinant et al. 2003) and phloem-specific PP2 promoters have been isolated and characterized (Jiang et al. 1999, Thompson and Larkins 1996, Guo et al. 2004). The Agrobacterium rhizogenes rolC pro-moter (Schmulling et al. 1989) is a strong bacterium-derived phloem promoter. Several viruses also contain promoters that contain cis elements resulting in phloem-specific expression. Promoters from coconut foliar decay virus (Rohde et al. 1995), rice tungro bacilliform virus (RTBV; Bhattacharyya-Pakrasi et al. 1993), commelina yellow mottle virus (Medberry et al. 1992) or wheat dwarf geminivirus (Dinant et al. 2004) have been demon-strated to drive phloem-specific gene expression.

Transgenic approaches to engineer citrus plants that can resist the many abiotic and biotic stresses have gained impor-tance in recent years. This is due to numerous new problems being faced by the industry. In Florida, the major disease cur-rently affecting citrus is citrus greening or huanglongbing (HLB) associated with ‘Candidatus Liberibacter asiaticus’, a phloem-limited bacterium (Chung and Brlansky 2009). This disease results in substantial economic losses to Florida’s citrus industry. Huanglongbing affects all cultivated citrus varieties and genetic resistance is not present in commercial orange and grapefruit cultivars in Florida. Targeting of a defense-related protein to combat HLB would be desirable to maximize its expression to phloem and reduce or minimize expression in other parts of the plant, including fruit and juice subsequently consumed by humans (Shi et al. 1994). Targeting of the defense protein would also decrease metabolic load on the plant (Glick 1995).

The purpose of this study was to evaluate the activity of four phloem-specific promoters in citrus. We transformed in vitro derived epicotyl segments of ‘Mexican’ lime (Citrus aurantifolia Swingle) and regenerated several plants with constructs con-taining rolC promoter of A. rhizogenes, RTBV promoter of the rice tungro bacilliform virus, RSs1 promoter of rice and AtSUC2 promoter of A. thaliana.

Materials and methods

Cloning of promoter fragments

Genomic DNA of A. thaliana ‘Col 0’ ecotype was used as tem-plate for isolation of AtSUC2 promoter. AtSUC2 sequence was amplified by polymerase chain reaction (PCR) using AtSUC2-

specific oligonucleotide primers (AT-F and AT-R; presented in Table 1). The forward primer introduced a HindIII site immediately upstream of the promoter fragment while the reverse primer introduced a BamHI site downstream. Similarly, RSs1 promoter fragment (1931 bp) was cloned from Oryza sativa ‘Carolina Gold’ using RSs1-F and RSs1-R primers, and rolC promoter fragment (882 bp) was cloned from A. rhizogenes plasmid pRiA4 using RC-F and RC-R primers (Table 1). Both RSs1 and rolC promoters were also modified to introduce a HindIII site immediately upstream of the promoter fragment and a BamHI site down-stream. The RTBV promoter was PCR amplified from plasmid pMB1709 (Yin and Beachy 1995) using RTV-F and RTV-R prim-ers to introduce KpnI immediately upstream of the promoter frag-ment and a BglII site downstream. All PCR products were amplified with Ex Taq Polymerase (Clontech Laboratories, Inc., Mountain View, CA, USA). The promoter fragments were isolated, purified and cloned into pGEM®-T Easy plasmid vector (Promega Corp., Madison, WI, USA). The cloned promoters were verified first by restriction enzyme analysis and then by DNA sequencing performed at the Interdisciplinary Center for Biotechnology Research (ICBR), University of Florida, Gainesville, FL, USA.

Construction of expression vectors

The 35S promoter of the nptII marker gene in pCAMBIA2300 (Cambia, Canberra, Australia) was excised as an EcoRI/NcoI fragment and replaced with an NOS promoter to form the plas-mid pCAM-NOS. A BamHI/EcoRI fragment containing a gus gene with the CaMV 35S terminator (35S-3′) from a pUC18-derived plasmid pDRG was cloned into a unique BamHI/EcoRI site of pCAM-NOS to form a promoterless binary plasmid, pCAM-PROM. This binary plasmid was used for subsequent cloning of all promoter fragments upstream of the gus gene to produce the binary plasmids pCAM-AtSUC, pCAM-RSs1, pCAM-rolC and pCAM-RTBV. pBI434 (Datla et al. 1991) containing a gus-nptII fusion gene under the control of a 35S promoter was used as control. Binary plasmids (Figure 1) were introduced into A. tumefaciens strain EHA105 (Hood et al. 1993) by the freeze–thaw method (Burrow et al. 1990).

Plant transformation

Nucellar seedlings of ‘Mexican’ lime (C. aurantifolia Swingle) were used for transformation as described by Dutt and Grosser (2009). Agrobacterium EHA105 cultures containing a binary

84 Dutt et al.

Table 1. Sequence of primers used to amplify the phloem-specific promoters and to detect the presence of nptII gene.

Promoter/gene Name Forward primer 5′→3′ Name Reverse primer 5′→3′ Amplicon length (bp)

AtSUC2 AT-F AAGCTTGCAAAATAGCACACCATTTATG AT-R AGGATCCTTTGACAAACCAAGAAAGTAAG 954RSs1 RSs1-F TCAAGCTTCAATCCACCAAATCAAAC RSs1-R AGGATCCCATGACTCAATTTCAGGAAC 1931rolC RC-F AAAGCTTAAAGTTGGCCCGCTATTG RC-R TAGGATCCGTTAACAAAGTAGGAAACAGG 882RTBV RTV-F AGGATCCTTTGACAAACCAAGAAAGTAAG RTV-R AGATCTTGCTCTCTTAGAAGTTTGAGC 77035S 35S-F AAGCTTCGGATTCCATTGCCCAGC 35S-R CCCTCTAGACCATGGTGGAAGTATTTGA 650nptII NP-F ATCCATCATGGCTGATGCAATGCG NP-R AACTCGTCAAGAAGGCGATAGAAGGC 450



ownloaded from


Tree Physiology Online at http://www.treephys.oxfordjournals.org

plasmid were grown in liquid YEP medium supplemented with 100 mg l−1 kanamycin and 50 mg l−1 rifampicin for ~24 h with shaking. Two milliliters of overnight culture were pipetted into 48 ml of YEP medium containing appropriate antibiotics and 100 µM acetosyringone. Cultures were incubated for an addi-tional 3 h at 28 °C. After centrifugation, the pellet was resus-pended in liquid co-cultivation medium (CM). Optical density (600 nm) was measured with a CO8000 cell density meter (WPA, Cambridge, UK) and adjusted to 0.3 before incubation with cut epicotyl ‘Mexican’ lime segments. Explants were incu-bated on solid CM medium for 2 days before transfer to shoot regeneration (RM) medium. RM medium contained Murashige and Skoog (MS) medium (Murashige and Skoog 1962) supple-mented with 13.2 µM 6-benzylaminopurine and 2.5 µM naph-thyleneacetic acid. The medium was supplemented with 0.5 g l−1 2-(N-morpholino) ethanesulfonic acid, 30 g l−1 sucrose and 8 g l−1 agar. pH was adjusted to 5.8 before autoclaving. Antibiotics added to cooled medium included kanamycin (100 mg l−1) and timentin (400 mg l−1).

Transgenic plant regeneration

Emerging ‘Mexican’ lime shoots in RM medium were excised and placed onto shoot elongation medium (RMG) for an additional 4 weeks (Dutt and Grosser 2009). Antibiotics added to this medium included kanamycin (75 mg l−1) and timentin (200 mg l−1). Elongated shoots that survived selection were sub-sequently tested for nptII expression using PCR. nptII- positive shoots were excised and transferred into rooting medium (RMM) containing 50 mg l−1 kanamycin. After 2 months in this medium,

well-rooted shoots were transferred into a peat-based commer-cial potting medium (Metromix 500, Sun Gro Horticulture, Bellevue, WA, USA) and acclimated to greenhouse conditions.

Polymerase chain reaction and Southern blot analysis

Genomic DNA from 12-month-old greenhouse-grown trans-genic plants was isolated. Young leaves (100 mg) were used for DNA extraction using the GenElute™ Plant Genomic DNA Miniprep Kit (Sigma-Aldrich Corp., St Louis, MO, USA). Duplex PCR to confirm presence of promoter was carried out using GoTaq® Green Master PCR Mix (Promega Corp., Madison, WI, USA) and the primers outlined in Table 1. In addition, primers to amplify a fragment of the nptII gene were included. Amplified DNA fragments were electrophoresed on a 1% agarose gel containing GelRedTM Nucleic Acid Gel Stain (Biotium Inc., Hayward, CA, USA) and visualized under ultraviolet light.

Southern blot analysis was carried out for confirmation of copy number in selected transgenic citrus plants. Genomic DNA was isolated using the Qiagen DNeasy Plant Maxi Kit (Qiagen, Valencia, CA, USA). EcoRI digested genomic DNA (15 µg) was immobilized on a positively charged nylon membrane and probed with a DIG-labeled gus probe. Following hybridization to the probe, chemilu-minescence substrate CDP-Star was used for immunological detection of hybridization signals using X-ray film autography.

Reverse transcription real-time PCR assay

RNA was isolated from 100 mg of leaf tissue using an RNeasy Mini Kit (Qiagen). After treatment with DNAse 1 (Qiagen) to remove con-taminating DNA, RNA was quantified spectrophotometrically. RNA

Evaluation of phloem-specific promoters in citrus 85

Figure 1. Schematic representation of the T-DNA region of the binary vectors used in this study. The binary vector contained a gus gene driven by one of the test phloem-specific promoters. The T-DNA also contained nptII as a selectable marker gene driven by the NOS promoter. The arrow indicates the unique EcoRI site. The control vector contains a fusion gus-nptII gene driven by a 35S promoter (pBI434).



ownloaded from



concentration of each sample was adjusted to 500 ng ml−1 and quality checked by agarose gel electrophoresis. Reverse tran-scription real-time PCR (RT-qPCR) assay was designed using the PrimerQuestSM online software (Integrated DNA Technologies Inc., Coralville, IA, USA) to detect the gus gene. The probe was labeled at the 5′ end with FAM (6-carboxy-fluorescein) reporter dye and at the 3′ end with Black Hole Quencher (BHQ)-1.

The cytochrome oxidase gene (cox) (GenBank accession num-ber CX297817) primers and probe designed by Li et al. (2006) were used to quantify mRNA from citrus as an internal standard. The cox probe was labeled at the 5′ end with JOE (2,7 dime-thoxy-4,5-dichloro-6-carboxyfluorescein) reporter dye and at the 3′ end with BHQ-2. All primers and probes were synthesized by Integrated DNA Technologies Inc. The sequences of primers and probes including the reporter fluorescent dye and the dark quencher dye are shown in Table 2. Different concentrations of primers and probes were tested and optimized. Total RNA from each sample was used in 10-fold serial dilutions for optimization and standardization. Initially, simplex PCR was performed with the target gene alone, but subsequently the internal control cox gene was combined and optimized in a single assay. Reverse transcription real-time PCR reactions were performed with a final volume of 20 µl using the TaqMan® RNA-to-CtTM one-step kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The one-step kit parameters con-sisted of 20 min incubation at 48 °C followed by 10 min incuba-tion at 95 °C and 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Each RT-qPCR contained negative and non-template/water controls in addition to the sample being tested. Experimental sample no. 7 (a non-transgenic greenhouse plant sample) was used as a calibrator sample. Experiments were repeated at least twice with two replicates, and data were analyzed using Applied Biosystems software Version 1.4.0. Relative quantitation was measured using the comparative Cq method also referred to as the 2−ΔΔCt. The fold change in the relative expression was then determined by calculating 2−ΔΔCt (Livak and Schmittgen, 2001).

Evaluation of GUS expression

Leaves were histochemically stained for GUS activity as described by Jefferson (1989) with minor modifications. X-Gluc (5-bromo-

4-chloro-3 indolyl-β-d-glucuronide) dissolved in dimethyl sulfox-ide was added at a final concentration of 1 mg ml−1 in a phosphate buffer solution (200 mM NaH2P04, pH. 7.0; 10 mM EDTA and 0.2% Triton X-100). Vacuum infiltration of explants was carried out for 5 min in this solution before being incubated in the dark at 37 °C overnight. After incubation, explants were de-stained in ethanol:acetic acid (3:1) for 12 h to eliminate background chloro-phylls and other pigments present in stained tissues. A quantita-tive fluorometric GUS assay was performed as outlined in the FluorAce β-Glucuronidase Reporter Assay Kit (Bio-Rad Laboratories, Hercules, CA, USA). Approximately 20–40 µg of total protein obtained from leaf petioles was added to 500 µl of assay buffer. Samples were incubated in a 37 °C water bath for 30 min before the reaction was terminated by the addition of 1x stop buffer. Total soluble protein of each sample was determined using the Coomassie (Bradford) Protein Assay Kit (Fisher Scientific Inc., Pittsburg, PA, USA). Relative GUS activity was cal-culated relative to the amount of total protein and reaction time period and expressed in pmol MU/mg protein/min.

Northern blot analysis

Total RNA from 12-month-old greenhouse-grown transgenic cit-rus plants was isolated using an RNeasy Mini Kit (Qiagen). Polymerase chain reaction was used to incorporate T7 promoter sequence (5′TAATACGACTCACTATAGGG3′) at the 5′ end of the antisense strand of gus and cox fragments. Digoxigenin (DIG)-labeled RNA probes were prepared according to the in vitro tran-scription labeling technique in the DIG Northern Starter Kit (Roche Applied Science, Indianapolis, IN, USA) using the PCR product as template. Total RNA (500 ng) was subjected to formaldehyde denaturation and was electrophoretically resolved in a 2% agarose–formaldehyde denaturing gel with 1× MOPS buffer. The RNA was transferred to a positively charged nylon membrane by capillary transfer. Hybridizations were performed overnight at 68 °C as described in the DIG Northern Starter Kit. The chemilu-minescence substrate CDP-Star was used for immunological detection of hybridization signals using X-ray film autography.

Results

Production of transgenic plants

Agrobacterium-mediated transformation of ‘Mexican’ lime epi-cotyl explants resulted in the production of a large number of putative kanamycin-resistant transgenic plants. There was no difference in ability to regenerate shoots following co- cultivation and incubation with any of the vectors. In order to confirm development of non-chimeric transgenic plants, shoots were excised from epicotyl segments, bases were cut off and transferred into RMG medium. Most shoots could be trans-ferred into RMM medium within 4 weeks of transfer to RMG. It was necessary to subculture several transgenic shoots twice into fresh RMM medium before they could root and be trans-

86 Dutt et al.

Table 2. Primers used in real-time PCR assay of transgenic citrus plants.

Target gene

Amplicon length (bp)

Primer/probe sequence 5′→3′ForwardProbe Reverse

gus 87 ACCTCGCATTACCCTTACGCTGAAFAM- AGATGCTCGACTGGGCAGATGAACAT -BHQ1GCCGACAGCAGCAGTTTCATCAAT

cox 69 GTATGCCACGTCGCATTCCAGAJOE-ATCCAGATGCTTACGCTGG-BHQ2GCCAAAACTGCTAAGGGCATTC



ownloaded from



ferred into soil. All plants grew normally and there was no phe-notypic abnormality observed between transgenic plants and non-transgenic controls. Rooted plants developed slowly in the first 6 months of transfer to soil followed by rapid plant growth and development. Six transgenic lines from each construct were hardened off in the greenhouse.

Polymerase chain reaction and Southern blot analyses of transgenic ‘Mexican’ lime plants

Putative transgenic plants were evaluated by duplex PCR with primers mentioned earlier. Results demonstrated the presence of a test promoter in each transgenic plant evaluated. In addi-tion, the nptII gene was also detected in transgenic plants that were positive for the promoter (Figure 2). Stable gene integration and copy number from four transgenic lines of each construct was evaluated using Southern blot analyses (Figure 3). Genomic DNA (15 µg) was digested with EcoRI and probed with a DIG-labeled gus probe. Among four transgenic plants analyzed con-taining the AtSUC2-gus construct (Figure 3a), line 2 was single copy, lines 1 and 4 had two copies and line 3 had three copies of the transgene stably incorporated into the genome. In trans-genic lines containing the RSs1-gus construct (Figure 3b), line 1 was single copy, line 4 had two copies, line 3 had three copies and line 2 had four copies of the transgene. With plants contain-ing the rolC-gus construct (Figure 3c), line 4 was single copy while line 2 had two, line 1 had three and line 3 had four copies of the transgene. Lines 2 and 3 were single copy while lines 1 and 4 contained two copies of the transgene in plants contain-ing the RTBV-gus construct (Figure 3d).

Analysis of GUS expression in transgenic ‘Mexican’ lime plants

Visualization of GUS activity was successfully done by over-night staining. We stained 6-week-old transgenic citrus plants. Expression of the constructs was observed in leaves and remained restricted to vascular tissues (Figure 4). Phloem-specific GUS expression was also observed in overnight stained cross-sections of tender 6-week-old stems (Figure 5). Histochemical GUS analysis demonstrated that staining of vas-cular tissues of young in vitro leaves was similar to that observed using greenhouse plants (data not shown).

Four transgenic citrus plants obtained from each construct were analyzed. Relative GUS activity ranging from 7 to 250 pmol MU/mg/min was obtained after transformation using gus gene-containing vectors. There was no significant differ-ence in relative GUS activity of plants transformed with either RTBV promoter or 35S control (pBI434; Figure 6). Of the four phloem-specific promoters evaluated in this study, GUS activity was highest in plants expressing RTBV promoter, followed by rolC promoter, AtSUC2 promoter and RSs1 promoter. The RSs1 promoter was not very active in citrus (19 pmol MU/mg protein/min). GUS activity was not detected in plants transformed with pC2300 that contained a construct with an nptII cassette only.

A comparison of relative GUS activity in stems, roots and leaves of transgenic citrus revealed that plants transformed with pCAM-rolC construct yielded about half the GUS activity of pCAM-RTBV in leaves (Table 3). GUS activity was 10 times lower in plants transformed with pCAM-RSs1 and 4 times lower in plants with pCAM-AtSUC2. GUS activity levels were


Figure 2. Amplification products obtained from duplex PCR of transgenic ‘Mexican’ lime genomic DNA with promoter-specific oligonucleotide prim-ers as outlined in Table 1. A fragment of the nptII gene (450 bp) was also amplified. M, 1 kb marker; 1–4 are four individual transgenic lines con-taining the RSs1 promoter; 5–8 are four individual transgenic lines containing the AtSUC2 promoter; 9–12 are four individual transgenic lines containing the RTBV promoter; 13–16 are four individual transgenic lines containing the rolC promoter.

Figure 3. Southern hybridization analysis of total DNA of transgenic ‘Mexican’ lime lines transformed with one of the four phloem-specific promot-ers. (a) AtSUC2, (b) RSs1, (c) rolC and (d) RTBV. The * indicates a line with single copy number.



ownloaded from



similar in leaves and stem. GUS activity in roots followed a different trend. Plants transformed with pCAM-rolC had rela-tively higher GUS activity than pCAM-RTBV while others lower.

Reverse transcription real-time PCR of transgenic ‘Mexican’ lime plants

Initially, primer evaluations and standardizations were per-formed by RT-qPCR with SYBR Green I dye (data not shown) and then TaqMan RT-qPCR was performed as duplex reactions. The optimized concentration of primers (300 nM each both for-ward and reverse) and probe (150 nM) provided good results for the target gene. The internal control gene (cox) was opti-mized with primers (300 nM each both forward and reverse) and probe (150 nM). No non-specific or cross-reaction/ amplification of targets was observed, and only targeted regions of the gene were amplified by the duplex reactions. No signal was detected using total RNA from healthy non-transgenic con-trol plants or from a non-template control/water sample.

Using the 2−ΔΔCt Ct method (Livak and Schmittgen 2001), overall relative quantification level was highest (upregulated) in plants expressing a gus gene driven by the 35S promoter fol-lowed by RTBV, rolC, AtSUC2 and RSs1. The relative quantifica-tion of the specific promoter varied among the individual lines tested. The 35S and RTBV promoters had above log10

3.3 (rela-tive quantification) and other promoters had log10

3.2 or below. All promoters consistently expressed above log10

2.6. The cox gene served as a good endogenous reference and was expressed and detected consistently. The internal reference gene measured 0 on a log10 scale. A greenhouse healthy con-trol plant sample was used as a calibrator sample. Results are shown in the graph/table by specific promoter (Figure 7).

Northern blot of transgenic ‘Mexican’ lime plants

Northern blot was essentially performed to confirm relative lev-els of promoter-driven gus expression in different tissues of transgenic ‘Mexican’ lime plants in selected single copy trans-genic plants obtained from each construct. We analyzed vas-cular leaf tissues and roots of greenhouse-derived plants in order to evaluate expression levels. Blots were also probed with a fragment of the cox gene. The cox gene served as a loading control for amount of total RNA. Good expression lev-els were observed in leaf vascular tissues (Figure 8). gus expression in roots was different from that observed in leaves. Expression levels were relatively lower in roots with the excep-tion of the rolC construct (Figure 9). As observed earlier using fluorometric analysis, plants containing the RSs1-gus construct had the lowest mRNA expression levels among all promoters evaluated.

Discussion

Citrus in Florida is currently under a severe threat from citrus HLB (greening disease) associated with the Gram negative, phloem-limited bacterium ‘Candidatus Liberibacter asiaticus’, which has now become endemic. Huanglongbing affects all

88 Dutt et al.

Figure 5. GUS expression in phloem tissues in a 6-week-old transgenic ‘Mexican’ lime stem cross-section. The plant was transformed with a con-struct containing the gus gene under control of the AtSUC2 promoter.

Figure 4. Phloem-specific gus expression in 6-week-old transgenic ‘Mexican’ lime leaves. Leaves were incubated in the dark at 37 °C over-night in a phosphate buffer solution containing 1 mg ml−1 X-Gluc. After incubation, the explants were de-stained in ethanol:acetic acid (3:1) for 12 h to eliminate background chlorophylls and other pigments present in stained tissues. AtSUC2: transgenic leaf expressing GUS under control of the AtSUC2 promoter; RSs1: transgenic leaf expressing GUS under con-trol of the RSs1 promoter; rolC: transgenic leaf expressing GUS under control of the rolC promoter; RTBV: transgenic leaf expressing GUS under control of the RTBV promoter; 35S: transgenic leaf expressing GUS under control of the 35S promoter; CON: leaf obtained from a non-transgenic control at a similar stage of development.



ownloaded from



cultivated citrus varieties and cannot be currently controlled due to a lack of resistant cultivars. The Asian citrus psyllid (ACP) (Diaphorina citri Kuwayama) is responsible for its spread. Infected psyllids and their nymphs transmit the bacterium into phloem tissues of the plant (Xu et al. 1988, Manjunath et al. 2008). The disease is then spread to different parts of the plant via phloem (Tatineni et al. 2008). Expression of a strong antimicrobial product in phloem and especially in younger tis-sues could help control this disease.

Our present study was conducted to evaluate the perfor-mance of four phloem-specific promoters for subsequent delivery of antimicrobial products against ‘Candidatus Liberibacter asiaticus’. We selected promoters originating from

diverse sources (dicot and monocot plants, bacteria and virus) for phloem-specific gene expression. We were able to suc-cessfully generate a population of transgenic ‘Mexican’ lime plants containing our promoter-gus constructs using a proto-col that has been described previously (Dutt and Grosser 2009). Non-transgenic escape plants were successfully elimi-nated after multiple rounds of kanamycin-based selection. Production of escape plants is a major problem in citrus trans-formation research (Domínguez et al. 2004) since non-trans-formed cells can be protected from the selective agent by neighboring transformed cells (Jordan and McHughen 1988). Use of reporter genes such as EGFP enables visual non-destructive identification of transgenic lines and can mitigate the problem of escape plant regeneration (Dutt and Grosser 2009). When visual reporter genes are not used, a selection regime that includes optimum levels of selection agent cou-pled with proper incubation time is necessary for efficient selection (Mitic et al. 2004). We report herein the expression patterns of several phloem-specific promoters in citrus. None of the promoters were active in non-vascular tissues (data not shown).

The 35S promoter is an efficient promoter and is constitu-tively expressed in citrus (Pena et al. 1995, Dutt et al. 2011). High levels of gene expression occur by interaction of a series of cis elements in the promoter (Benfey et al. 1989). Yin et al. (1997) suggested that high levels of phloem-spe-cific pararetrovirus (RTBV) expression are mainly due to three cis elements: Box II, ASL box and GATA motif. Differences in


Figure 6. Fluorometric assay for relative GUS activity in fully expanded leaves of greenhouse grown ‘Mexican’ lime plants. Midrib and petioles were used for sampling after 1 year of transfer to the greenhouse. Vertical lines represent standard errors. pC2300: transgenic plants containing a nptII cassette; pCAM-AtSUC: transgenic plants expressing GUS under control of the AtSUC2 promoter; pCAM-RSs1: transgenic plants expressing GUS under control of the RSs1 promoter; pCAM-rolC: transgenic plants expressing GUS under control of the rolC promoter; pCAM-RTBV: transgenic plants expressing GUS under control of the RTBV promoter; pBI434: transgenic plants expressing GUS under control of the 35S promoter.

Table 3. Relative GUS activity in stems, roots and leaves of transgenic ‘Mexican’ lime. GUS activity from individual promoter-gus constructs is expressed as a percentage of mean relative GUS activity from RTBV-GUS.

Promoter construct1 Leaves Stem Roots

pCAM-AtSUC2 28 ± 3 25 ± 4 48 ± 5pCAM-RSs1 10 ± 3 10 ± 3 21 ± 5pCAM-RolC 51 ± 7 44 ± 7 126 ± 2pCAM-RTBV 100 100 100pBI434 103 ± 5 84 ± 3 148 ± 51All constructs contain the gus gene driven by an individual test pro-moter. The construct pCAM-AtSUC contains the AtSUC2 promoter, pCAM-RSs1 contains the RSs1 promoter, pCAM-rolC contains the rolC promoter, pCAM-RTBV contains the RTBV promoter and pBI434 con-tains the 35S promoter.



ownloaded from



tissue specificity between the two promoters (RTBV and 35S) are also due to the presence of different cis elements such as activation sequence-1 (as-1) site, a CA-rich region and a GATA region, both of which are key elements that bind nuclear factors for constitutive expression in 35S (Lam and Chua 1989).

Relatively lower levels of GUS expression were obtained from plants transformed with the two plant-derived promoters. The AtSUC2 promoter is localized in companion cells (Stadler and Sauer 1996) and expressed strongly in midrib and sec-ondary veins (Srivastava et al. 2008). GUS activity was observed in both young and older leaves, contrary to that reported in transgenic strawberries, where GUS activity was

absent in young leaves (Zhao et al. 2004). The RSs1 promoter was the least effective of the four promoters evaluated in this study in driving transgene expression. Monocot promoters that exhibit a highly regulated expression pattern in monocots can function at a reduced level in dicots (Hauptmann et al. 1988, Shimamoto 1994).

The rolC promoter produced adequate levels of GUS expres-sion in both leaves and roots of citrus. This promoter is acti-vated by sucrose in phloem cells (Yokoyama et al. 1994). High levels of sucrose in actively growing parts result in rapid trans-location of photosynthates from source to sink tissues and play a role in up-regulating gene expression. Activity of the rolC promoter was superior to that of AtSUC2 and RSs1. Gene

90 Dutt et al.

Figure 8. Northern blot analysis of gus gene expression in leaf midrib and petioles of transgenic ‘Mexican’ lime. Total RNA (500 ng) was probed with a gus DIG-labeled RNA probe (top panel). Northern blot was probed with the cytochrome oxidase gene (lower panel). AtSUC2: transgenic plants expressing gus under control of the AtSUC2 pro-moter; RSs1: transgenic plants expressing gus under control of the RSs1 promoter; rolC: transgenic plants expressing gus under control of the rolC promoter; RTBV: transgenic plants expressing gus under con-trol of the RTBV promoter; CON: leaf obtained from a non-transgenic control at a similar stage of development.

Figure 9. Northern blot analysis of gus gene expression in roots of transgenic ‘Mexican’ lime. Total RNA (500 ng) was probed with a gus DIG-labeled RNA probe (top panel). Northern blots were probed with the cytochrome oxidase gene (lower panel). AtSUC2: transgenic plants expressing gus under control of the AtSUC2 promoter; RSs1: transgenic plants expressing gus under control of the RSs1 promoter; rolC: transgenic plants expressing gus under control of the rolC pro-moter; RTBV: transgenic plants expressing gus under control of the RTBV promoter; CON: roots obtained from a non-transgenic control at a similar stage of development.

Figure 7. Quantification of gus activity using RT-qPCR. Total RNA from ‘Mexican’ lime leaf midrib and petioles was used as template. The sequence of primers used to amplify the gus gene is detailed in Table 2. Four independent lines were tested from each construct. Lanes 1–4 are individual transgenic lines containing the AtSUC2 promoter; 5–8 are four individual transgenic lines containing the RSs1 promoter; 9–12 are four individual transgenic lines containing the rolC promoter; 13–16 are four individual transgenic lines containing the RTBV promoter; 17–20 are four individual transgenic lines containing the 35S promoter. Lane 21 is the calibrator sample. Total RNA from a ‘Mexican’ lime plant transformed with pC2300 (lane 22) and a water sample (lane 23) was also included to verify the accuracy of the amplification process.



ownloaded from



expression regulated by the rolC promoter has been reported to be higher than the RSs1 promoter in both monocots and dicots (Saha et al. 2007).

We further corroborated our observations on gus expression in citrus by RT-qPCR. Protocols were optimized to detect varia-tions among plants. Major differences were not observed between various transgenic lines transformed with a specific promoter, and variation observed in different groups was simi-lar to that obtained in fluorometric assays.

Agrobacterium-mediated transformation is a random process, and incorporation of a set number of transgenes is not currently possible by this method (Nagaya et al. 2005). One to four cop-ies of the gus gene were detected by Southern blotting. However, none of these transgenic lines exhibited gene silencing. Gene silencing occurs in plants containing numerous copies of a trans-gene integrated at one or multiple unlinked loci (Nagaya et al. 2005) or repetitive T-DNA structures (Jorgensen et al. 1996). In many cases, multiple copies of a transgene result in gene silenc-ing (Schubert et al. 2004). In citrus, we did not observe any silencing when 1–4 copies of the transgene were present in the genome. Similar results were obtained by Tang et al. (2007). They observed post-transcriptional gene silencing in transgenic lines with more than three copies of T-DNA.

To minimize variability of transgene expression and to con-firm our results, we evaluated transgenic plants that were observed to contain a single copy of a transgene stably incorporated into the genome as evaluated through Southern blot analyses. Our results mirrored those observed using fluorometric GUS analysis. High levels of GUS expression were observed in leaf petioles and veins and there was no differ-ence in expression levels between this and stem phloem tissues.

In conclusion, we evaluated four phloem-specific promoters from diverse sources. Each of the promoters was able to drive vascular-specific gene expression in vegetative parts of the plant. Expression levels depended on the promoter, with a virus derived promoter exhibiting the highest transgene expression, followed by a bacterial rolC promoter. The two plant-based AtSUC2 and RSs1 promoters were comparatively weak in directing vascular-specific gene expression. However, a weaker plant-based pro-moter that is able to drive adequate levels of gene expression may be preferable to the consumer than stronger non-plant-based promoters. Citrus is a long-lived perennial, and further analyses are required on transgene stability during different growing seasons.

Acknowledgments

We thank Dr E. Etxeberria for providing us with facilities to conduct GUS fluorometric analysis, Gary Barthe for excellent technical assistance and Dr Roger Beachy for providing us with the pMB1709 plasmid.

Funding

This work was partially supported by funds provided by the Citrus Research and Development Foundation, Inc. (CRDF).

References

An, Y.Q., J.M. McDowell, S. Huang, E.C. McKinney, S. Chambliss and R.B. Meagher. 1996. Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J. 10:107–121.

Benfey, R.N., L. Ren and N.H. Chua, 1989. The CaMV 35S enhancer con-tains at least two domains which can confer different developmental and tissue-specific expression patterns. EMBO J. 8:2195–2202.

Bevan, M.W., R.B. Flavell and M.D. Chilton. 1983. A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature 304:184–187.

Bhattacharyya-Pakrasi, M., J. Peng, J.S. Elmer, G. Laco, P. Shen, M.B. Kaniewska, H. Kononowicz, F. Wen, T.K. Hodges and R.N. Beachy. 1993. Specificity of a promoter from the rice tungro bacilliform virus for expression in phloem tissues. Plant J. 4:71–79.

Burrow, M.D., C.A. Chlan, P. Sen and N. Murai. 1990. High frequency generation of transgenic tobacco plants after modified leaf disk co-cultivation with Agrobacterium tumefaciens. Plant Mol. Biol. Rep. 8:124–139.

Chung, K.R. and R.H. Brlansky. 2009. Citrus diseases exotic to Florida: Huanglongbing (Citrus Greening) Fact Sheet PP-210. http://edis.ifas.ufl.edu/pp133.

Datla, R.S.S., J.K. Hammerlindl, L.E. Pelcher, W.L. Crosby and G. Selvaraj. 1991. A bifunctional fusion between beta-glucuronidase and neomycin phosphotransferase: a broad-spectrum marker enzyme for plants. Gene 101:239–246.

Dinant, S., A.M. Clark, Y. Zhu, F. Vilaine, J.C. Palauqui, C. Kusiak and G.A. Thompson. 2003. Diversity of the superfamily of phloem lec-tins (phloem protein 2) in angiosperms. Plant Physiol. 131:114–128.

Dinant, S., Ripoll, C., Pieper, M. and C. David. 2004. Phloem specific expression driven by wheat dwarf geminivirus V-sense promoter in transgenic dicotyledonous species. Physiol. Plant. 121:108–116.

DiRita, V.J. and S.B. Gelvin. 1987. Deletion analysis of the mannopine synthase gene promoter in sunflower crown gall tumors and Agrobacterium tumefaciens. Mol. Gen. Genet. 207:233–241.

Domínguez, A., M. Cervera, R.M. Pérez, J. Romero, C. Fagoaga, J. Cubero, M.M. López, J.A. Juárez, L. Navarro and L. Peña. 2004. Characterization of regenerants obtained under selective conditions after Agrobacterium-mediated transformation of citrus explants reveals production of silenced and chimeric plants at unexpected high frequencies. Mol. Breeding 14:171–183.

Dutt, M. and J.W. Grosser. 2009. Evaluation of parameters affecting Agrobacterium-mediated transformation of citrus. Plant Cell Tiss. Organ Cult. 98:331–340.

Dutt, M., M. Vasconcellos and J.W. Grosser, 2011. Effects of antioxi-dants on Agrobacterium-mediated transformation and accelerated production of transgenic plants of Mexican lime (Citrus aurantifolia Swingle). Plant Cell Tiss. Organ Cult. 107:79–89.

Glick, B.R. 1995. Metabolic load and heterologous gene expression. Biotech. Adv. 13:247–261.

Guo, H., X. Chen, H. Zhang, R. Fang, Z. Yuan, Z. Zhang and Y. Tian. 2004. Characterization and activity enhancement of the phloem-specific pumpkin PP2 gene promoter. Transgenic Res. 13:559–566.

Hauptmann, R.M., M. Ashraf, V. Vasil, L.C. Hannah, I.K. Vasil and R. Ferl. 1988. Promoter strength comparisons of maize shrunken I and




ownloaded from

http://edis.ifas.ufl.edu/pp133

http://edis.ifas.ufl.edu/pp133



alcohol dehydrogenase I and 2 promoters in mono- and dicotyle-donous species. Plant Physiol. 88:1063–1066.

Hawker, J.S. and M.D. Hatch. 1965. Mechanism of sugar storage by mature stem tissue of sugarcane. Physiol. Plant. 18:444–453.

Hood, E.E., S.B. Gelvin, L.S. Melchers and A. Hoekema. 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 2:208–218.

Imlau, A., E. Truernit and N. Sauer. 1999. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and sym-plastic unloading of the protein into sink tissues. Plant Cell 11:309–322.

Jefferson, R.A. 1989. The GUS reporter gene system. Nature 342:837–838.

Jiang, H., H.M. Qin, H.M. Yu and Y.C. Tian. 1999. Cloning and function of the phloem protein gene promoter from Cucurbita maxima. J. Agric. Biotechnol. 7:63–68.

Jordan, M.C. and A. McHughen. 1988. Transformed callus does not necessarily regenerate transformed shoots. Plant Cell Rep. 7:285–287.

Jorgensen, R.A., P.D. Cluster, J. English, Q. Que and C.A. Napoli. 1996. Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and singlecopy vs. complex T-DNA sequences. Plant Mol. Biol. 31:957–973.

Lam, E., and N.H. Chua. 1989. ASF-2: a factor that binds to the cauli-flower mosaic virus 355 promoter and a conserved GATA motif in Cab promoters. Plant Cell 1:1147–1156.

Li, W., J.S. Hartung and L. Levy. 2006. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species asso-ciated with citrus huanglongbing. J. Microbiol. Methods 66:104–115.

Livak, K.J. and T.D. Schmittgen. 2001. Analysis of relative gene expres-sion data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 25:402–408.

Maiti, I.B., S. Gowda, J. Kiernan, S.K. Ghosh and R.J. Shepherd. 1997. Promoter/leader deletion analysis and plant expression vectors with the figwort mosaic virus (FMV) full length transcript (FLt) promoter containing single or double enhancer domains. Transgenic Res. 6:143–156.

Manjunath, K.L., S.E. Halbert, C. Ramadugu, S. Webb and R.F. Lee. 2008. Detection of ‘Candidatus Liberibacter asiaticus’ in Diaphorina citri and its importance in the management of citrus huanglongbing in Florida. Phytopathology 98:387–396.

Medberry, S.L., B. Lockhart and N.E. Olszewski. 1992. The commelina yellow mottle virus promoter is a strong promoter in vascular and reproductive tissues. Plant Cell 4:185–192.

Mitic, N., R. Nikolic, S. Ninkovic, J. Miljuš-Djukic and M. Neškovic. 2004. Agrobacterium-mediated transformation and plant regeneration of Triticum aestivum L. Biol. Plant. 48:179–184.

Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant. 15:473–497.

Nagaya, S., K. Kato, Y. Ninomiya, R. Horie, M. Sekine, K. Yoshida and A. Shinmyo. 2005. Expression of randomly integrated single complete copy transgenes does not vary in Arabidopsis thaliana. Plant Cell Physiol. 46:438–444.

Nolte, K.D. and K.E. Koch 1993. Companion-cell specific localization of sucrose synthase in zones of phloem loading and unloading. Plant Physiol. 101:899–905.

Odell, J.T., F. Nagy and N.H. Chua. 1985. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313:810–812.

Pena, L., M. Cervera, J. Juárez, C. Ortega, J. Pina, N. Durán-Vila and L. Navarro. 1995. High efficiency Agrobacterium-mediated transfor-mation and regeneration of citrus. Plant Sci. 104:183–191.

Rohde, W., D. Becker and J.W. Randles. 1995. The promoter of coconut foliar decay-associated circular single-stranded DNA directs

phloem-specific reporter gene expression in transgenic tobacco. Plant Mol. Biol. 27:623–628.

Saha, P., D. Chakraborti, A. Sarkar, I. Dutta, D. Basu and S. Das. 2007. Characterization of vascular-specific RSs1 and rolC promoters for their utilization in engineering plants to develop resistance against hemipteran insect pests. Planta 226:429–442.

Sauer, N. and J. Stolz. 1994. SUC1 and SUC2: two sucrose transport-ers from Arabidopsis thaliana: expression and characterization in baker’s yeast and identification of the histidine-tagged protein. Plant J. 6:67–77.

Schmulling, T., J. Schell and A. Spena. 1989. Promoters of the rol A, B, and C genes of Agrobacterium rhizogenes are differentially regulated in transgenic plants. Plant Cell 1:665–670.

Schubert, D., B. Lechtenberg, A. Forsbach, M. Gils, S. Bahadur and R. Schmidt. 2004. Silencing in Arabidopsis T-DNA transformants—the predominant role of a gene-specific RNA sensing mechanism versus position effects. Plant Cell 16:2561–2572.

Shi, Y., M.B. Wang, K.S. Powell, E. Van Damme, V.A. Hilder, A.M.R. Gatehouse, D. Boulter, and J.A. Gatehouse, 1994. Use of the rice sucrose synthase-1 promoter to direct phloem-specific expression of β-glucuronidase and snowdrop lectin genes in transgenic tobacco plants. J. Exp. Bot. 45:623–631.

Shimamoto, K. 1994. Gene expression in transgenic plants. Curr. Opin.Biotechnol. 5:158–162.

Srivastava, A.C., S. Ganesan, I.O. Ismail and B.G. Ayre. 2008. Functional characterization of the Arabidopsis AtSUC2 sucrose/H+ symporter by tissue-specific complementation reveals an essential role in phloem loading but not in long-distance transport. Plant Physiol. 148:200–211.

Stadler, R. and N. Sauer, 1996. The Arabidopsis thaliana AtSUC2 gene is specifically expressed in companion cells. Bot. Acta. 109:299–306.

Tang, W., R.J. Newton and D.A. Weidner. 2007. Genetic transforma-tion and gene silencing mediated by multiple copies of a transgene in eastern white pine. J. Exp. Bot. 58:545–554.

Tatineni, S., U.S. Sagaram, S. Gowda, C.J. Robertson, W.O. Dawson, T. Iwanami and N. Wang. 2008. In planta distribution of ‘Candidatus Liberibacter asiaticus’ as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology 98:592–599.

Thompson, G.A. and B.A. Larkins. 1996. Phloem-specific promoter. US patent US005495007A.

Truernit, E. and N. Sauer. 1995. The promoter of the Arabidopsis thaliana SUC2 sucrose-H+ symporter gene directs expression of beta-glucuronidase to the phloem: evidence for phloem loading and unloading by SUC2. Planta 196:564–570.

Waclawovsky, A.J., R.L. Freitas, C.S. Rocha, L.A.S. Contim and E.P.B. Fontes. 2006. Combinatorial regulation modules on GmSBP2 promoter: a distal cis-regulatory domain confines the SBP2 pro-moter activity to the vascular tissue in vegetative organs. BBA-Gene Struct. Expr. 1759:89–98.

Wang, M.B., D. Boulter and J.A. Gatehouse. 1992. A complete sequence of the rice sucrose synthase-1 (RSsl) gene. Plant Mol. Biol. 19:881–885.

Xiao, K., C. Zhang, M. Harrison and Z.Y. Wang. 2005. Isolation and characterization of a novel plant promoter that directs strong con-stitutive expression of transgenes in plants. Mol. Breeding 15:221–231.

Xu, C.F., K.B. Li and C. Ke 1988. Further study of the transmission of citrus huanglongbing by a psyllid, Diaphorina citri Kuwayama. Proceedings of 10th Conference of the International Organization of Citrus Virologists. pp 243–248.

Yang, N.S. and D. Russell 1980. Maize sucrose synthase-1 promoter directs phloem specific expression of gus gene in transgenic tobacco plants. Proc. Natl Acad. Sci. USA 87:4144–4148.

92 Dutt et al.



ownloaded from



Yin, Y. and R.N. Beachy. 1995. The regulatory regions of the rice tun-gro bacilliform virus promoter and interacting nuclear factors in rice (Oryza sativa L.). Plant J. 7:969–980.

Yin, Y., L. Chen and R.N. Beachy. 1997. Promoter elements required for phloem-specific gene expression from the RTBV promoter in rice. Plant J. 12:1179–1188.

Yokoyama, R., T. Hirose, N. Fujii, E.T. Aspuria, A. Kato and H. Uchimiya. 1994. The rolC promoter of Agrobacterium rhizogenes Ri plasmid is

activated by sucrose in transgenic tobacco plants. Mol. Gen. Genet. 244:15–22.

Yoshida, K., T. Mohri, M. Nishiguchi and K. Tazaki. 2002. Robinia pseudo-acacia inner-bark lectin promoter expresses GUS also predominantly in phloem of transgenic tobacco. J. Plant Physiol. 159:757–764.

Zhao, Y., Q. Liu and R.E. Davis. 2004. Transgene expression in straw-berries driven by a heterologous phloem-specific promoter. Plant Cell Rep. 23:224–230.




ownloaded from


evaluation of four phloem-specific promoters in...

Documents