Zoologica Scripta. 2018;47:159–173. wileyonlinelibrary.com/journal/zsc | 159© 2017 Royal Swedish Academy of Sciences

Received: 6 July 2017 | Accepted: 4 November 2017

DOI: 10.1111/zsc.12266

O R I G I N A L A R T I C L E

Evolutionary history of spiny- tailed lizards (Agamidae: Uromastyx) from the Saharo- Arabian region

Karin Tamar1 | Margarita Metallinou1† | Thomas Wilms2 | Andreas Schmitz3 | Pierre-André Crochet4 | Philippe Geniez5 | Salvador Carranza1

1Institute of Evolutionary Biology (CSIC-Universitat Pompeu Fabra), Barcelona, Spain2Allwetterzoo Münster, Münster, Germany3Department of Herpetology & Ichthyology, Natural History Museum of Geneva (MHNG), Geneva, Switzerland4CNRS-UMR 5175, Centre d’Écologie Fonctionnelle et Évolutive (CEFE), Montpellier, France5EPHE, CNRS, UM, SupAgro, IRD, INRA, UMR 5175 Centre d’Écologie Fonctionnelle et Évolutive (CEFE), PSL Research University, Montpellier, France

CorrespondenceKarin Tamar, Institute of Evolutionary Biology (CSIC-Universitat Pompeu Fabra), Barcelona, Spain.Email: karintmr@gmail.com

Funding informationSecretaria d’Universitats i Recerca del Departament d’Economia i Coneixement de la Generalitat de Catalunya, Grant/Award Number: 2014-SGR-1532; Ministerio de Economía y Competitividad, Spain (cofunded by FEDER), Grant/Award Number: CGL2015-70390-P

The subfamily Uromastycinae within the Agamidae is comprised of 18 species: three within the genus Saara and 15 within Uromastyx. Uromastyx is distributed in the desert areas of North Africa and across the Arabian Peninsula towards Iran. The systematics of this genus has been previously revised, although incomplete taxo-nomic sampling or weakly supported topologies resulted in inconclusive relation-ships. Biogeographic assessments of Uromastycinae mostly agree on the direction of dispersal from Asia to Africa, although the timeframe of the cladogenesis events has never been fully explored. In this study, we analysed 129 Uromastyx specimens from across the entire distribution range of the genus. We included all but one of the rec-ognized taxa of the genus and sequenced them for three mitochondrial and three nuclear markers. This enabled us to obtain a comprehensive multilocus time- calibrated phylogeny of the genus, using the concatenated data and species trees. We also applied coalescent- based species delimitation methods, phylogenetic network analyses and model- testing approaches to biogeographic inferences. Our results re-vealed Uromastyx as a monophyletic genus comprised of five groups and 14 inde-pendently evolving lineages, corresponding to the 14 currently recognized species sampled. The onset of Uromastyx diversification is estimated to have occurred in south- west Asia during the Middle Miocene with a later radiation in North Africa. During its Saharo- Arabian colonization, Uromastyx underwent multiple vicariance and dispersal events, hypothesized to be derived from tectonic movements and habi-tat fragmentation due to the active continental separation of Arabia from Africa and the expansion and contraction of arid areas in the region.

K E Y W O R D Sagamids, Arabia, biogeography, multilocus phylogeny, reptiles, systematics

1 | INTRODUCTION

The Uromastycinae Theobald, 1868 is a subfamily within Agamidae, distributed in the desert belt of the Old World, and is phylogenetically the sister subfamily to the rest of the Agamid taxa (Macey et al., 2000; Pyron, Burbrink, & Wiens, 2013; Townsend et al., 2011). This subfamily is comprised of

two genera, Saara Gray, 1845 (three species; Irano- Turanian region; Iraq, Iran, Afghanistan, Pakistan, and India) and Uromastyx Merrem, 1820 (15 species; Saharo- Arabian re-gion; from the Atlantic coast of north- west Africa to Iran) (Sindaco & Jeremčenko, 2008; Uetz, Freed, & Hzrošek, 2017; Wilms, 2005; Wilms, Böhme, Wagner, Lutzmann, & Schmitz, 2009). Uromastycinae members are commonly called spiny- tailed lizards due to the shape of their tail cov-ered by spiny scales arranged in distinct whorls. The two †Deceased July 2015.

160 | TAMAR eT Al.

genera, Saara and Uromastyx, are differentiated by the pres-ence or absence of intercalaries between the tail whorls, re-spectively (Wilms, 2005; Wilms et al., 2009). Spiny- tailed lizards are ground dwelling or saxicolous, predominantly herbivorous, characterized by their medium to large size, their spiny whorled tail and a distinctive diagnostic denti-tion (Moody, 1980; Wilms, 2005). These lizards have a stout depressed habitus with stubby limbs, and their body is usu-ally covered with small homogeneous scales, although some members have additional scattered tubercular scales (Wilms, 2005; Wilms & Böhme, 2001). Uromastycinae members have long been a part of the reptile pet trade, with reports dating to the 19th century (e.g., von Fischer, 1885). These liz-ards are registered in appendix II of CITES (www.cites.org) due to their extensive collection for food, medicine, and local and international pet trade (Ching & Chng, 2016; Knapp, 2004; Mahmood, Shah, Rais, & Nadeem, 2011; Pechmann, Scott, Semlisch, Caldwell, & Vitt, 2005; Robinson, Griffiths, John, & Roberts, 2015). In the IUCN Red List of Threatened Species (http://www.iucnredlist.org), of the nine listed spe-cies of the subfamily, three are listed as Near Threatened and two as Vulnerable.

Uromastyx, the largest genus within the Uromastycinae, inhabits desert areas and ranges across North Africa, in-cluding the Sahel and the Horn of Africa, eastwards to Iran through the Arabian Peninsula and northwards to cen-tral Syria and Iraq (Figure 1; Wilms, 2005; Sindaco & Jeremčenko, 2008; Wilms & Schmitz, 2007; Uetz et al., 2017). Uromastyx mainly occurs in deserts and semi- desert habitats of compacted ground (they do not occur on sand dunes), covered with rocks, scattered stones, gravel and sparse vegetation (Arnold, 1980; Wilms, 2005). The tax-onomy of Uromastyx has changed through the years, with four species and three subspecies described since 1980 (see Uetz et al., 2017). Morphological revisions of Uromastyx (e.g., Mateo, Geniez, Lopez- Jurado, & Bons, 1999; Wilms, 2001; Wilms & Böhme, 2000a, 2000b, 2001, 2007; Wilms & Schmitz, 2007; Wilms et al., 2009) and molecular phyloge-netic studies (e.g., Amer & Kumazawa, 2005a, 2009; Harris, Vaconcelos, & Brito, 2007; Wilms & Schmitz, 2007; Wilms et al., 2009; Amin & Amer, 2011; Amer, Ahmed, Wilms, Shobrak, & Kumazawa, 2012) have contributed greatly to our understanding of the intra- and interspecific relationships within the genus. Uromastyx taxa are currently divided into the following five groups: U. acanthinura group (African; five species), U. aegyptia (Arabian; one species), U. ocellata group (Arabian; five species), U. princeps group (African; two species) and U. thomasi (Arabian; one species). The phylogenetic relationships among the Uromastyx taxa were

partially established in the previously mentioned studies, although incomplete taxonomic sampling or several weakly supported topologies resulted in inconclusive relationships.

The biogeographic history of Uromastycinae in general and that of Uromastyx in particular was evaluated in several studies, suggesting a general dispersal from east to west (e.g., Amer & Kumazawa, 2005a; Moody, 1980; Wilms et al., 2009). From central or southern Asia, Uromastycinae dis-persed westwards into south- western Asia, Arabia and North Africa, most likely during the Eocene–Oligocene onwards, with the progression of suitable arid habitats in these regions. Although the direction of this divergence from Asia to Africa is agreed upon by most studies, the timeframe of these cladoge-netic events has never been fully explored. Divergence- time estimates targeting the Uromastycinae members have only been assessed by two prior studies (i.e., Amer & Kumazawa, 2005a; Joger, 1986), based on ND2-tRNAs amino acid and nucleotide distances and on immunological distance data, respectively. These two studies suggested that the species now classified within Saara and Uromastyx started diverg-ing during the Oligocene, approximately 25–30 million years ago (Mya). Amer and Kumazawa (2005a) hypothesized that an initial stage of radiation probably occurred in the eastern Middle East, prior to the connection between Africa and Eurasia ca. 18 Mya (i.e., the Gomphotherium land bridge; Rögl, 1998), and that the ancestor of Uromastyx most likely derived from this region. According to their estimates, the Uromastyx radiation during the Middle Miocene ca. 11–15 Mya may have occurred due to an aridification pro-cess in the area, which facilitated migration and cladogenesis between and within Arabia and Africa.

The Saharo- Arabian region, spanning across North Africa and Arabia, is a unique region for evolutionary and biogeo-graphic research. The region has a long and complex geo-logical history of suturing and rifting—it covers both the active continental separation of Arabia from Africa at the Red Sea and the collision zone of the African- Arabian plates with the Eurasian landmass at its northern edge (Bohannon 1989; Girdler, 1991; Ghebreab, 1998; Popov et al., 2004; Bosworth, Huchon, & McClay, 2005). This tectonically ac-tive region has undergone drastic climatic changes with pro-found aridification processes followed by hyperarid areas alternately expanding and contracting (Le Houérou, 1992, 1997). Periodic terrestrial connectivity between Africa and Arabia through the Red Sea, and between Afro- Arabia and Asia (through the Gomphotherium land bridge), coupled with climatic oscillations are hypothesized to have enabled multiple vicariance and dispersal events, and phases of fau-nal exchanges between the regions. These processes have

F I G U R E 1 Distribution ranges and maximum- likelihood concatenated tree of Uromastyx. Ranges were modified from Wilms (2005) and Sindaco and Jeremčenko (2008). The tree was reconstructed from the complete concatenated data, with support values indicated near the nodes (bootstrap/Bayesian posterior probabilities). Sample codes correlate to specimens in Table S1 [Colour figure can be viewed at wileyonlinelibrary.com]

| 161TAMAR eT Al.

162 | TAMAR eT Al.

created an admixture of evolutionary histories and biogeo-graphic patterns for the regional reptile fauna (e.g., Carranza & Arnold, 2012; Kapli et al., 2015; Metallinou et al., 2012, 2015; Papenfuss et al., 2009; Pook, Joger, Stümpel, & Wüster, 2009; Portik & Papenfuss, 2012; Šmíd et al., 2013; Tamar, Carranza, Sindaco, Moravec, & Meiri, 2014; Tamar, et al., 2015; Tamar, Carranza, et al., 2016; Tamar, Scholz, et al., 2016).

Due to its continuous distribution on both sides of the Red Sea, Uromastyx is of particular interest to elucidate the different diversification processes affecting the evolutionary history of Saharo- Arabian reptiles. In this study, we estimate the phylogenetic relationships and biogeographic history of Uromastyx taxa using a comprehensive sampling and novel multilocus data. We reconstructed concatenated trees and species trees, and conducted species delimitation analyses to identify the different taxonomic units within the genus compared to the current taxonomy. We reconstructed these relationships within a time- calibrated species tree, which en-abled us to evaluate the biogeographic history of this genus, with the aim to improve our understanding on the environ-mental processes that influenced diversification in Africa and Arabia.

2 | MATERIALS AND METHODS

2.1 | Taxon sampling and DNA sequencingOur sampling includes 129 specimens representing 20 recog-nized taxa of Uromastyx (i.e., 14 species and six subspecies) from their entire distribution range (Table S1; Uromastyx occidentalis was not sampled; sequences retrieved from GenBank are from Amer & Kumazawa, 2009; Wilms & Schmitz, 2007; Wilms et al., 2009). The monophyly and phy-logenetic position of Uromastyx within the Agamidae have been established in previous studies (Amer & Kumazawa, 2005a; Joger, 1986, 1991; Macey et al., 2000; Pyron et al., 2013; Tonini, Beard, Ferreira, Jetz, & Pyron, 2016; Townsend et al., 2011; Wilms et al., 2009). We therefore in-cluded as outgroups eight specimens of its phylogenetically closely related genus Saara. Sample codes, vouchers, locali-ties and GenBank accession numbers are given in Table S1. Distribution ranges of each species are presented in Figure 1.

The DNA of alcohol- preserved muscle, fingers or liver tissue samples was extracted using the SpeedTools Tissue DNA Extraction kit (Biotools, Madrid, Spain). For each indi-vidual, up to six markers were PCR amplified and sequenced for both strands. The mitochondrial data set (1,696 bp) in-cluded three gene fragments: the ribosomal 16S rRNA (16S; 502 bp) and the protein- coding cytochrome b (cytb; 306 bp) and NADH dehydrogenase subunit 4 (ND4; 708 bp) with the adjacent histidine, serine and leucine tRNAs (tRNAs; 180 bp). The nuclear data set (1,737 bp) included three protein- coding

gene fragments: melano- cortin 1 receptor (MC1R; 663 bp), acetylcholine receptor M4 (ACM4; 429 bp) and neurotroph-in- 3 (NTF3; 645 bp). Data on the primers, PCR conditions and source references are listed in Table S2.

2.2 | Sequence alignment and phylogenetic analysesChromatographs were checked manually, assembled and edited using Geneious v.7.1.9 (Biomatter Ltd.). For the nu-clear genes (MC1R, ACM4, NTF3), heterozygous positions were identified and coded according to the IUPAC ambiguity codes. We tested for the occurrence of recombination in the phased nuclear genes using the Pairwise Homoplasy Index (PhiTest; Bruen, Hervé, & Bryant, 2006) as implemented in splitstree v.4.14.5 (Huson & Bryant, 2006) and no recombi-nation was detected (p > .18 for each gene). Sequences were aligned, for each gene independently, using the online ap-plication of mafft v.7.3 (Katoh & Standley, 2013) with de-fault parameters, except for the 16S and tRNAs fragments to which we applied the Q- INS- i strategy that considers the sec-ondary structure of RNA. Poorly aligned gap regions of 16S and tRNAs were eliminated with Gblocks (Castresana, 2000) using low stringency options (Talavera & Castresana, 2007). Protein- coding genes (cytb, ND4, MC1R, ACM4, NTF3) were translated into amino acids, and no stop codons were de-tected. Inter- and intraspecific uncorrected p- distances with pairwise deletion for the mitochondrial fragments, and the number of variable (V) and parsimony informative (Pi) sites for all the markers were calculated in mega v.7.0.14 (Kumar, Stecher, & Tamura, 2016). The data sets for the different analyses were partitioned as specified by partitionfinder v.1.1.1 (Lanfear, Calcott, Ho, & Guindon, 2012), with the following parameters: linked branch length; BEAST models; BIC model selection; greedy schemes search algorithm; sin-gle partition of the non- coding 16S and tRNAs, and by codons for the protein- coding markers cytb, ND4, MC1R, ACM4 and NTF3. A summary of DNA partitions, with the best fit model of nucleotide substitution for each partition, is presented in Table S3.

Concatenated phylogenetic analyses were performed under maximum likelihood (ML) and Bayesian inference (BI) frameworks. We treated alignment gaps as missing data, and the nuclear gene sequences were not phased. The ML anal-yses were conducted in raxml v.7.4.2 (Stamatakis, 2006) as implemented in raxmlgui v.1.3 (Silvestro & Michalak, 2012). All ML analyses were performed with the GTR+G model of sequence evolution and 100 inferences. Each inference was initiated with a random starting tree, and nodal support was assessed with 1,000 bootstrap replicates. The BI analysis was conducted with mrbayes v.3.2.6 (Ronquist et al., 2012). Nucleotide substitution model parameters were unlinked across partitions and the different partitions were allowed

| 163TAMAR eT Al.

to evolve at different rates. Two simultaneous parallel runs were performed with four chains per run (three heated, one cold) for 107 generations with sampling frequency of every 1,000 generations. We examined the standard deviation of the split frequencies between the two runs and the Potential Scale Reduction Factor (PSRF) diagnostic; convergence was assessed by confirming that all parameters had reached sta-tionarity and had sufficient effective sample sizes (>200) using tracer v.1.6 (Rambaut, Suchard, Xie, & Drummond, 2014). We conservatively discarded the first 25% of trees as burn- in. Nodes were considered as well supported if they re-ceived ML bootstrap values ≥70% and posterior probability (pp) support values ≥.95.

Haplotype networks were constructed for the three nu-clear genes: MC1R, ACM4 and NTF3. To resolve haplotype phase when multiple heterozygous sites were present, the on-line web tool SeqPHASE (Flot, 2010) was used to convert the input files for each gene independently, and the software phase v.2.1.1 (Stephens & Scheet, 2005; Stephens, Smith, & Donnelly, 2001) to resolve haplotypes, with a probability threshold set to .5 for each of the three markers. The phased nuclear sequences were used to generate median- joining net-works using networks v.5 (Bandelt, Forster, & Röhl, 1999).

2.3 | Species delimitation and species tree analysesTo evaluate the relationships and species boundaries within Uromastyx, we applied two approaches for species delimita-tion, assuming no prior knowledge for species designations. To objectively identify divergent lineages within Uromastyx, putative species boundaries were first tested using the multi-rate Poisson Tree Processes (mPTP; Kapli et al., 2016) model, using a web server (http://mptp.h-its.org/). As this analysis relies on single locus data, we reconstructed and used a ML haplotype mitochondrial phylogenetic tree as specified above (i.e., same mitochondrial partitions and analysis parameters). We then reconstructed a multilocus species- tree using *beast (v.1.8.2; Drummond, Suchard, Xie, & Rambaut, 2012; Heled & Drummond, 2010). We defined lineages based on the re-sults obtained from the mPTP analysis. Outgroups were ex-cluded, and only linages with a full set of genes were included (thus excluding U. princeps from this analysis; see Table S1). The nuclear loci were phased, and the site models, clock mod-els and gene trees were unlinked across loci (tree model linked for the mtDNA partitions). The Bayesian information crite-rion (BIC), as implemented in jmodeltest v.2.1.7 (Darriba, Taboada, Doallo, & Posada, 2012; Guindon & Gascuel, 2003), was used to select the best model of nucleotide sub-stitution for each partition: 16S (GTR+G), ND4 (TrN+I+G), ACM4 (TrN+G), MC1R (TrN+I) and cytb, tRNA, NTF3 (HKY+G). Other prior settings were as follows (otherwise by default): models as listed above, strict clock prior (tested

for each marker using a likelihood ratio test implemented in mega), Yule process species tree prior, random starting trees, ploidy type (mitochondrial for the mtDNA tree), GTR base substitution prior uniform (0, 100) and alpha prior uniform (0, 10). Three individual runs were performed for 4 × 108 gen-erations with a sampling frequency of 4 × 104. For all *beast analyses, we assessed stationarity with tracer v.1.6, and LogCombiner and TreeAnnotator (in the beast package) were used to infer the ultrametric tree after discarding 10% as burn- in. All *beast analyses were carried out in CIPRES Science Gateway (Miller, Pfeiffer, & Schwartz, 2010).

We performed a nuclear multilocus Bayesian coalescent species delimitation and species tree analyses conducted with Bayesian Phylogenetics and Phylogeography (bp&p v.3.3; Yang & Rannala, 2010, 2014; Rannala & Yang, 2013) with the full phased data set of the three nuclear loci (MC1R, ACM4, NTF3). We carried out two analytical approaches using the 13 recognized species within Uromastyx (see Results; excluding U. princeps due to incomplete data set): (i) conducting Bayesian species delimitation analyses using a fixed guide tree (i.e., the 13 ‘species’ species tree recov-ered from *beast; see above). (ii) conducting joint analyses of Bayesian species delimitation while estimating the spe-cies tree (Yang, 2015). For both approaches, algorithms 0 and 1 were used, assigning each species delimitation model equal prior probability. As prior distributions on the ances-tral population size (θ) and root age (τ) can affect the pos-terior probabilities for models (Yang & Rannala, 2010), we tested four different combinations of priors following the study of Leaché and Fujita (2010): θ = G(1,10), τ = G(1,10); θ = G(2,2000), τ = G(2,2000); θ = G(1,10), τ = G(2,2000); θ = G(2,2000), τ = G(1,10). The locus rate parameter that allows variable mutation rates among loci was estimated with a Dirichlet prior (α = 2). As our data set was autosomal only, the heredity parameter that allows θ to vary among loci was set as default. We ran each of the rjMCMC analysis twice to confirm consistency between runs, each run for 5 × 105 gen-erations with 10% discarded as burn- in.

2.4 | Estimating a temporal framework for divergenceDivergence times were estimated in beast v.1.8.2 with one rep-resentative of each independent mPTP lineage of Uromastyx (the nuclear genes unphased; for representatives see Table S1 and Figure S1). We performed three different calibration analyses using the concatenated data to cross- validate diver-gence times. For each of the three analyses, three individual runs were performed for 5 × 107 generations with a sampling frequency of 5 × 103. Other prior settings were as detailed for the *beast species tree, apart from ploidy type. A summary of DNA partitions, with the best fit model of nucleotide substitu-tion for each partition, is presented in Table S3.

164 | TAMAR eT Al.

The three analyses were as follows: (i) applying one cali-bration point, using the Uromastycinae data set alone (Saara and Uromastyx), based on the agamid fossil Uromastyx eu-ropaeus (De Stefano, 1903) dated to the Early Oligocene (Augé, 1988; Moody, 1980; Rage & Augé, 2015). This cal-ibration point was applied at the crown of Uromastycinae (Saara and Uromastyx; gamma distribution, α = .9, β = 8, 28–56 Mya); (ii) applying seven calibration points related to other members of the family Agamidae, as previously esti-mated or used in other studies (see below; Table S1); (iii) use of the same data set as in analysis (ii), with the incorporation of the Uromastyx europaeus fossil calibration (i.e., eight cal-ibration points).

The seven agamid calibrations used for the calibration analyses were as follows: (i) the divergence of Hydrosaurinae from Amphibolurinae, Agaminae and Draconinae during the Late Cretaceous (normal distribution, mean 70, SD 3; Townsend et al., 2011); (ii) the divergence of Amphibolurinae from Agaminae and Draconinae during the Late Cretaceous (normal distribution, mean 68, SD 3.5; Amer & Kumazawa, 2005b; Townsend et al., 2011); (iii) the divergence between Agaminae and Draconinae during the Early Paleocene (nor-mal distribution, mean 61, SD 2; Amer & Kumazawa, 2005b; Wiens, Brandley, & Reeder, 2006; Townsend et al., 2011); (iv) the divergence between Phrynocephalus and Trapelus during the Middle Eocene (normal distribution, mean 41, SD 1.5; Townsend et al., 2011; Leaché et al., 2014); (v) the diver-gence between Calotes and Acanthosaura during the Middle Oligocene (normal distribution, mean 27, SD 1.5; Amer & Kumazawa, 2005b; Townsend et al., 2011); (vi) the fossil agamid Physignathus sp. (21 Mya; Covacevich, Couper, Molnar, Witten, & Young, 1990) from the Early Miocene was used to calibrate the divergence of Intellagama lesueurii (lognormal distribution, offset 18, mean 1.3, SD 1.4; Hugall, Foster, Hutchinson, & Lee, 2008; Townsend et al., 2011); (vii) the divergence between Ctenophorus and Pogona during the Middle Miocene (normal distribution, mean 18, SD 1.5; Hugall et al., 2008; Townsend et al., 2011).

In addition, a time- calibrated species tree of Uromastyx was estimated using *beast, including its closest relative genus Saara. As the three calibration approaches mentioned above provided almost identical dates (see Results), we cali-brated the species tree using the Uromastyx europaeus fossil. Three individual runs were performed for 8 × 108 genera-tions with a sampling frequency of 8 × 104. Calibration set-tings were as specified above and other priors as detailed for the previous species tree.

2.5 | Ancestral range reconstructionTo infer the phylogeographic history and estimate the ances-tral ranges of Uromastyx, we performed both likelihood and Bayesian analyses on the concatenated Uromastycinae data

set using the Uromastyx europaeus fossil as described in the divergence- time estimations analyses (see above; data set comprised of one representative of each species and subspe-cies for wider geographic sampling). The likelihood- based analysis was performed with the R- package BioGeoBEARS (Matzke, 2013). This method implements six biogeographic models: DEC (dispersal–extinction–cladogenesis; Ree, Moore, Webb, & Donoghue, 2005; Ree & Smith, 2008), DIVA (dispersal–vicariance analysis; Ronquist, 1997) and BayArea (Landis, Matzke, Moore, & Huelsenbeck, 2013); and the parameter (J), considered for each model, which al-lows founder effect speciation events (Matzke, 2013). The Bayesian approach was performed using BSSVS (Lemey, Rambaut, Drummond, & Suchard, 2009), the discrete phy-logeographic model implemented in beast. Partitions and models of nucleotide substitution are detailed in Table S3. The prior settings, MCMC chain length and sampling strategy were the same as in the divergence- time estimations analy-sis, with additional specification of symmetric discrete trait substitution model and an exponential prior for the discrete location state rate.

The Uromastycinae taxa were assigned to four discrete biogeographic areas based on their modern day distributions: (i) Asia- Iran to India; (ii) Arabia- Iraq to the Sinai Peninsula; (iii) North Africa- Egypt to Morocco; (iv) Horn of Africa- Eritrea to Somalia.

3 | RESULTS

3.1 | Sampling and genetic diversityThe data set for the phylogenetic analyses comprised 137 indi-viduals of Uromastycinae, with 129 specimens of Uromastyx and eight specimens of Saara (Table S1). The data set to-talling 3,433 bp comprised mitochondrial gene fragments of 16S (V = 164; Pi = 139), cytb (V = 124; Pi = 117), ND4 (V = 288; Pi = 280) and tRNAs (V = 91; Pi = 89), and nu-clear gene fragments of MC1R (V = 33; Pi = 29), ACM4 (V = 30; Pi = 29) and NTF3 (V = 28; Pi = 20). The uncor-rected p- distances of the 16S, cytb and ND4 mitochondrial gene fragments between and within each species are sum-marized in Table S4.

3.2 | Phylogenetic inferenceThe concatenated analyses resulted in identical topologies with high bootstrap support (ML) and posterior probabilities (BI) for all lineages, yet with several less supported nodes among them (Figure 1). The separation between the two rec-ognized genera of Uromastycinae is strongly supported, re-covering both Uromastyx and Saara as monophyletic. The 17 species sampled within the subfamily were all recovered as monophyletic.

| 165TAMAR eT Al.

The 14 lineages recovered in the concatenated analyses within Uromastyx are distinct, well supported, and they mostly correspond to current taxonomic classifications (Figure 1; Table S1). Genetic distances (p- distance) appear to be low within each lineage (16S: 0%–1.4%; cytb: 0%–1.5%; ND4: 0%–2%; Table S4). The lowest genetic divergence among spe-cies in the cytb and ND4 markers was found between U. geyri and U. alfredschmidti (16S: 2.03%; cytb: 3.5%; ND4: 4.8%), whereas in the 16S marker, the distances among U. acanthin-ura, U. nigriventris and U. dispar are the lowest (16S: 1.1%–1.5%; cytb: 4.6%–6.4%; ND4: 6.4%–7%). The haplotype networks inferred for the phased full length nuclear markers are presented in Figure 2. The three networks show similar patterns and closely agree with the phylogenetic trees, as most of the observed polymorphism contributes to the differentia-tion of specimens assigned to the 14 lineages/species. In each network, alleles are mostly shared among the African species. The subspecies of U. dispar share alleles in all three networks, but those of U. ornata share alleles only in the NTF3 network. Interestingly, the U. geyri specimen M83 from Tassili N’Ajjer in Algeria, an area of sympatry with the phylogenetically closely related U. alfredschmidti (samples M23 and M24), shares alleles with this species in the three networks.

The mPTP species delimitation analysis recovered 14 de-limited lineages (Figure S1) corresponding to the 14 recog-nized species sampled. The multilocus species trees inferred using *beast and the bp&p analyses were performed by treating each of the 14 mPTP delimited entities as a separate putative species resulting in 13 species (excluding U. prin-ceps due to its incomplete data set; Figure S1). The results of the species trees strongly support most of the interspe-cific relationships in the concatenated analyses, except the weak support for the phylogenetic positions of U. aegyptia, U. macfadyeni and U. thomasi. The results of the bp&p spe-cies delimitation analyses yielded 12 putative species with consistent results regardless of the analytical approach, the rjMCMC algorithm, and the θ and τ priors. The sole specia-tion event that was unsupported in both approaches and in all combinations of priors was between U. geyri and U. alfred-schmidti (<.3 for all combinations of priors).

Based on the different phylogenetic analyses, Uromastyx taxa are divided into five groups (Figures 1–2 and S1). The phylogenetic position of U. thomasi from Oman is not sup-ported in any of the analyses carried out. The widely spread Arabian species, U. aegyptia, was recovered as a sister taxon to the U. ocellata group with strong support in the concatenated analyses, although this support is much lower in the species trees, and in the calibrations and the bio-geographic analyses. In the concatenated analyses, within U. aegyptia, the subspecies U. a. aegyptia from Egypt was recovered as monophyletic, sister taxon to the clade formed by the reciprocally monophyletic subspecies U. a. leptieni and U. a. microlepis from the Arabian Peninsula. The

genetic differentiation within U. aegyptia is extremely low (16S: .2%; cytb: .8%; ND4: .2%; Table S4). Uromastyx benti from Oman and the Yemeni U. shobraki and U. yemenen-sis form a well- supported clade, although the relationships among these three taxa are not supported in any of the analyses carried out. Uromastyx ocellata from Egypt and Sudan and U. ornata from Egypt and Saudi Arabia form a well- supported clade with both species reciprocally mono-phyletic. The latter species comprises two monophyletic subspecies, U. o. ornata from Egypt and U. o. philbyi from Saudi Arabia. The two strongly supported species of the U. princeps group from the Horn of Africa region, U. prin-ceps and U. macfadyeni, form a well- supported clade (the U. princeps group), sister to the U. acanthinura group, strongly supported in the concatenated analyses, but not in the species trees. The five North African species of the U. acanthinura group—U. geyri, U. alfredschmidti, U. dis-par, U. acanthinura and U. nigriventris—are all monophy-letic mostly with strong support, apart from the relationship between the two latter species, which is not supported in both the concatenated and species trees analyses. The four subspecies of the widespread North African species U. dis-par (i.e., U. d. dispar, U. d. flavifasciata, U. d. hodhensis and U. d. maliensis), sampled at both eastern and western edges of its distribution range, cluster together without a resolved phylogenetic structure. The genetic differenti-ation within U. dispar is extremely low (16S: .2%; cytb: .6%; ND4: .2%; Table S4). The speciation event between U. geyri and U. alfredschmidti was not supported by the bp&p species delimitation analyses.

3.3 | Divergence- time estimations and biogeographic inferenceEstimated divergence times based on the three calibration approaches and the concatenated data sets, using one mPTP representative of each lineage of Uromastyx, are presented in Figure S2 and Table S5. The three calibration approaches concurred extremely well presenting nearly identical dates. We therefore calibrated the multilocus species tree with the Uromastyx europaeus fossil (Figures 2 and S3; Table S5) and refer to these ages. Uromastyx started diverging during the Middle Miocene, approximately 16 Mya (12.8–20.9 Mya, 95% highest posterior densities [HPD]). Speciation between the groups appears to have occurred during the Middle–Late Miocene and between species mostly during the Pliocene. Uromastyx princeps, which was excluded from the species tree due to its incomplete data set, diverged from U. macfady-eni approximately 10–12 Mya according to the concatenated analyses (around the same time U. macfadyeni diverged in the species tree; Figure S2; Table S5).

The BI and ML approaches used to estimate ances-tral ranges (i.e., BSSVS and BioGeoBEARS, respectively)

166 | TAMAR eT Al.

produced similar estimates of ancestral areas and are sum-marized in Figure 3. In the ancestral area estimations using BioGeoBEARS, DIVALIKE+J was identified as the best- fitting model (Table S6; see Figure S4 for the results of

each model). The biogeographic origin of Uromastyx was most likely confined to Arabia (i.e., south- west Asia) with later radiations in North Africa and the Horn of Africa re-gion. This origin follows a western dispersal from Asia as

F I G U R E 2 Unrooted haplotype nuclear networks (top) and a time-calibrated multilocus species tree (bottom) of Uromastyx. Circle size in the networks is proportional to the number of alleles with codes correlating to the two alleles (i.e., a and b) of specimens listed in Table S1. The multilocus species tree was calibrated with the Uromastyx europaeus fossil (see Material and Methods; Uromastyx princeps was excluded due to incomplete data set). Mean age estimates with the 95% highest posterior densities (in brackets) are indicated near the nodes (see Figure S3 and Table S5). White circles represent nodes with posterior probability values ≥.95 [Colour figure can be viewed at wileyonlinelibrary.com]

| 167TAMAR eT Al.

the biogeographic distribution of Saara, the sister genus to Uromastyx, is Asian.

4 | DISCUSSION

This study provides a comprehensive phylogenetic recon-struction and assessment of the inter- and intraspecific rela-tionships, diversity and historical biogeography of the genus Uromastyx. The data presented feature the largest taxon sampling to date, with representatives of all but one (U. occi-dentalis) presently recognized species and subspecies of the genus. Specimens throughout the species’ distribution ranges were incorporated, and several phylogenetic and coalescent- based methods were applied to generate concatenated trees, species trees and ancestral area reconstructions.

4.1 | Phylogenetic relationships and systematic implicationsThe inferred topologies in our study were mostly congru-ent across analyses and generally support those of Joger (1986), Amer and Kumazawa (2005a), Harris et al. (2007) and Wilms et al. (2009). The broader sampling in our study present the Uromastyx taxa as phylogenetically divided into five main well- supported groupings (similar to Wilms et al., 2009): U. thomasi (Arabian Peninsula), U. aegyptia

(Arabian Peninsula and Egypt), U. ocellata group (Arabian Peninsula and west of the Red Sea), U. princeps group (Horn of Africa) and the U. acanthinura group (North Africa). With few exceptions, both the concatenated anal-yses and the multilocus species trees were consistent with most taxonomic classifications within Uromastyx. We thus retain the status of most recognized species and subspecies (Figures 1–2): U. acanthinura, U. aegyptia (and its three subspecies: U. a. aegyptia, U. a. leptieni and U. a. micro-lepis), U. benti, U. dispar, U. geyri, U. macfadyeni, U. ni-griventris, U. ocellata, U. ornata (and its two subspecies: U. o. ornata and U. o. philbyi), U. princeps, U. shobraki, U. thomasi and U. yemenensis.

Morphological studies have previously suggested that U. thomasi may be phylogenetically closely related to the African species U. princeps based on their exceptionally short tail length (Moody, 1987; Wilms, 2001, 2005; Wilms & Böhme, 2007). This notion was refuted in Wilms et al. (2009) suggesting that this is an example of evolutionary con-vergence. The phylogenetic position of U. thomasi remains unresolved in our phylogenetic analyses (as in Wilms et al., 2009), although Wilms (2005) suggested, based on external morphology, that it may be sister to its remaining congeners.

The polytypic species U. aegyptia comprises three sub-species: U. a. aegyptia, U. a. leptieni and U. a. microlepis. The taxonomic status of these subspecies was often debated (e.g., Arnold, 1980; Joger, 1986; Moody, 1987; Wilms, 2005;

F I G U R E 3 Ancestral area reconstructions of Uromastyx estimated using the concatenated data with BioGeoBEARS (left) and BSSVS (right). A pie chart describing the probability of each inferred area is presented near the major nodes (ranges visualized in the lower left map). For the BSSVS analysis, branch colours indicate inferred ancestral range and posterior probabilities values are indicated near the nodes [Colour figure can be viewed at wileyonlinelibrary.com]

168 | TAMAR eT Al.

Wilms & Böhme, 2000a, 2000b, 2007). The three subspe-cies are reciprocally monophyletic, present a low genetic variability among them (Table S4; see also Wilms et al., 2009) and have different morphology (Wilms, 2005; Wilms & Böhme, 2000a, 2000b; Wilms et al., 2009). We thus val-idate their subspecific status. Interestingly, a single sample of U. aegyptia ssp. from the Dhofar Governorate in southern Oman clusters with two samples of U. a. leptieni from the UAE (Table S1; Figure 1). This result may indicate a possible range extension for this subspecies (Sindaco & Jeremčenko, 2008; Wilms, 2005; Wilms & Böhme, 2000a, 2000b; Wilms et al., 2009), although further data are necessary to confirm this hypothesis.

The well- supported U. ocellata group consists of five closely related species and subdivided into two subgroups: one is comprised of U. benti, U. shobraki and U. yemenen-sis from the southern Arabian Peninsula; the other comprises U. ocellata and U. ornata from both sides of the Red Sea. The monophyly of each species and the relationships recov-ered are supported in this study as suggested by previous morphological examinations and phylogenetic works using mitochondrial data only (Wilms & Schmitz, 2007; Wilms et al., 2009). Both U. ocellata and U. ornata are distinct in every analysis, and they do not share alleles in the nuclear networks, supporting their specific status. The two subspe-cies of the latter taxon (i.e., U. o. ornata and U. o. philbyi) also do not share alleles in the ACM4 and MC1R networks. Within the southern Arabian subgroup, although the phylo-genetic relationships are not well supported among the taxa, U. shobraki does not share alleles in the nuclear networks and is divergent in all analyses, supporting its taxonomic and spe-cific distinctiveness from its previously conspecific U. yeme-nensis, as suggested in Wilms et al. (2009).

The U. princeps group includes the two species from the Horn of Africa region, U. princeps and U. macfadyeni. These two species are clearly distinct in their morphology (Moody, 1987; Wilms et al., 2009) and were previously af-filiated with different groups (i.e., U. princeps with U. thom-asi and U. macfadyeni with the U. ocellata group; Moody, 1987; Wilms & Böhme, 2000a, 2000b; Wilms, 2005). The genetic results herein confirm the phylogenetic relationships presented in Wilms et al. (2009) and in Wilms and Schmitz (2007), although these genetic results conflict with the dis-tinct morphology of the species.

The phylogenetic structure of the U. acanthinura group is similar to the topology shown in Amer and Kumazawa (2005a), but differs from that in Harris et al. (2007) and Wilms et al. (2009). The three taxa, U. acanthinura, U. dis-par and U. nigriventris, form a subgroup, and U. geyri and U. alfredschmidti form another. The morphological dif-ferentiation and the mitochondrial differentiation among the members of this group have been previously evaluated (Wilms & Böhme, 2001; Wilms et al., 2009) and are mostly

supported by the genetic results in this study (Figures 1–2; Table S4). The sympatry of U. geyri and U. alfredschmidti with U. dispar, their distinct morphology and their separa-tion in each of the genetic analyses are a strong evidence of their separated species status. Within the subgroup of U. dis-par, U. acanthinura and U. nigriventris, the genetic results and the species delimitation analyses support their distinct status, although the phylogenetic relationships among the taxa are less supported in the concatenated analyses and species trees. In the nuclear networks of ACM4 and NTF3, U. acanthinura and U. nigriventris do not share alleles, but do so in the MC1R network. Without further data from their contact zones, and no evidence of the contrary, we retain them as valid species. Nonetheless, future studies with addi-tional samples from the contact zones of these three species will allow to further investigate hypotheses concerning their diversification and phylogenetic relationships.

Our results highlight two unexpected discrepancies from the known taxonomy of the African U. acanthinura group. First, the divergence between two species, U. geyri and U. al-fredschmidti, is not supported by the bp&p species delimita-tion analyses, contrary to some expectations derived from morphological and taxonomic studies (Sindaco, Wilms, & Venchi, 2012; Wilms & Böhme, 2001; Wilms et al., 2009). The genetic divergence of these two taxa is also among the lowest in the genus, and they share alleles in each nuclear network, even between samples from distant localities, not presenting any geographic structure. These unexpected re-sults may stem from a recent speciation event (Figure 2), thus the lack of substantial time to accumulate genetic divergence. Additionally, the two species are morphologically distinct, even though they are sympatric in the Tassili N’Ajjer area in Algeria (samples M23 and M24 of U. alfredschmidti and M83 and M84 of U. geyri). We thus retain them as valid species and advocate for further taxonomic scrutiny with other sources of data to fully evaluate the status of these two taxa and the pos-sible presence of gene flow between their sympatric popula-tions. The second discrepancy found in our molecular results is the admixture of samples identified as the four subspecies of U. dispar (Figure 1). Samples of U. d. dispar from the eastern edge of the distribution range (i.e., Egypt, Sudan and Chad) are phylogenetically exceptionally close to samples of U. d. flavifasciata from the western edge (i.e., Algeria, Morocco and Mauritania) displaying an extremely low genetic diver-sity (Table S4). Unfortunately, due to the low representation of two subspecies, U. d. maliensis and U. d. hodhensis, and lack of samples from the contact zones of all four subspecies, we are unable to fully account for their systematic status.

4.2 | Historical biogeographyTime- calibrated phylogenies of Uromastyx have been pre-sented in two studies using immunological distance data

| 169TAMAR eT Al.

(Joger, 1986) and gamma- corrected distances of the ND2 amino acid sequences and of the nucleotide sequences be-tween tRNAGln and tRNATyr genes (Amer & Kumazawa, 2005a). In this study, using the Uromastyx europaeus fos-sil, supported by seven other agamid calibration points, we provide further insights into the timeframe of cladogenesis of Uromastyx. The general pattern of the Uromastycinae di-versity elucidated in this study resembles some hypotheses derived from phylogeographic and biogeographic studies on the genera, presenting an Asia to Africa dispersal (Amer & Kumazawa, 2005a; Joger, 1986; Moody, 1980, 1987; Wilms et al., 2009). The results of the ancestral area reconstructions are in accordance with previous studies by suggesting that Uromastyx most likely originated in Arabia (i.e., northern Arabia, south- west Asia) during the Middle Miocene with later radiations in North Africa.

Divergence between the Asian Saara and the Afro- Arabian Uromastyx is estimated to have occurred during the Middle Oligocene (Figures S2–S3; Table S5). This estimate predates a known Arabian- Eurasian land connection, which leads us to agree with the hypothesis postulated by Amer and Kumazawa (2005a). They speculated that an initial stage of radiation occurred in south- west Asia before the formation of a land bridge/connection between Asia and Arabia, with the ancestor of Uromastyx derived from one of these diversified lineages. Uromastyx taxa started diverging during the Middle Miocene according to our estimates, approximately 16 Mya (95% HPD: 12.8–20.9 Mya). After a temporary period of dis-connection of the Gomphotherium land bridge (~18–16 Mya) connecting Eurasia and Afro- Arabia, a terrestrial land bridge was continuously present since ca. 15 Mya (Harzhauser et al., 2007; Rögl, 1998; Steininger & Wessely, 2000). The Gomphotherium land bridge and the later connection enabled faunal exchange from Asia to Afro- Arabia and vice versa, in-cluding the possible western/southern dispersal of Uromastyx into Arabia. Uromastyx cladogenesis was most likely facili-tated by the global climate change during the Miocene and the subsequent aridification process that greatly altered the landscapes of the Saharo- Arabian region (Flower & Kennett, 1994; Griffin, 2002; Hsü et al., 1977; Le Houérou, 1992, 1997; Ruddiman, Raymo, Martinson, Clement, & Backman, 1989; Zachos, Pagani, Sloan, Thomas, & Billups, 2001). The aridification process in Arabia and North Africa has proba-bly contributed to the dispersal of Uromastyx to new suitable habitats. These conditions may have also facilitated the diver-gence of U. aegyptia and U. thomasi (Figures 2–3).

The divergence within the Arabian U. ocellata group (ca. 3.8–9.9 Mya; 95% HPD: 2.5–13 Mya) during the Late Miocene and the Pliocene is hypothesized to have resulted mainly from habitat fragmentation caused by the tectonic instability around the Red Sea. This period in the south- west Arabia region has been characterized by tectonic and geological activity in the Arabian shield, and by the active

Afro- Arabian rift system, causing seismic activity, periodic volcanism and mountain ridges uplifting (Bohannon 1989; Girdler, 1991; Bosworth et al., 2005; Kusky, Robinson, & El- Baz, 2005; Edgell, 2006). These changing landscapes and habitats are hypothesized to have facilitated the diver-gence within other reptile genera such as the agamid genus Pseudotrapelus (Tamar, Scholz, et al., 2016), and within Hemidactylus geckos (Šmíd et al., 2013). Within the U. ocel-lata group, the African species U. ocellata diverged from its close relative, U. ornata, approximately 6 Mya (Figure 2). Originating from the Arabian U. ocellata group, it is clear that U. ocellata attained its current African range from Arabia, although it is not entirely clear whether its African range was obtained through vicariance or via dispersal. Both U. ocellata and U. ornata occur in Egypt, at the northern edge of their distribution ranges, thus hypothesizing disper-sal through this northern route is a likely scenario. On the other hand, both species also occur near the Bab- el- Mandeb strait in their southern range. The confidence interval of our time estimate (95% HPD: 3.8–8 Mya) does not rule out the reopening of the Bab- el- Mandeb strait as a vicariant event at around ~5 Mya (Bosworth et al., 2005; Girdler, 1984).

The separation of the U. princeps group distributed across the Horn of Africa region from the North African U. acanthi-nura group is hypothesized to result from the tectonic and sub-sequent geological activity of the Afar mantle plume (similar to that suggested by Amer & Kumazawa, 2005a). The U. prin-ceps group is distributed at the southern edge of the Afar zone, the East African Rift Valley and the Ethiopian Highlands, whereas the U. acanthinura group ranges north- west of them, in the arid region of North Africa (Figure 1). The volcanism, the formation of the East African Rift Valley and the uplift-ing of mountain ridges associated with the tectonic movement of the Arabian plate separating from Africa (Bosworth et al., 2005; Girdler, 1991) may have created terrestrial barriers and habitat fragmentation, and the consequent separation of the U. princeps group from its North African relatives.

The radiation within the North African U. acanthinura group is estimated to have occurred during the Pliocene and Middle Pleistocene (~0.23–4.1 Mya). Although we provide different ages, this timeframe resembles the period suggested in Joger (1986) and Amer and Kumazawa (2005a). We agree with the hypothesis suggested by the latter study regarding the climatic effect on the cladogenesis within the group. During the Quaternary (~2.5–0 Mya), North Africa underwent sev-eral dry- wet climatic cycles, leading to the expansion and contraction of arid areas, which in turn prompted large fluc-tuations in floral and faunal distributions (Le Houérou, 1997; Ruddiman et al., 1989). We hypothesize that these climatic fluctuations have facilitated divergence among Uromastyx populations, through the dynamic expansion and contraction of their arid habitats, enabling contact and fragmentation of populations, respectively.

170 | TAMAR eT Al.

5 | CONCLUSIONS

In this study, we contribute to the understanding of the evo-lutionary history of Uromastyx from the Saharo- Arabian re-gion. We support the status of most species using multilocus coalescent analyses, which are generally accurately repre-sented by current taxonomy, and provide a new timeframe of cladogenesis and biogeographic assessments. Our results strongly support the long- held hypothesis that Uromastyx originated from an ancestor in south- west Asia during the Middle Oligocene to the Early Miocene, and radiated and dispersed in Arabia and later in North Africa from the Middle Miocene onwards. Throughout its Saharo- Arabian coloni-zation, occurring during an influential period in the evolu-tion of the regional fauna, Uromastyx underwent multiple vicariance and dispersal events, hypothesized to be derived from tectonic motions, habitat fragmentation and the chang-ing climate. Our phylogenetic and biogeographic inferences supplement the growing body of work evaluating the effects of the tectonic separation of Arabia and Africa and the cli-matic oscillations on the evolutionary history of the Saharo- Arabian fauna.

ACKNOWLEDGEMENTS

We wish to thank the Nature Conservation Department of the Ministry of Environment and Climate Affairs, Oman, for their support and to the following people for providing sam-ples for this study, or for helping in the field: F. Amat, E.N. Arnold, A. Bauer, D. Donaire, Y. Gauthier, E. Gómez- Díaz, D.J. Harris, P. Kodym, P. Leptien, Y. Mansier, H. Nickel, J. Padial, O. Peyre, J.M. Pleguezuelos, J. Renoult, M. Rodriguez and J.F. Trape. This work was funded by grant CGL2015- 70390- P from the Ministerio de Economía y Competitividad, Spain (cofunded by FEDER) and grant 2014- SGR- 1532 from the Secretaria d’Universitats i Recerca del Departament d’Economia i Coneixement de la Generalitat de Catalunya.

ORCID

Karin Tamar http://orcid.org/0000-0003-2375-4529

REFERENCES

Amer, S. A. (2011). Genetic variability of the Saudi Arabian Uromastyx aegyptia microlepis using protein and isoenzymes electrophore-ses. Advances in Bioscience and Biotechnology, 2, 27. https://doi.org/10.4236/abb.2011.21005

Amer, S. A., Ahmed, M. M., Wilms, T. M., Shobrak, M., & Kumazawa, Y. (2012). Mitochondrial DNA variability within Uromastyx ornata philbyi (Agamidae: Squamata) from Southwestern Saudi Arabia. Comparative and Functional Genomics, 2012, 851379. https://doi.org/10.1155/2012/851379

Amer, S. A., & Kumazawa, Y. (2005a). Mitochondrial DNA sequences of the Afro- Arabian spiny- tailed lizards (genus Uromastyx; family Agamidae): Phylogenetic analyses and evolution of gene arrange-ments. Biological Journal of the Linnaean Society, 85, 247–260. https://doi.org/10.1111/j.1095-8312.2005.00485.x

Amer, S. A., & Kumazawa, Y. (2005b). Mitochondrial genome of Pogona vitticepes (Reptilia; Agamidae): Control region duplica-tion and the origin of Australasian agamids. Gene, 346, 249–256. https://doi.org/10.1016/j.gene.2004.11.014

Amer, S. A., & Kumazawa, Y. (2009). Molecular affinity of Somali and Egyptian mastigures among the Afro- Arabian Uromastyx. Egyptian Journal of Experimental Biology, Zoology, 5, 1–7.

Arnold, E. N. (1980). Reptiles and amphibians of Dhofar, Southern Arabia. In S. N. Shaw-Reade, J. B. Sale, M. D. Gallagher & R. H. Daly (Eds.), The scientific results of the Oman flora and fauna survey 1977 (Dhofar) (pp. 273–332). Special Report: Journal of Oman Studies.

Augé, M. (1988). Revision du lézard Uromastyx europaeus (Reptilia, Lacertilia) de l’Oligocène français. Analyse functionelle de l’appar-eil masticateur de genre Uromastix et implications paleoécologiques. Revue de Paléobiologie, 7, 317–325.

Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median- joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution, 16, 37–48. https://doi.org/10.1093/oxfordjournals.mol-bev.a026036

Bohannon, R. G., Naeser, C. W., Schmidt, D. L., & Zimmermann, R. A. (1989). The timing of uplift, volcanism, and rifting peripheral to the Red Sea: A case for passive rifting? Journal of Geophysical Research: Solid Earth, 94, 1683–1701. https://doi.org/10.1029/JB094iB02p01683

Bosworth, W., Huchon, P., & McClay, K. (2005). The Red Sea and Gulf of Aden basins. Journal of African Earth Sciences, 43, 334–378. https://doi.org/10.1016/j.jafrearsci.2005.07.020

Bruen, T. C., Hervé, P., & Bryant, D. (2006). A simple and robust statis-tical test for detecting the presence of recombination. Genetics, 172, 2665–2681. https://doi.org/10.1534/genetics.105.048975

Carranza, S., & Arnold, E. N. (2012). A review of the geckos of the genus Hemidactylus (Squamata: Gekkonidae) from Oman based on morphology, mitochondrial and nuclear data, with descriptions of eight new species. Zootaxa, 3378, 1–95.

Castresana, J. (2000). Selection of conserved blocks from multi-ple alignments for their use in phylogenetic analysis. Molecular Phylogenetics and Evolution, 17, 540–552. https://doi.org/10.1093/oxfordjournals.molbev.a026334

Ching, O. O., & Chng, S. C. (2016). The use of spiny- tailed lizards Uromastyx spp. for medicinal purposes in Peninsular Malaysia. TRAFFIC Bulletin, 28, 35.

Covacevich, J., Couper, P., Molnar, R. E., Witten, G., & Young, W. (1990). Miocene dragons from Riversleigh: New data on the history of the family Agamidae (Reptilia: Squamata) in Australia. Memoirs of the Queensland Museum, 29, 339–360.

Darriba, D., Taboada, G. L., Doallo, R., & Posada, D. (2012). jModelT-est 2: More models, new heuristics and parallel computing. Nature Methods, 9, 772. https://doi.org/10.1038/nmeth.2109

De Stefano, G. (1903). I Sauri del Quercy appartenenti alla collezione Rossignol. Atti della Società Italiana di Scienze naturali e del Museo Civico di Storia naturale in Milano, 42, 382–418.

Drummond, A. J., Suchard, M. A., Xie, D., & Rambaut, A. (2012). Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29, 1969–1973. https://doi.org/10.1093/molbev/mss075

| 171TAMAR eT Al.

Edgell, H. S. (2006). Arabian deserts: Nature, origin and evolution. Dordrecht, the Netherlands: Springer Science & Business Media. https://doi.org/10.1007/1-4020-3970-0

von Fischer, J. (1885). Der veränderliche Schleuderschwanz (Uromastyx acanthinurus BELL.) in der Gefangenschaft. Der Zoologische Garten, 26, 269–278.

Flot, J. F. (2010). SeqPHASE: A web tool for interconvert-ing PHASE input/output files and FASTA sequence align-ments. Molecular Ecology Resources, 10, 162–166. https://doi.org/10.1111/j.1755-0998.2009.02732.x

Flower, B. P., & Kennett, J. P. (1994). The middle Miocene climatic transition: East Antarctic ice sheet development, deep ocean circulation and global carbon cycling. Palaeogeography, Palaeoclimatology, Palaeoecology, 108, 537–555. https://doi.org/10.1016/0031-0182(94)90251-8

Ghebreab, W. (1998). Tectonics of the Red Sea region reassessed. Earth- Science Reviews, 45, 1–44. https://doi.org/10.1016/S0012-8252(98) 00036-1

Girdler, R. W. (1984). The evolution of the Gulf of Aden and Red Sea in space and time. Deep Sea Research Part A. Oceanographic Research Papers, 31, 747–762. https://doi.org/10.1016/0198-0149(84)90039-6

Girdler, R. W. (1991). The Afro- Arabian rift system – an overview. Tectonophysics, 197, 139–153. https://doi.org/10.1016/0040-1951 (91)90038-T

Gray, J. (1845). A synopsis of the genera of reptiles and amphibians, with a description of some new species. Annual philosophy Society London (Ser. 2), 10, 193–217.

Griffin, D. L. (2002). Aridity and humidity: Two aspects of the late Miocene climate of North Africa and the Mediterranean. Palaeogeography, Palaeoclimatology, Palaeoecology, 182, 65–91. https://doi.org/10.1016/S0031-0182(01)00453-9

Guindon, S., & Gascuel, O. (2003). A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 52, 696–704. https://doi.org/10.1080/10635150390235520

Harris, D. J., Vaconcelos, R., & Brito, J. C. (2007). Genetic variation within African spiny- tailed lizards (Agamidae: Uromastyx) esti-mated using mitochondrial DNA sequences. Amphibia- Reptilia, 28, 1–6. https://doi.org/10.1163/156853807779799144

Harzhauser, M., Kroh, A., Mandic, O., Piller, W. E., Göhlich, U., Reuter, M., & Berning, B. (2007). Biogeographic responses to geodynam-ics: A key study all around the Oligo- Miocene Tethyan Seaway. Zoologischer Anzeiger, 246, 241–256. https://doi.org/10.1016/j.jcz.2007.05.001

Heled, J., & Drummond, A. J. (2010). Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution, 27, 570–580. https://doi.org/10.1093/molbev/msp274

Hsü, K. J., Montadert, L., Bernoulli, D., Cita, M. B., Erickson, A., Garrison, R. E., … Wright, R. (1977). History of the Mediterranean salinity crisis. Nature, 267, 399–403. https://doi.org/10.1038/267399a0

Hugall, A. F., Foster, R., Hutchinson, M., & Lee, M. S. (2008). Phylogeny of Australasian agamid lizards based on nuclear and mitochondrial genes: Implications for morphological evolution and biogeography. Biological Journal of the Linnean Society, 93, 343–358. https://doi.org/10.1111/j.1095-8312.2007.00911.x

Huson, D. H., & Bryant, D. (2006). Application of phylogenetic net-works in evolutionary studies. Molecular Biology Evolution, 23, 254–267. https://doi.org/10.1093/molbev/msj030

Joger, U. (1986). Phylogenetic analysis of Uromastyx lizards, based on albumin immunological distances. Studies in Herpetology (pp. 187–192). Prague, Czech Republic: Charles University.

Joger, U. (1991). A molecular phylogeny of agamid lizards. Copeia, 1991, 616–622. https://doi.org/10.2307/1446389

Kapli, P., Lutteropp, S., Zhang, J., Kobert, K., Pavlidis, P., Stamatakis, A., & Flouri, T. (2016). Multi- rate Poisson Tree Processes for single- locus species delimitation under Maximum Likelihood and Markov Chain Monte Carlo. Bioinformatics, 33, 1630–1638.

Kapli, P., Lymberakis, P., Crochet, P. A., Geniez, P., Brito, J. C., Almutairi, M., … Poulakakis, N. (2015). Historical biogeography of the lacertid lizard Mesalina in North Africa and the Middle East. Journal of Biogeography, 42, 267–279. https://doi.org/10.1111/jbi.12420

Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence align-ment software version 7: Improvements in performance and us-ability. Molecular Biology and Evolution, 30, 772–780. https://doi.org/10.1093/molbev/mst010

Knapp, A. (2004). An assessment of the international trade in Spiny-tailed Lizards Uromastyx with a focus on the role of the European Union. CITES Doc AC Inf. 13.

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33, 1870–1874. https://doi.org/10.1093/molbev/msw054

Kusky, T., Robinson, C., & El-Baz, F. (2005). Tertiary- Quaternary faulting and uplift in the northern Oman Hajar Mountains. Journal of the Geological Society, 162, 871–888. https://doi.org/10.1144/0016-764904-122

Landis, M. J., Matzke, N. J., Moore, B. R., & Huelsenbeck, J. P. (2013). Bayesian analysis of biogeography when the number of areas is large. Systematic Biology, 62, 789–804. https://doi.org/10.1093/sysbio/syt040

Lanfear, R., Calcott, B., Ho, S. Y., & Guindon, S. (2012). PartitionFinder: Combined selection of partitioning schemes and substitution mod-els for phylogenetic analyses. Molecular Biology and Evolution, 29, 1695–1701. https://doi.org/10.1093/molbev/mss020

Le Houérou, H. N. (1992). Outline of the biological history of the Sahara. Journal of Arid Environments, 22, 3–30.

Le Houérou, H. N. (1997). Climate, flora and fauna changes in the Sahara over the past 500 million years. Journal of Arid Environments, 37, 619–647. https://doi.org/10.1006/jare.1997.0315

Leaché, A. D., & Fujita, M. K. (2010). Bayesian species delimitation in West African forest geckos (Hemidactylus fasciatus). Proceedings of the Royal Society B, 277, 3071–3077. https://doi.org/10.1098/rspb.2010.0662

Leaché, A. D., Wagner, P., Linkem, C. W., Böehme, W., Papenfuss, T. J., Chong, R. A., … Burbrink, F. T. (2014). A hybrid phylogenetic- phylogenomic approach for species tree estimation in African Agama lizards with applications to biogeography, character evolu-tion, and diversification. Molecular Phylogenetics and Evolution, 79, 215–230. https://doi.org/10.1016/j.ympev.2014.06.013

Lemey, P., Rambaut, A., Drummond, A., & Suchard, M. (2009). Bayesian phylogeography finds its roots. PLoS Computational Biology, 5, e1000520.

Macey, J. R., Schulte, J. A., Larson, A., Ananjeva, N. B., Wang, Y., Pethiyagoda, R., … Papenfuss, T. J. (2000). Evaluating trans- Tethys migration: An example using acrodont lizard phylogenet-ics. Systematic Biology, 49, 233–256. https://doi.org/10.1093/sysbio/49.2.233

Mahmood, T., Shah, S. M. A., Rais, M., & Nadeem, M. S. (2011). An investigation of animal species trade at pet shops of Rawalpindi and Multan cities. The Journal of Animal and Plant Science, 21, 822–929.

172 | TAMAR eT Al.

Mateo, J. A., Geniez, P., Lopez-Jurado, L. F., & Bons, J. (1999). Chorological analysis and morphological variation of Saurians of the genus Uromastyx (Reptilia, Agamidae) in the West of the Sahara: Description of two new taxa. Revista Española de Herpetológia, 12, 97–109.

Matzke, N. J. (2013). Probabilistic historical biogeography: New models for founder- event speciation, imperfect detection, and fossils allow improved accuracy and model- testing. Frontiers of Biogeography, 5, 242–248.

Merrem, B. (1820). Versuch eines Systems der Amphibien. Marburg, Germany: Krieger. https://doi.org/10.5962/bhl.title.5037

Metallinou, M., Arnold, E. N., Crochet, P. A., Geniez, P., Brito, J. C., Lymberakis, P., … Carranza, S. (2012). Conquering the Sahara and Arabian deserts: Systematics and biogeography of Stenodactylus geckos (Reptilia: Gekkonidae). BMC Evolutionary Biology, 12, 258. https://doi.org/10.1186/1471-2148-12-258

Metallinou, M., Červenka, J., Crochet, P. A., Kratochvíl, L., Wilms, T., Geniez, P., … Carranza, S. (2015). Species on the rocks: Systematics and biogeography of the rock- dwelling Ptyodactylus geckos (Squamata: Phyllodactylidae) in North Africa and Arabia. Molecular Phylogenetics and Evolution, 85, 208–220. https://doi.org/10.1016/j.ympev.2015.02.010

Miller, M., Pfeiffer, W., & Schwartz, T. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop (GCE) (pp. 1–8). New Orleans, LA: IEEE.

Moody, S. (1980). Phylogenetic and Historical Biogeographical Relationships of the Genera in the Family Agamidae (Reptilia Lacertilia).Unpublished PhD thesis, University of Ann Arbor, Ann Arbor, MI.

Moody, S. M. (1987). A preliminary cladistic study of the lizard genus Uromastyx (Agamidae, sensu lato), with a checklist and diag-nostic key to the species. In J. J. van Gelder, H. Strijbosch & P. J. M. Bergers (Eds.), Proceedings of the Fourth Ordinary General Meeting of the Societas Europaea Herpetologica (pp. 285–288). Holland, the Netherlands: Nijmegen.

Papenfuss, T. J., Jackman, T., Bauer, A., Stuart, B. L., Robinson, M. D., & Parham, J. F. (2009). Phylogenetic relationships among species in the sphaerodactylid lizard genus Pristurus. Proceedings of the California Academy of Sciences, 60, 675.

Pechmann, J., Scott, D., Semlisch, R., Caldwell, J., & Vitt, L. (2005). West- Africa, Madagascar, Central- and South- America: Main ori-gins of the CITES- listed lizard pet market in France. Herpetological Review, 36, 133–137.

Pook, C. E., Joger, U., Stümpel, N., & Wüster, W. (2009). When con-tinents collide: Phylogeny, historical biogeography and systematics of the medically important viper genus Echis (Squamata: Serpentes: Viperidae). Molecular Phylogenetics and Evolution, 53, 792–807. https://doi.org/10.1016/j.ympev.2009.08.002

Popov, S. V., Rögl, F., Rozanov, A. Y., Steininger, F. F., Shcherba, I. G., & Kovac, M. (2004). Lithological- Paleogeographic maps of Paratethys.10 Maps Late Eocene to Pliocene. Courier Forschungsinstitut Senckenberg, 250, 1–46.

Portik, D. M., & Papenfuss, T. J. (2012). Monitors cross the Red Sea: The biogeographic history of Varanus yemenensis. Molecular Phylogenetics and Evolution, 62, 561–565. https://doi.org/10.1016/j.ympev.2011.09.024

Pyron, R. A., Burbrink, F. T., & Wiens, J. J. (2013). A phylogeny and revised classification of Squamata, including 4161 species of

lizards and snakes. BMC Evolutionary Biology, 13, 93. https://doi.org/10.1186/1471-2148-13-93

Rage, J. C., & Augé, M. (2015). Valbro: A new site of vertebrates from the early Oligocene (MP 22) of France (Quercy). III- Amphibians and squamates. Annales de Paleontologie, 101, 29–41. https://doi.org/10.1016/j.annpal.2014.10.002

Rambaut, A., Suchard, M. A., Xie, D., & Drummond, A. J. (2014). Tracer v1.6. Available from http://beast.bio.ed.ac.uk/Tracer.

Rannala, B., & Yang, Z. (2013). Improved reversible jump algorithms for Bayesian species delimitation. Genetics, 194, 245–253.

Ree, R. H., Moore, B. R., Webb, C. O., & Donoghue, M. J. (2005). A likelihood framework for inferring the evolution of geographic range on phylogenetic trees. Evolution, 59, 2299–2311. https://doi.org/10.1111/j.0014-3820.2005.tb00940.x

Ree, R. H., & Smith, S. A. (2008). Maximum likelihood infer-ence of geographic range evolution by dispersal, local extinc-tion, and cladogenesis. Systematic Biology, 57, 4–14. https://doi.org/10.1080/10635150701883881

Robinson, J. E., Griffiths, R. A., John, F. A. S., & Roberts, D. L. (2015). Dynamics of the global trade in live reptiles: Shifting trends in pro-duction and consequences for sustainability. Biological Conservation, 184, 42–50. https://doi.org/10.1016/j.biocon.2014.12.019

Rögl, F. (1998). Palaeogeographic considerations for Mediterranean and Paratethys seaways (Oligocene to Miocene). Annalen des Naturhistorischen Museums in Wien, 99, 279–310.

Ronquist, F. (1997). Dispersal- vicariance analysis: A new approach to the quantification of historical biogeography. Systematic Biology, 46, 195–203. https://doi.org/10.1093/sysbio/46.1.195

Ronquist, F., Teslenko, M., Mark, P., van der Ayres, D. L., Darling, A., Höhna, S., … Huelsenbeck, J. P. (2012). MrBayes 3.2: Efficient Bayesian phylogenetic inference  and model choice across a large model space. Systematic Biology, 61, 1–4.

Ruddiman, W. F., Raymo, M., Martinson, D. G., Clement, B. M., & Backman, J. (1989). Pleistocene evolution: Northern hemisphere ice sheets and North Atlantic Ocean. Paleoceanography, 4, 353–412. https://doi.org/10.1029/PA004i004p00353

Silvestro, D., & Michalak, I. (2012). raxmlGUI: A graphical front- end for RAxML. Organisms Diversity and Evolution, 12, 335–337. https://doi.org/10.1007/s13127-011-0056-0

Sindaco, R., & Jeremčenko, V. K. (2008). The reptiles of the Western Palearctic. 1. Annotated checklist and distributional atlas of the turtles, crocodiles, amphisbaenians and lizards of Europe, North Africa, Middle East and Central Asia. Edizioni Belvedere Latina, Monografie della Societas Herpetologica Italica.

Sindaco, R., Wilms, T. M., & Venchi, A. (2012). On the distribution of Uromastyx alfredschmidti Wilms and Böhme, 2000 (Squamata: Agamidae: Uromastycinae). Acta Herpetologica, 7, 23–28.

Šmíd, J., Carranza, S., Kratochvíl, L., Gvoždík, V., Nasher, A. K., & Moravec, J. (2013). Out of Arabia: A complex biogeographic his-tory of multiple vicariance and dispersal events in the gecko genus Hemidactylus (Reptilia: Gekkonidae). PLoS One, 8, e64018.

Stamatakis, A. (2006). RAxML- VI- HPC: Maximum likelihood- based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690. https://doi.org/10.1093/bioinformatics/btl446

Steininger, F. F., & Wessely, G. (2000). From the Tethyan Ocean to the Paratethys Sea: Oligocene to Neogene stratigraphy, paleoge-ography and paleobiogeography of the circum- Mediterranean region and the Oligocene to Neogene basin evolution in Austria.

| 173TAMAR eT Al.

Mitteilungen der Österreichischen Geologischen Gesellschaft, 92, 95–116.

Stephens, M., & Scheet, P. (2005). Accounting for decay of linkage disequilibrium in haplotype inference and missing- data imputation. The American Journal of Human Genetics, 76, 449–462. https://doi.org/10.1086/428594

Stephens, M., Smith, N. J., & Donnelly, P. (2001). A new statistical method for haplotype reconstruction from population data. The American Journal of Human Genetics, 68(4), 978–989. https://doi.org/10.1086/319501

Talavera, G., & Castresana, J. (2007). Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology, 56, 564–577. https://doi.org/10.1080/10635150701472164

Tamar, K., Carranza, S., In den Bosch, H., Sindaco, R., Moravec, J., & Meiri, S. (2015). Hidden relationships and genetic diversity: Molecular phylogeny and phylogeography of the Levantine lizards of the genus Phoenicolacerta (Squamata: Lacertidae). Molecular Phylogenetics and Evolution, 91, 86–97. https://doi.org/10.1016/j.ympev.2015.05.002

Tamar, K., Carranza, S., Sindaco, R., Moravec, J., & Meiri, S. (2014). Systematics and phylogeography of Acanthodactylus schreiberi and its relationships with Acanthodactylus boskianus (Reptilia: Squamata: Lacertidae). Zoological Journal of the Linnean Society, 172, 720–739. https://doi.org/10.1111/zoj.12170

Tamar, K., Carranza, S., Sindaco, R., Moravec, J., Trape, J. F., & Meiri, S. (2016). Out of Africa: Phylogeny and biogeography of the widespread genus Acanthodactylus (Reptilia: Lacertidae). Molecular Phylogenetics and Evolution, 103, 6–18. https://doi.org/10.1016/j.ympev.2016.07.003

Tamar, K., Scholz, S., Crochet, P.-A., Geniez, P., Meiri, S., Schmitz, A., … Carranza, S. (2016). Evolution around the Red Sea: Systematics and biogeography of the agamid genus Pseudotrapelus (Squamata: Agamidae) from North Africa and Arabia. Molecular Phylogenetics and Evolution, 97, 55–68. https://doi.org/10.1016/j.ympev.2015.12.021

Theobald, W. (1868). Catalogue of the Reptiles of British Birma, embracing the Provinces of Pegu, Martaban, and Tenasserim; with descriptions of new or little known species. Journal of the Linnean Society of London, Zoology, 10, 4–67. https://doi.org/10.1111/j.1096-3642.1868.tb02007.x

Tonini, J. F. R., Beard, K. H., Ferreira, R. B., Jetz, W., & Pyron, R. A. (2016). Fully- sampled phylogenies of squamates reveal evolution-ary patterns in threat status. Biological Conservation, 204, 23–31. https://doi.org/10.1016/j.biocon.2016.03.039

Townsend, T. M., Mulcahy, D. G., Noonan, B. P., Sites, J. W., Kuczynski, C. A., Wiens, J. J., & Reeder, T. W. (2011). Phylogeny of iguanian lizards inferred from 29 nuclear loci, and a comparison of concat-enated and species- tree approaches for an ancient, rapid radiation. Molecular Phylogenetics and Evolution, 61, 363–380. https://doi.org/10.1016/j.ympev.2011.07.008

Uetz, P., Freed, P., & Hzrošek, J. (2017). The reptile database. Retrieved from http://www.reptile-database.org.

Wiens, J. J., Brandley, M. C., & Reeder, T. W. (2006). Why does a trait evolve multiple times within a clade? Repeated evolution of snake-like body form in squamate reptiles. Evolution, 60, 123–141.

Wilms, T. (2001). Dornschwanzagamen. Lebensweise, Pflege und Zucht. Offenbach, Germany: Herpeton-Verlag.

Wilms, T. (2005). Uromastyx – Natural History, Captive Care, Breeding. Offenbach, Germany: Herpeton.

Wilms, T., & Böhme, W. (2000a). A new Uromastyx species from south- eastern Arabia, with comments on the taxonomy of Uromastyx ae-gyptia (Forskål, 1775) (Squamata: Sauria: Agamidae). Herpetozoa, 13, 133–148.

Wilms, T., & Böhme, W. (2000b). Zur Taxonomie und Verbreitung der Arten der Uromastyx-ocellata–Gruppe (Sauria: Agamidae: Leiolepidinae). Zoology in the Middle East, 21, 55–76. https://doi.org/10.1080/09397140.2000.10637834

Wilms, T., & Böhme, W. (2001). Revision der Uromastyx- acanthinura- Artengruppe, mit Beschreibung einer neuen Art aus der Zentralsahara (Reptilia: Sauria: Agamidae). Zoologische Abhandlungen Staatliches Museum für Tierkunde, Dresden, 51, 73–104.

Wilms, T., & Böhme, W. (2007). Review of the taxonomy of the spiny- tailed lizards of Arabia (Reptilia: Agamidae: Leiolepidinae: Uromastyx). Fauna of Arabia, 23, 435–468.

Wilms, T. M., Böhme, W., Wagner, P., Lutzmann, N., & Schmitz, A. (2009). On the phylogeny and taxonomy of the genus Uromastyx Merrem, 1820 (Reptilia: Squamata: Agamidae: Uromastycinae): Resurrection of the genus Saara Gray, 1845. Bonner Zoologische Beiträge, 56, 55–99.

Wilms, T., & Schmitz, A. (2007). A new polytypic species of the genus Uromastyx MERREM 1820 (Reptilia: Squamata: Agamidae: Leiolepidinae) from southwestern Arabia. Zootaxa, 1394, 1–23. https://doi.org/10.11646/zootaxa.1394.1.1

Yang, Z. (2015). The BPP program for species tree estimation and spe-cies delimitation and species delimitation. Current Zoology, 61, 854–865. https://doi.org/10.1093/czoolo/61.5.854

Yang, Z., & Rannala, B. (2010). Bayesian species delimitation using multilocus sequence data. Proceedings of the National Academy of Sciences of the United States of America, 107, 9264–9269. https://doi.org/10.1073/pnas.0913022107

Yang, Z., & Rannala, B. (2014). Unguided species delimitation using DNA sequence data from multiple loci. Molecular Biology and Evolution, 31, 3125–3135. https://doi.org/10.1093/molbev/msu279

Zachos, J., Pagani, M., Sloan, L., Thomas, E., & Billups, K. (2001). Trends, rhythms, and aberrations in global climate 65 Ma to present. Science, 292, 686–693. https://doi.org/10.1126/science.1059412

SUPPORTING INFORMATION

Additional Supporting Information may be found online in the supporting information tab for this article.

How to cite this article: Tamar K, Metallinou M, Wilms T, et al. Evolutionary history of spiny- tailed lizards (Agamidae: Uromastyx) from the Saharo- Arabian region. Zool Scr. 2018;47:159–173. https://doi.org/10.1111/zsc.12266

SUPPLEMENTARY MATERIAL

Evolutionary history of spiny-tailed lizards (Agamidae: Uromastyx) from the Saharo-Arabian region

KARIN TAMAR, MARGARITA METALLINOU, THOMAS WILMS, ANDREAS SCHMITZ, PIERRE-ANDRÉ CROCHET, PHILIPPE GENIEZ, SALVADOR

CARRANZA

Table S1. Data on the specimens used in this study and related GenBank accession numbers. (*) Haplotypes used for the mPTP species

delimitation analysis (n=99); (#) Representatives of each mPTP cluster used for the divergence time estimations (n=18); ($) Representatives for

the biogeographical analyses (n=24).

Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3

M1 E107.15 Uromastyx acanthinura Tunisia \ FJ639595 MF960539 MF993161 MF960340 MF960229 MF960440 M2 * # $ ZFMK 83816 ZFMK83816 Uromastyx acanthinura Tunisia \ FJ639592 MF960614 MF993233 MF960400 MF960300 MF960503 M3 * ZFMK83817 ZFMK83817 Uromastyx acanthinura Tunisia \ FJ639593 - MF993234 MF960401 MF960301 -

M4 * ZFMK83818 ZFMK83818 Uromastyx acanthinura Tunisia \ FJ639594 MF960615 MF993235 MF960402 MF960302 MF960504

M5 * $ NSMT-H4667 NSMT-H4667 Uromastyx aegyptia aegyptia Egypt \ AB116943 AB116944 - - - -

M6 * ZFMK83792 ZFMK83792 Uromastyx aegyptia aegyptia Egypt Sinai Peninsula FJ639619 - - - - -

M7 * E106.27 Uromastyx aegyptia leptieni UAE Rimah-Al-Kaznah FJ639622 - - - - -

M8 * $ ZFMK52398 ZFMK52398 Uromastyx aegyptia leptieni UAE Wadi Siji FJ639623 MF960595 - - - -

M17 * S7349 Uromastyx aegyptia ssp. Oman Road to Madrakah, 5 km from crossroad MF980195 MF960569 MF993190 MF960368 MF960259 MF960470 M9 * BEV.10052 BEV.10052 Uromastyx aegyptia microlepis Kuwait 13 km NNE of Jahra MF980154 MF960517 MF993140 - - -

M10 * # $ BEV.10053 BEV.10053 Uromastyx aegyptia microlepis Kuwait 20 km NW of Abdali MF980155 MF960518 MF993141 MF960321 MF960210 MF960421 M11 BEV.T1497 Uromastyx aegyptia microlepis Kuwait 7 km N of Al Wafrah MF980160 MF960523 MF993146 MF960326 MF960215 MF960426 M12 * BEV.T1498 Uromastyx aegyptia microlepis Kuwait 13 km NNE of Jahra MF980161 MF960524 - - - -

M13 * BEV.T1499 Uromastyx aegyptia microlepis Kuwait Sabah Al-Ahmad Reserve MF980162 MF960525 MF993147 MF960327 MF960216 MF960427

M14 BEV.T1500 Uromastyx aegyptia microlepis Kuwait 4 km E of Abdali MF980163 MF960526 MF993148 MF960328 MF960217 MF960428

M15 BEV.T1508 Uromastyx aegyptia microlepis Kuwait 70 km E of Jahra MF980164 MF960527 MF993149 MF960329 MF960218 MF960429

M16 BEV.T1510 Uromastyx aegyptia microlepis Kuwait 70 km E of Jahra MF980165 MF960528 MF993150 MF960330 MF960219 MF960430

Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3

M18 * SPM001689 Uromastyx aegyptia microlepis UAE Jebel Gaddah MF980196 MF960570 MF993191 MF960369 MF960260 MF960471 M19 * SPM003103 Uromastyx aegyptia microlepis Kuwait Iraqi border, E Kuwait MF980199 MF960573 - - MF960263 -

M20 TW1167 TW1167 Uromastyx aegyptia microlepis Saudi Arabia Mahazat as-Sayd MF980211 MF960585 MF993204 MF960382 MF960274 MF960484 M21 * ZFMK86567 ZFMK86567 Uromastyx aegyptia microlepis Saudi Arabia Mahazat as Sayd FJ639621 MF960630 MF993249 MF960418 MF960318 MF960514 M22 * ZFMK86573 ZFMK86573 Uromastyx aegyptia microlepis Saudi Arabia Mahazat as Sayd FJ639620 MF960631 MF993250 MF960419 MF960319 MF960515 M23* # $ BEV.10184 BEV.10184 Uromastyx alfredschmidti Algeria Tassili n'Ajjer, 13 km S of Iherir MF980156 MF960519 MF993142 MF960322 MF960211 MF960422 M24 * BEV.T2976 Uromastyx alfredschmidti Algeria Tassili n'Ajjer, 7 km NE of Tin Taghirt MF980166 MF960529 MF993151 MF960331 MF960220 MF960431 M25 * BEV.T2996 Uromastyx alfredschmidti Libya Wâdi Illalen MF980167 MF960530 MF993152 MF960332 MF960221 MF960432 M26 * BEV.T3671 Uromastyx alfredschmidti Libya 110 km NNW of Ghat, Wadi I-n-Ana MF980171 MF960534 MF993156 MF960336 MF960225 MF960436 M27 * BEV.T5533 Uromastyx alfredschmidti Libya Libyan part of the Tassili-n-Azjer MF980175 MF960538 MF993160 MF960339 MF960228 MF960439 M28 * ZFMK73680 ZFMK73680 Uromastyx benti Oman Vicinity of Mirbat EF081057 MF960601 MF993218 - - -

M29 * ZFMK73681 ZFMK73681 Uromastyx benti Oman Vicinity of Mirbat EF081055 MF960602 MF993219 - MF960287 MF960495 M30 * # $ ZFMK83347 ZFMK83347 Uromastyx benti Oman Vicinity of Mirbat EF081056 MF960603 MF993220 MF960393 MF960288 MF960496 M31 * ZFMK83801 ZFMK83801 Uromastyx benti Oman Vicinity of Mirbat EF081054 - MF993226 MF960395 MF960293 -

M33 * NSMT-H4682 NSMT-H4682 Uromastyx dispar dispar Sudan \ AB116939 AB116940 - - - -

M34 * RIM059 Uromastyx dispar flavifasciata Mauritania 65Km S of Atar (Adrar) MF980176 MF960550 - - MF960240 MF960451

M35 RIM061 Uromastyx dispar flavifasciata Mauritania 65Km S of Atar (Adrar) MF980177 MF960551 MF993172 MF960350 MF960241 MF960452

M36 RIM062 Uromastyx dispar flavifasciata Mauritania 65Km S of Atar (Adrar) MF980178 MF960552 MF993173 MF960351 MF960242 MF960453

M37 * RIM068 Uromastyx dispar flavifasciata Mauritania Terjit (Adrar) MF980179 MF960553 MF993174 MF960352 MF960243 MF960454

M38 RIM069 Uromastyx dispar flavifasciata Mauritania Oued Seguelil (Adrar) MF980180 MF960554 MF993175 MF960353 MF960244 MF960455

M39 * RIM089 Uromastyx dispar flavifasciata Mauritania Between Guelb Er Richat and El Beyyed (Adrar) MF980181 MF960555 MF993176 MF960354 MF960245 MF960456

M40 * RIM090 Uromastyx dispar flavifasciata Mauritania Between El Beyed and Atar (Adrar) MF980182 MF960556 MF993177 MF960355 MF960246 MF960457

M41 * RIM101 Uromastyx dispar flavifasciata Mauritania Oued Choum (Adrar) MF980183 MF960557 MF993178 MF960356 MF960247 MF960458

M42 * RIM108 Uromastyx dispar flavifasciata Mauritania Zouerat (Tiris Zemmour) MF980184 MF960558 MF993179 MF960357 MF960248 MF960459

M43 RIM115 Uromastyx dispar flavifasciata Mauritania Oued Choum (Adrar) MF980185 MF960559 MF993180 MF960358 MF960249 MF960460

M44 * RIM136 Uromastyx dispar flavifasciata Mauritania Boudarga MF980186 MF960560 MF993181 MF960359 MF960250 MF960461

M45 * RIM153 Uromastyx dispar flavifasciata Mauritania Between Aghoueyyt and Inal MF980187 MF960561 MF993182 MF960360 MF960251 MF960462

M46 RIM154 Uromastyx dispar flavifasciata Mauritania Between Aghoueyyt and Inal MF980188 MF960562 MF993183 MF960361 MF960252 MF960463

M47 RIM155 Uromastyx dispar flavifasciata Mauritania Between Aghoueyyt and Inal MF980189 MF960563 MF993184 MF960362 MF960253 MF960464

M48 RIM157 Uromastyx dispar flavifasciata Mauritania 4 km SW of Choum MF980190 MF960564 MF993185 MF960363 MF960254 MF960465

M49 * RIM160 Uromastyx dispar flavifasciata Mauritania Dahr Chinguetti, between Atar and Tidjikja MF980191 MF960565 MF993186 MF960364 MF960255 MF960466

M50 RIM161 Uromastyx dispar flavifasciata Mauritania Dahr Chinguetti, between Atar and Tidjikja MF980192 MF960566 MF993187 MF960365 MF960256 MF960467

M51 * RIM223 Uromastyx dispar flavifasciata Mauritania Oualata MF980193 MF960567 MF993188 MF960366 MF960257 MF960468

M52 * $ S11164 Uromastyx dispar dispar Egypt SW Egypt MF980194 MF960568 MF993189 MF960367 MF960258 MF960469

M53 * TW1174 TW1174 Uromastyx dispar dispar Chad Zouar MF980215 MF960589 MF993208 MF960386 MF960278 MF960488

Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3

M54 * TW1175 TW1175 Uromastyx dispar dispar Chad Fada MF980216 MF960590 MF993209 MF960387 MF960279 MF960489 M55 TW1177 TW1177 Uromastyx dispar dispar Chad Zouar MF980218 MF960592 MF993211 MF960389 MF960281 MF960490 M56 ZFMK84437 ZFMK84437 Uromastyx dispar dispar Chad Zouar, Tibesti Mountains FJ639600 MF960623 MF993241 - - -

M57 * ZFMK84800 ZFMK84800 Uromastyx dispar dispar Chad Zouar, Tibesti Mountains FJ639600 - - MF960414 MF960314 -

M77 * BEV.10840 BEV.10840 Uromastyx dispar flavifasciata Western Sahara 9 km S of Awsard MF980157 MF960520 MF993143 MF960323 MF960212 MF960423 M78 * # $ BEV.9144 BEV.9144 Uromastyx dispar flavifasciata Mauritania Atar-Choum MF980158 MF960521 MF993144 MF960324 MF960213 MF960424 M79 * BEV.T1207 Uromastyx dispar flavifasciata Mauritania 97 km SE of Pozo Bu Lanuar MF980159 MF960522 MF993145 MF960325 MF960214 MF960425 M80 * BEV.T346 Uromastyx dispar flavifasciata Mauritania 56 km WSW of Ouadane (Adrar) MF980169 MF960532 MF993154 MF960334 MF960223 MF960434 M81 * BEV.T347 Uromastyx dispar flavifasciata Mauritania 12 km N of Atar (Adrar) MF980170 MF960533 MF993155 MF960335 MF960224 MF960435 M82 BEV.T3676 Uromastyx dispar flavifasciata Western Sahara 7.6 km S of Awsard MF980172 MF960535 MF993157 - - -

M58 E133.10 Uromastyx dispar flavifasciata Mauritania Atar-Choum FJ639615 MF960541 MF993163 MF960341 MF960231 MF960442

M59 E133.11 Uromastyx dispar flavifasciata Mauritania 26 km NW of Atar FJ639611 MF960542 MF993164 MF960342 MF960232 MF960443

M60 E133.2 Uromastyx dispar flavifasciata Mauritania 33 km SW of Choum FJ639607 MF960543 MF993165 MF960343 MF960233 MF960444

M61 * E133.3 Uromastyx dispar flavifasciata Mauritania Aghmakoum-El Beyed FJ639608 MF960544 MF993166 MF960344 MF960234 MF960445

M62 * E133.6 Uromastyx dispar flavifasciata Mauritania S of Choum FJ639612 MF960545 MF993167 MF960345 MF960235 MF960446

M63 * E133.7 Uromastyx dispar flavifasciata Mauritania S of Choum FJ639613 MF960546 MF993168 MF960346 MF960236 MF960447

M64 E133.8 Uromastyx dispar flavifasciata Mauritania 33 km SW of Choum FJ639614 MF960547 MF993169 MF960347 MF960237 MF960448

M65 E133.9 Uromastyx dispar flavifasciata Mauritania 26 km NW of Atar FJ639609 MF960548 MF993170 MF960348 MF960238 MF960449

M66 * SPM002896 Uromastyx dispar flavifasciata Algeria Tindouf MF980198 MF960572 MF993193 MF960371 MF960262 MF960471 M67 TW1158 TW1158 Uromastyx dispar flavifasciata Mauritania Adrar Mountains MF980203 MF960577 MF993196 MF960374 MF960266 MF960476 M68 ZFMK73500 ZFMK73500 Uromastyx dispar flavifasciata Mauritania Atar FJ639602 MF960598 - - - -

M69 ZFMK83824 ZFMK83824 Uromastyx dispar flavifasciata Mauritania Captive bred (Atar- Akjoujt) FJ639601 MF960618 MF993238 MF960407 MF960306 MF960507 M70 ZFMK84261 ZFMK84261 Uromastyx dispar flavifasciata Algeria Tindouf FJ639603 MF960621 MF993240 MF960409 - -

M71 * ZFMK84262 ZFMK84262 Uromastyx dispar flavifasciata Algeria Tindouf FJ639604 MF960622 - - - -

M72 * ZFMK85163 ZFMK85163 Uromastyx dispar flavifasciata Mauritania Captive bred (Atar- Akjoujt) FJ639605 MF960627 MF993246 MF960415 MF960315 MF960511 M73 * ZFMK86473 ZFMK86473 Uromastyx dispar flavifasciata Mauritania Vicinity of Atar (Adrar) FJ639606 MF960628 MF993247 MF960416 MF960316 MF960512 M74 * ZFMK86474 ZFMK86474 Uromastyx dispar flavifasciata Mauritania Northern Mauritania FJ639610 MF960629 MF993248 MF960417 MF960317 MF960513 M75 * $ TR2284 TR2284 Uromastyx dispar hodhensis Mauritania \ MF980201 MF960575 - - - -

M76 * $ ZFMK71647 ZFMK71647 Uromastyx dispar maliensis Mali \ FJ639616 MF960597 - MF960391 MF960285 MF960493 M83 * # $ BEV.T4132 Uromastyx geyri Algeria Oued Tahar MF980173 MF960536 MF993158 MF960337 MF960226 MF960437 M84 BEV.T4133 Uromastyx geyri Algeria Oued Tahar MF980174 MF960537 MF993159 MF960338 MF960227 MF960438 M85 * NSMT-H4677 NSMT-H4677 Uromastyx geyri Mali \ AB474754 AB474755 - - - -

M86 * ZFMK83821 ZFMK83821 Uromastyx geyri Niger Kafadek, near Agadez FJ639617 - MF993237 MF960405 MF960305 -

M87 * ZFMK83822 ZFMK83822 Uromastyx geyri Niger Kafadek, near Agadez FJ639618 MF960617 - MF960406 - MF960506

88 * NSMT-H4675 NSMT-H4675 Uromastyx macfadyeni Somalia \ AB116945 AB116946 - - - -

Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3

M89 * # $ ZFMK84440 ZFMK84440 Uromastyx macfadyeni Somalia North Somalia EF081043 MF960625 MF993243 MF960411 MF960311 MF960509 M90 * ZFMK84441 ZFMK84441 Uromastyx macfadyeni Somalia North Somalia EF081042 - MF993244 MF960412 MF960312 -

M91 * 14022012B Uromastyx nigriventris Morocco Timiright MF980153 MF960516 MF993139 MF960320 MF960209 MF960420 M92 * SPM004950 Uromastyx nigriventris Morocco 30 km E Tata MF980200 MF960574 MF993194 MF960372 MF960264 MF960474 M93 * TW1178 TW1178 Uromastyx nigriventris Morocco Izilf MF980219 MF960593 MF993212 MF960390 MF960282 MF960492 M94 * ZFMK83819 ZFMK83819 Uromastyx nigriventris Morocco Guelmin FJ639598 MF960616 MF993236 MF960403 MF960303 MF960505 M95 * ZFMK83820 ZFMK83820 Uromastyx nigriventris Morocco \ FJ639597 - - MF960404 MF960304 -

M96 * # $ ZFMK84438 ZFMK84438 Uromastyx nigriventris Morocco Guelmin FJ639599 MF960624 MF993242 MF960410 MF960310 MF960508 M97 * # $ BEV.T3076 Uromastyx ocellata Egypt Wadi el Rada, 16 km E of Hamata MF980168 MF960531 MF993153 MF960333 MF960222 MF960433 M98 * NSMT303 NSMT DNA 303 Uromastyx ocellata Egypt \ AB116947 AB116948 - - - -

M99 * TW1165 TW1165 Uromastyx ocellata \ Pet trade MF980210 MF960584 MF993203 MF960381 MF960273 MF960483 M100 * ZFMK83798 ZFMK83798 Uromastyx ocellata Sudan \ EF081044 - MF993224 MF960394 MF960291 -

M101 * ZFMK83799 ZFMK83799 Uromastyx ocellata Sudan \ EF081045 MF960608 MF993225 - MF960292 MF960497 M102 * TW1164 TW1164 Uromastyx ornata ornata \ Pet trade MF980209 MF960583 MF993202 MF960380 MF960272 MF960482 M103 * ZFMK83812 ZFMK83812 Uromastyx ornata ornata Egypt Sinai Peninsula EF081052 MF960612 MF993230 - MF960297 MF960501 M104 * $ ZFMK83813 ZFMK83813 Uromastyx ornata ornata Egypt Sinai Peninsula EF081053 MF960613 MF993231 MF960398 MF960298 MF960502 M105 * ZFMK83815 ZFMK83815 Uromastyx ornata ornata Egypt Sinai Peninsula EF081051 - MF993232 MF960399 MF960299 -

M106 * # $ TW1159 TW1159 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980204 MF960578 MF993197 MF960375 MF960267 MF960477

M107 * TW1160 TW1160 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980205 MF960579 MF993198 MF960376 MF960268 MF960478

M108 * TW1161 TW1161 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980206 MF960580 MF993199 MF960377 MF960269 MF960479

M109 * TW1162 TW1162 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980207 MF960581 MF993200 MF960378 MF960270 MF960480

M110 TW1163 TW1163 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980208 MF960582 MF993201 MF960379 MF960271 MF960481

M111 TW1168 TW1168 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980212 MF960586 MF993205 MF960383 MF960275 MF960485 M112 TW1169 TW1169 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980213 MF960587 MF993206 MF960384 MF960276 MF960486 M113 * TW1173 TW1173 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980214 MF960588 MF993207 MF960385 MF960277 MF960487 M114 * ZFMK84442 ZFMK84442 Uromastyx ornata philbyi Saudi Arabia Tihama EF081046 MF960626 MF993245 MF960413 MF960313 MF960510 M115 * # $ ZFMK58048 ZFMK58048 Uromastyx princeps Somalia Bossasso FJ639625 MF960596 MF993213 - MF960284 -

M116 * ZFMK58985 ZFMK58985 Uromastyx princeps Somalia Bossasso FJ639624 - MF993214 - - -

M117 * ZFMK48681 ZFMK48681 Uromastyx shobraki Yemen Between Mafraq and Mocca EF081067 MF960594 - - MF960283 -

M118 * # $ ZFMK73675 ZFMK73675 Uromastyx shobraki Yemen Mokka EF081068 MF960599 MF993215 MF960392 MF960286 MF960494 M119 * ZFMK73676 ZFMK73676 Uromastyx shobraki Yemen Mocca EF081066 MF960600 MF993216 - - -

M120 * ZFMK73677 ZFMK73677 Uromastyx shobraki Yemen Mocca EF081065 - MF993217 - - -

M121 * # $ TW1157 TW1157 Uromastyx thomasi Oman Masirah Island MF980202 MF960576 MF993195 MF960373 MF960265 MF960475 M122 * TW1176 TW1176 Uromastyx thomasi Oman Masirah Island MF980217 MF960591 MF993210 MF960388 MF960280 MF960490 M123 * ZFMK83830 ZFMK83830 Uromastyx thomasi Oman Vicinity of Ras Hilf, Masirah Island FJ639626 - MF993239 MF960408 MF960307 -

Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3

M124 * ZFMK83837 ZFMK83837 Uromastyx thomasi Oman Vicinity of Ras Hilf, Masirah Island FJ639627 MF960619 - - MF960308 -

M125 * ZFMK83838 ZFMK83838 Uromastyx thomasi Oman Vicinity of Ras Hilf, Masirah Island FJ639628 MF960620 - - MF960309 -

M32 * NSMT-H4670 NSMT-H4670 Uromastyx yemenensis Yemen \ AB114447 AB114447 AB114447 - - -

M126 * ZFMK47861 ZFMK47861 Uromastyx yemenensis Yemen Abian EF081058 - - - - -

M127 * ZFMK83805 ZFMK83805 Uromastyx yemenensis Yemen \ EF081059 MF960609 MF993227 - MF960294 MF960498

M128 * ZFMK83806 ZFMK83806 Uromastyx yemenensis Yemen \ EF081060 MF960610 MF993228 MF960396 MF960295 MF960499

M129 * # $ ZFMK83807 ZFMK83807 Uromastyx yemenensis Yemen \ EF081061 MF960611 MF993229 MF960397 MF960296 MF960500

M130 # $ NMP6V 73519 NMP6V 73519 Saara asmussi Iran \ FJ639585 MF960549 MF993171 MF960349 MF960239 MF960450 M131 # $ E112.2 Saara hardwickii \ \ FJ639591 MF960540 MF993162 - MF960230 MF960441 M132 # $ SPM002104 Saara hardwickii India/Pakistan \ MF980197 MF960571 MF993192 MF960370 MF960261 MF960472 M133 ZFMK83794 ZFMK83794 Saara hardwickii \ \ FJ639589 MF960604 MF993221 - MF960289 -

M134 ZFMK83795 ZFMK83795 Saara hardwickii \ \ FJ639588 MF960605 MF993222 - MF960290 -

M135 ZFMK83796 ZFMK83796 Saara hardwickii \ \ FJ639590 MF960606 MF993223 - - -

M136 ZFMK83797 ZFMK83797 Saara hardwickii \ \ FJ639587 MF960607 - - - -

M137 # $ ZFMK87396 ZFMK87396 Saara loricata Iran \ FJ639586 MF960632 MF993251 - - -

Acanthosaura lepidogaster KR092427 KR092427 KR092427 - - JF804531

Calotes versicolor AB183287 AB183287 AB183287 - - JX839246

Chamaeleo calyptratus NC_012420 NC_012420 NC_012420 - - GU456003

Ctenophorus adelaidensis - - - - - JF804566

Ctenophorus isolepis - - - - - JF804543

Hydrosaurus amboinensis AB475096 AB475096 AB475096 - - JF804549 Intellagama lesueurii AB031991 - - - - JF804562

Leiolepis belliana AB537554 AB537554 AB537554 - - JF804552

Phrynocephalus mystaceus KC578685 KC578685 KC578685 - - JF804558

Pogona vitticeps AB166795 AB166795 AB166795 - - JF804563

Trapelus boehmei JX668221 - JX857619 KU097647 - JX839250

1 Voucher code abbreviations: [BEV] Laboratoire de Biogéographie et Écologie des Vertébrés de l'École Pratique des Hautes Etudes, Centre

d’Écologie Fonctionnelle et Évolutive, Montpellier, France; [NMP6V] National Museum (Natural History), Prague, Czech Republic; [NSMT]

National Science Museum of Tokyo, Japan (from Amer & Kumazawa, 2009); [TR] Private collection of Jean-François Trape, Dakar, Senegal;

[TW] Private collection of Thomas Wilms, Münster, Germany; [ZFMK] Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany.

Table S2. Data on the gene fragments used in this study, including the primers used, with their orientation, sequences, references and PCR

conditions.

References

Arevalo, E., Davis, S.K. & Sites, J.W. (1994). Mitochondrial DNA sequence divergence and phylogenetic relationships among eight

chromosome races of the Sceloporus Grammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology, 43, 387–418.

Gamble, T., Bauer, A.M., Greenbaum, E. & Jackman, T.R. (2008). Evidence of Gondwanan vicariance in an ancient clade of geckos. Journal of

Biogeography, 35, 88–104.

Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X. & Wilson, A.C. (1989). Dynamics of mitochondrial DNA

evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the United

States of America, 86, 6196–6200.

Gene Primer Sequence (5’-3’) Reference PCR Conditions

16S 16Sa F: CGCCTGTTTATCAAAAACAT

Palumbi et al. (1991) 94°C (5’), [94°C (30’’), 48°C (45’’), 72°C (70’’)] x35, 72°C (5’) 16Sb R: CCGGTCTGAACTCAGATCACGT

cytb Cytb1 F: TCCAACATCTCAGCATGATGAAA

Kocher et al. (1989) 94°C (5’), [94°C (30’’), 50°C (45’’), 72°C (1’)] x34, 72°C (5’) Cytb2 R: CCCTCAGAATGATATTTGTCCTCA

ND4+tRNA ND4 F: CACCTATGACTACCAAAAGCTCATGTAGAAGC

Arévalo et al. (1994) 94°C (5’), [94°C (30’’), 52°C (45’’), 72°C (70’’)] x34, 72°C (5’) Leu R: CATTACTTTTACTTGGATTTGCACCA

MC1R MC1RF F: AGGCNGCCATYGTCAAGAACCGGAACC

Pinho et al. (2009) 94°C (5’), [94°C (30’’), 52°C (45’’), 72°C (80’’)] x40, 72°C (5’) MC1RR R: CTCCGRAAGGCRTAAATGATGGGGTCCAC

ACM4 Tg-F F: CAAGCCTGAGAGCAARAAGG

Gamble et al. (2008) 94°C (5’), [94°C (30’’), 54°C (45’’), 72°C (80’’)] x40, 72°C (5’) Tg-R R: ACYTGACTCCTGGCAATGCT

NTF3 NTF3_f1 F:ATGTCCATCTTGTTTTATGTGATATTT

Townsend et al. (2008) 94°C (5’), [94°C (30’’), 50°C (45’’), 72°C (80’’)] x40, 72°C (5’) NTF3_r1 R:ACRAGTTTRTTGTTYTCTGAAGTC

Palumbi, S.R., Martin, A., Romano, S., McMillan, W.S., Stice, S. & Grabowski, G. (1991). The Simple Fool’s Guide to PCR. University of

Hawaii Press, Honolulu.

Pinho, C., Rocha, S., Carvalho, B.M., Lopes, S., Mourao, S., Vallinoto, M., Brunes, T.O., Haddad, C.F.B., Goncalves, H., Sequeira, F. &

Ferrand, N. (2009(. New primers for the amplification and sequencing of nuclear loci in a taxonomically wide set of reptiles and amphibians.

Conservation Genetics Resources, 2(S1), 181–185.

Townsend, T.M., Alegre, E., Kelley, S.T., Wiens, J.J. & Reeder, T.W. )2008(. Rapid development of multiple nuclear loci for phylogenetic

analysis using genomic resources: an example from squamate reptiles. Molecular Phylogenetics and Evolution, 47, 129–142.

Table S3. Partitions and models selected by PartitionFinder for the different concatenated Bayesian analyses.

Partition

Models

Phylogenetic

analyses

Divergence time estimates

(including other agamids)

Divergence time estimates

(Uromastycinae only)

BSSVS

(Uromastycinae only)

16S, cytb_1st, ND4_1st, tRNAs GTR+G GTR+G GTR+G GTR+G

cytb_2nd, ND4_2nd HKY+I GTR+G HKY+I HKY+I

cytb_3rd, ND4_3rd GTR+G GTR+G GTR+G GTR+G

ACM4_1st+2nd, MC1R_1st, NTF3_1st+2nd HKY+I HKY+G HKY+G HKY+I

MC1R _2nd HKY HKY HKY HKY

MC1R _3rd GTR+I TrN GTR+I GTR+I

ACM4 _3rd, NTF3_3rd K80+G K80+G K80+G K80+G

Table S4. Pairwise uncorrected mitochondrial sequence divergence (p-distance). (A) Among and within Uromastyx taxa. Values derived from

the mitochondrial genes fragments of 16S (above the diagonal) and cytb/ND4 (below the diagonal); and within each taxon (in bold;

16S/cytb/ND4). (B) Within the taxa U. aegyptia and U. ornata (16S, above the diagonal; cytb/ND4, below the diagonal).

(A) 1 2 3 4 5 6 7 8 9 10 11 12 13 14

1. U. acanthinura 0.1/0/0 8.2 2.7 7.7 1.4 2.7 7.3 1.5 9.2 8.7 7.8 8.4 9.1 8.8

2. U. aegyptia 15.6/14.2 0.2/0.8/0.2 9.3 9.7 7.9 8.4 11.3 8.2 10.7 10.1 10.8 9.8 9.9 11.1

3. U. alfredschmidti 7.6/9.3 14.7/14.5 0.1/0.1/0.3 8.9 3.2 2 8 2.5 9.7 9.7 8.5 9.2 9.9 9.4

4. U. benti 15/15.3 14.6/13.6 12.4/16.8 0.2/0/0.1 7.9 8.4 9.5 8 8.2 7.3 11.2 2.5 10.5 3

5. U. dispar 6.3/6.4 14.8/12.8 8.4/8.5 14.1/15.2 0.2/0.6/0.2 2.7 7.6 1.1 9.3 8.4 7.6 8.2 9 8.8

6. U. geyri 8 /9.4 14.9/12.7 3.5/4.8 13.2/15 9.1/8 1.4/0.2/0 8.1 2.4 9.8 9.4 8 8.9 9.9 9.5

7. U. macfadyeni 12.2/15.6 16.1/14.6 12.2/16.2 14/18.1 15/15.9 11.2/15.8 0.2/0.4/0 7.4 11.2 11.3 8.6 9.5 9.6 9.9

8. U. nigriventris 4.6/7 16.2/13 8.2/10 14.8/15 6.4/6.9 8.5/8.9 13.7/16.3 0.2/0.5/0.3 9 8.5 7.6 8.5 8.8 8.8

9. U. ocellata 15.9/14.3 15.3/10.6 15.6/15.7 11.6/13 16.4/13.5 14.6/14.8 15.3/15.9 16.1/15 0.1/0.2/0.3 5.3 12.9 8.1 11.1 8.4

10. U. ornata 16.5/14.4 13.4/12.4 14.6/15.4 11/12.6 16.3/13.6 14.1/15 13.6/16 15.6/14.2 9.2/9.7 0.9/1.5/2 12 7.6 10.5 7.5

11. U. princeps 12.7/15.6 16.6/14.5 14.1/15.5 16/15.5 14.8/14.1 13.2/15.3 9.3/14.3 13.5/15.2 16/14.3 15.9/14.9 0.2/ NC/0.7 11.5 11 11.7

12. U. shobraki 14.9/13.9 16/12.6 12.9/15.5 7.7/6 15.2/13.4 13.6/14.1 15.6/17.6 16/13.6 11.4/11.6 12.6/11.7 17.9/14 0/0.4/0.1 11 2.1

13. U. thomasi 13.1/15.2 18.5/13.4 15.1/16.7 17.3/14.1 14.8/15.7 15.5/15.9 13.1/17.5 14.3/15.9 16.9/13.4 16.4/13.7 14.7/16.1 17.9/15.5 0.1/0/0.1 10.9

14. U. yemenensis 16.1/15.1 16.8/11.8 14.7/15.3 7.6/5.8 17.5/14.2 15/14.1 14.6/16.6 17.1/14.1 11.9/11.8 13.4/12.4 16.7/13.9 6.8/5.9 16.7/14.6 0.2/0.2/0.2

(B) U. aegyptia aegyptia U. aegyptia leptieni U. aegyptia microlepis U. ornata ornata U. ornata philbyi

U. aegyptia aegyptia --- 0.9 0.3 U. ornata ornata --- 1.6

U. aegyptia leptieni 2.3/- --- 0.5 U. ornata philbyi 3/3.8 ---

U. aegyptia microlepis 1.6/- 2.4/- ---

Table S5. Divergence time estimations for the Uromastycinae taxa based on the different calibrations (see Material and Methods; estimated node

ages and the 95% highest posterior densities; see Figs. S2–S3).

Node

Multilocus species-tree

(Uromastyx europaeus fossil)

Concatenated data

(Uromastyx europaeus fossil)

Concatenated data

(7 calibration points)

Concatenated data

(8 calibration points)

Median 95% HPD Median Median 95% HPD Median 95% HPD Median 95% HPD

Uromastycinae root 29.6 28–35.9 Middle Oligocene 29.4 28–35.2 30.3 26.5–34.3 30.1 28–33.2

Saara root 16.6 12.4–22 Middle Miocene 17.2 13.9–21.7 18.6 15.8–21.8 18.6 16–21.5

S. asmussi-S. loricata --- --- --- 5.4 3.7–7.3 6.1 4.6–7.7 6 4.7–7.6

S. hardwickii --- --- --- 2.4 1.6–3.4 2.8 2–3.7 2.8 2–3.7

Uromastyx root (U. thomasi) 16.3 12.8–20.9 Middle Miocene 16.3 13.2–20.2 18.1 15.9–20.5 18 16–20.1

U. aegyptia 14.3 11–18.2 Middle Miocene 13.9 11.1–17.4 15.7 13.5–17.9 15.6 13.7–17.8

U. ocellata group root 9.9 7.4–13 Late Miocene 10.4 8.2–13.2 11.9 10.1–13.8 11.9 10.3–13.7

U. ocellata-U. ornata 5.8 3.8–8 Late Miocene 6.2 4.5–8 7.2 5.9–8.7 7.2 5.9–8.6

U. shobraki-U. benti-U. yemenensis 3.8 2.5–5.3 Pliocene 3.8 2.7–5 4.1 3.3–5.1 4.1 3.3–5

U. princeps-U. macfadyeni --- --- --- 10.3 7.7–13.2 11.7 9.6–14.1 11.7 9.7–14

U. acanthinura group root 4.1 2.4–5.9 Pliocene 4.5 3.3–5.8 5.3 4.3–6.4 5.3 4.3–6.4

U. dispar 2.8 1.8–4 Pliocene 2.9 2.1–3.9 3.4 2.7–4.2 3.4 2.7–4.2

U. acanthinura-U. nigriventris 2.4 1.3–3.6 Pleistocene 2.5 1.7–3.4 2.9 2.2–3.7 2.9 2.2–3.6

U. geyri-U. alfredschmidti 0.23 0.05–0.5 Pleistocene 1.6 1–2.3 1.9 1.4–2.6 1.9 1.4–2.6

Table S6. BioGeoBEARS results of the competing models (DEC; DIVA; BayArea) of ancestral-area estimation for the concatenated data of

Uromastycinae. The best model is in bold. Results of each analysis are presented in Fig. S4.

Model LnL No. of parameters (n) Rate of dispersal (d) Rate of Extinction (e) Relative probability

of founder-event speciation (j) AIC AIC_wt AICc AICc_wt

DEC -21.46 2 0.0036 1.0e-12 0 46.92 0.016 47.49 0.022

DEC+J -17.42 3 1.0e-12 1.0e-12 0.0335 40.84 0.34 42.04 0.34

DIVALIKE -20.99 2 0.0060 1.0e-12 0 45.98 0.026 46.55 0.035

DIVALIKE+J -16.92 3 1.0e-12 1.0e-12 0.0388 39.83 0.57 41.03 0.56

BAYAREALIKE -32.09 2 0.0019 0.0477 0 68.18 4.0e-07 68.75 5.3e-07

BAYAREALIKE+J -19.34 3 1.0e-07 1.0e-07 0.0472 44.68 0.050 45.88 0.049

U. benti

M6 - U. aegyptia aegyptia - EgyptM5 - U. aegyptia aegyptia - Egypt

M17 - U. aegyptia leptieni - Oman

M19 - U. aegyptia microlepis - Kuwait

M18 - U. aegyptia microlepis - UAEM22 - U. aegyptia microlepis - Saudi Arabia

M7 - U. aegyptia leptieni - UAEM8 - U. aegyptia leptieni - UAE

M10 - U. aegyptia microlepis - Kuwait

M13 - U. aegyptia microlepis - KuwaitM9 - U. aegyptia microlepis - Kuwait

M21 - U. aegyptia microlepis - Saudi Arabia

M12 - U. aegyptia microlepis - Kuwait

U. aegyptia

M28 - U. benti - Oman

M126 - U. yemenensis - Yemen

M31 - U. benti - Oman

M30 - U. benti - OmanM29 - U. benti - Oman

M129 - U. yemenensis - Yemen

M128 - U. yemenensis - YemenM127 - U. yemenensis - Yemen

M32 - U. yemenensis - Yemen

M119 - U. shobraki - Yemen

M118 - U. shobraki - Yemen

M117 - U. shobraki - YemenM120 - U. shobraki - Yemen U. shobraki

U. yemenensis

M97 - U. ocellata - EgyptM98 - U. ocellata - Egypt

M101 - U. ocellata - Sudan

M100 - U. ocellata - SudanM99 - U. ocellata

U. ocellata

M102 - U. ornata ornata - Egypt

M103 - U. ornata ornata - Egypt

M104 - U. ornata ornata - EgyptM105 - U. ornata ornata

M106 - U. ornata philbyi - Saudi ArabiaM109 - U. ornata philbyi - Saudi Arabia

M108 - U. ornata philbyi - Saudi ArabiaM107 - U. ornata philbyi - Saudi Arabia

M114 - U. ornata philbyi - Saudi ArabiaM113 - U. ornata philbyi - Saudi Arabia U. ornata

M115 - U. princeps - SomaliaM116 - U. princeps - Somalia

M88 - U. macfadyeni - SomaliaM90 - U. macfadyeni - SomaliaM89 - U. macfadyeni - Somalia

U. macfadyeni

U. princeps

M83 - U. geyri - AlgeriaM24 - U. alfredschmidti - Algeria

M87 - U. geyri - Niger

M86 - U. geyri - NigerM85 - U. geyri - Mali

M23 - U. alfredschmidti - Algeria

M25 - U. alfredschmidti - Libya

M27 - U. alfredschmidti - Libya

M26 - U. alfredschmidti - Libya

U. geyri

U. alfredschmidti

M91 - U. nigriventris - Morocco

M4 - U. acanthinura - Tunisia

M3 - U. acanthinura - TunisiaM2 - U. acanthinura - Tunisia

M95 - U. nigriventris - Morocco

M94 - U. nigriventris - Morocco

M93 - U. nigriventris - Morocco

M96 - U. nigriventris - Morocco

U. acanthinura

U. nigriventris

M92 - U. nigriventris - Morocco

M79 - U. dispar �avifasciata - Mauritania

M34 - U. dispar �avifasciata - Mauritania

M75 - U. dispar hodhensis - Mauritania

M45 - U. dispar �avifasciata - Mauritania

M51 - U. dispar �avifasciata - Mauritania

M37 - U. dispar �avifasciata - Mauritania

M39 - U. dispar �avifasciata - MauritaniaM40 - U. dispar �avifasciata - Mauritania

M41 - U. dispar �avifasciata - Mauritania

M42 - U. dispar �avifasciata - Mauritania

M44 - U. dispar �avifasciata - Mauritania

M49 - U. dispar �avifasciata - Mauritania

M52 - U. dispar dispar - Egypt

M53 - U. dispar dispar - Chad

M54 - U. dispar dispar - ChadM57 - U. dispar dispar - Chad

M77 - U. dispar �avifasciata - Morocco

M81 - U. dispar �avifasciata - Mauritania

M80 - U. dispar �avifasciata - Mauritania

M78 - U. dispar �avifasciata - Mauritania

M61 - U. dispar �avifasciata - Mauritania

M63 - U. dispar �avifasciata - Mauritania

M62 - U. dispar �avifasciata - MauritaniaM66 - U. dispar �avifasciata - AlgeriaM71 - U. dispar �avifasciata - Algeria

M72 - U. dispar �avifasciata - MauritaniaM73 - U. dispar �avifasciata - Mauritania

M74 - U. dispar �avifasciata - Mauritania

M33 - U. dispar dispar - Sudan

M76 - U. dispar maliensis - Mali

U. dispar

M121 - U. thomasi - OmanM125 - U. thomasi - Oman

M124 - U. thomasi - Oman

M123 - U. thomasi - OmanM122 - U. thomasi - Oman

U. thomasi

*

*

*

*

*

*

*

*

*

*

*

*

*

*

Figure S1. mPTP results (left) and *BEAST species-tree (right) of Uromastyx. The mPTP results were inferred from the concatenated mitochondrial haplotype dataset. Asterisks represent specimens used for the divergence time estimation analyses. Sample codes and colours correlate to specimens in Table S1 and Figs. 1–2. The species-tree is based on the mPTP putative species (Uromastyx princeps was excluded due to incomplete dataset). Posterior probability values are indicated near the nodes.

U. thomasi

U. macfadyeniU. ornataU. ocellataU. yemenensisU. shobrakiU. bentiU. aegyptia

U. alfredschmidtiU. geyri

U. acanthinuraU. nigriventrisU. dispar0.02

1

1

1

1

1

1

0.93

0.39

0.82

0.83

0.95

0.66

U. princepsgroup

U. ocellatagroup

U. aegyptia

U. thomasi

U. acanthinuragroup

Mya020 1030405070 6080100 90

Mio

cene

Olig

ocen

e

Plio

cene

Pleisto

cene

Eocen

e

Paleocen

e

Up

per

Cretaceo

us

M121 - U. thomasiM10 - U. aegyptia

M30 - U. bentiM118 - U. shobraki

M129 - U. yemenensisM97 - U. ocellataM106 - U. ornata M115 - U. princepsM89 - U. macfadyeniM83 - U. geyri M23 - U. alfredschmidti M2 - U. acanthinuraM96 - U. nigriventrisM78 - U. dispar

M130 - Saara asmussiM137 - Saara loricata

M132 - Saara hardwickiiM131 - Saara hardwickii

Intellagama lesueurii

Calotes versicolorAcanthosaura lepidogaster

Trapelus boehmeiPhrynocephalus mystaceus

Leiolepis belliana

Ctenophorus isolepisCtenophorus adelaidensisPogona vitticeps

Chamaeleo calyptratus

Hydrosaurus amboinensis

11.111.1

17.5

17.6

19.519.5 7

6

5

4

3

2

1

9.0

39.539.6

29.629.662.4

62.465.265.3

6767.1

75

75.1

80.180.2

85.1

85.2

2.82.8

3.42.9

3.4

2.418.617.2

18.6

6.15.4

6

30.329.4

30.1

18.116.3

18

17.415.6

17.3

15.713.9

15.6

11.910.4

11.9

7.26.2

7.2

15.713.9

15.711.7

10.3

11.7

1.91.6

1.9

5.34.5

5.3

4.1

3

4.1

3.3

3.83.3

2.92.5

2.9

Figure S2. Time-calibrated Bayesian inference concatenated tree of Agamidae. Mean age estimates are provided near the nodes with horizontal bars representing the 95% highest posterior densities based on the analysis of eight calibration points (black dates; calibration points are denoted by arrows and numbers; see Material and Methods; Table S5). Additional dates are based on the analysis of seven calibration points (blue) and on the Uromastyx europaeus fossil only (red) (see Table S5). White circles represent nodes with posterior probability values ≥0.95. Sample codes correlate to specimens in Table S1.

Mio

cene

Olig

ocen

e

Plio

cene

Pleisto

cene

Figure S3. Time-calibrated multilocus species-tree of Uromastyx based on the Uromastyx europaeus fossil calibration (see Material and Methods). Mean age estimates are provided above the nodes with horizontal bars representing the 95% highest posterior densities (see Table S5). White circles represent nodes with posterior probability values ≥0.95.

U. thomasi

U. benti

U. shobraki

U. yemenensis

U. ocellata

U. ornata

U. macfadyeni

U. geyri

U. acanthinura

U. nigriventris

U. dispar

Saara asmussi

Saara hardwickii

10 0530 25 1520 Mya

U. alfredschmidti

U. aegyptia

35

16.6

40

Eocen

e

29.6

16.3

15.3

14.3

9.9

3.8

5.8

3

0.23

2.8

2.4

4.1

12.4

3.0

BioGeoBEARS DIVALIKE on Uromastyx concatenated tree: global optim, 4 areas max. d=0.006; e=0; j=0; LnL=−20.99

ZFMK87396

NMP6V73519

SPM002104

E112.2

TW1157

NSMTH4667

BEV.10053

ZFMK52398

BEV.T3076

TW1159

ZFMK83813

ZFMK83347

ZFMK73675

ZFMK83807

ZFMK58048

ZFMK84440

BEV.T4132

BEV.10184

ZFMK83816

ZFMK84438

TR2284

BEV.9144

ZFMK71647

S11164

30 25 20 15 10 5 0

Millions of years ago

As

As

As

As

Ar

Af

Ar

Ar

Af

Ar

Ar

Ar

Ar

Ar

H

H

Af

Af

Af

Af

Af

Af

Af

Af

BioGeoBEARS DIVALIKE+J on Uromastyx concatenated tree: global optim, 4 areas max. d=0; e=0; j=0.0388; LnL=−16.92

ZFMK87396

NMP6V73519

SPM002104

E112.2

TW1157

NSMTH4667

BEV.10053

ZFMK52398

BEV.T3076

TW1159

ZFMK83813

ZFMK83347

ZFMK73675

ZFMK83807

ZFMK58048

ZFMK84440

BEV.T4132

BEV.10184

ZFMK83816

ZFMK84438

TR2284

BEV.9144

ZFMK71647

S11164

30 25 20 15 10 5 0

Millions of years ago

As

As

As

As

Ar

Af

Ar

Ar

Af

Ar

Ar

Ar

Ar

Ar

H

H

Af

Af

Af

Af

Af

Af

Af

Af

BioGeoBEARS DEC on Uromastyx concatenated tree: global optim, 4 areas max. d=0.0036; e=0; j=0; LnL=−21.46

ZFMK87396

NMP6V73519

SPM002104

E112.2

TW1157

NSMTH4667

BEV.10053

ZFMK52398

BEV.T3076

TW1159

ZFMK83813

ZFMK83347

ZFMK73675

ZFMK83807

ZFMK58048

ZFMK84440

BEV.T4132

BEV.10184

ZFMK83816

ZFMK84438

TR2284

BEV.9144

ZFMK71647

S11164

30 25 20 15 10 5 0

Millions of years ago

As

As

As

As

Ar

Af

Ar

Ar

Af

Ar

Ar

Ar

Ar

Ar

H

H

Af

Af

Af

Af

Af

Af

Af

Af

BioGeoBEARS DEC+J on Uromastyx concatenated tree: global optim, 4 areas max. d=0; e=0; j=0.0335; LnL=−17.42

ZFMK87396

NMP6V73519

SPM002104

E112.2

TW1157

NSMTH4667

BEV.10053

ZFMK52398

BEV.T3076

TW1159

ZFMK83813

ZFMK83347

ZFMK73675

ZFMK83807

ZFMK58048

ZFMK84440

BEV.T4132

BEV.10184

ZFMK83816

ZFMK84438

TR2284

BEV.9144

ZFMK71647

S11164

30 25 20 15 10 5 0

Millions of years ago

As

As

As

As

Ar

Af

Ar

Ar

Af

Ar

Ar

Ar

Ar

Ar

H

H

Af

Af

Af

Af

Af

Af

Af

Af

BioGeoBEARS BAYAREALIKE on Uromastyx concatenated tree: global optim, 4 areas max. d=0.0019; e=0.0477; j=0; LnL=−32.09

ZFMK87396

NMP6V73519

SPM002104

E112.2

TW1157

NSMTH4667

BEV.10053

ZFMK52398

BEV.T3076

TW1159

ZFMK83813

ZFMK83347

ZFMK73675

ZFMK83807

ZFMK58048

ZFMK84440

BEV.T4132

BEV.10184

ZFMK83816

ZFMK84438

TR2284

BEV.9144

ZFMK71647

S11164

30 25 20 15 10 5 0

Millions of years ago

As

As

As

As

Ar

Af

Ar

Ar

Af

Ar

Ar

Ar

Ar

Ar

H

H

Af

Af

Af

Af

Af

Af

Af

Af

BioGeoBEARS BAYAREALIKE+J on Uromastyx concatenated tree: global optim, 4 areas max. d=0; e=0; j=0.0472; LnL=−19.34

ZFMK87396

NMP6V73519

SPM002104

E112.2

TW1157

NSMTH4667

BEV.10053

ZFMK52398

BEV.T3076

TW1159

ZFMK83813

ZFMK83347

ZFMK73675

ZFMK83807

ZFMK58048

ZFMK84440

BEV.T4132

BEV.10184

ZFMK83816

ZFMK84438

TR2284

BEV.9144

ZFMK71647

S11164

30 25 20 15 10 5 0

Millions of years ago

As

As

As

As

Ar

Af

Ar

Ar

Af

Ar

Ar

Ar

Ar

Ar

H

H

Af

Af

Af

Af

Af

Af

Af

Af

Figure S4. BioGeoBEARS results of the competing models (DEC; DIVA; BayArea) of ancestral-area estimation for the concatenated data of Uromastycinae. A pie chart describing the probability of each inferred area is presented at the major nodes: Africa (yellow), Horn of Africa (red), Arabia (green), Asia (blue). Sample codes correlate to specimens in Table S1.