Am. J. Hum. Genet. 46:1141-1148, 1990

Exclusion of Linkage, between the Human Apolipoprotein BGene and AbetalipoproteinemiaLi-Shin Huang, * Pasi A. Janne, * Jacqueline de Graaf, * Michael Cooper,§Richard J. Decklebaum,t Herbert Kayden4 and Jan L. Breslow*

Laboratory of Biochemical Genetics and Metabolism, Rockefeller University, TDepartment of Pediatrics, Columbia College of Physicians andSurgeons, and $New York University School of Medicine, New York; and §Department of Pediatrics, Kaplan Hospital, Rehovot, Israel

Summary

Abetalipoproteinemia (ABLP) is a rare autosomal recessive disease characterized by a lack of plasmaapolipoprotein B (apo B). In this report, the hypothesis that ABLP is due to rare mutations in the apo Bgene was tested. A total of eight ABLP families were studied. Apo B gene RFLPs were used to establish thehaplotypes of the apo B alleles in family members. LOD score analysis was used to study the linkage be-tween the apo B alleles and ABLP. These families were categorized arbitrarily as class I, II, III, or IV be-cause of differences in the results derived from both haplotyping and LOD score analysis. In a class I fam-ily, affected siblings, who on the basis of the hypothesis would be expected to have the same apo B alleles,had different ones. LOD score analysis of this family gave an infinite negative number at a recombinationfraction (0) of zero. In two class II families, probands who were the result of consanguineous marriagesand who, on the basis of the hypothesis, should be homozygotes for a defective apo B allele, were hetero-zygotes at this locus. The sum of the LOD scores from these two families was -1.7 at 0 = 0. In one classIII family, a parent was apparently homozygous for a particular apo B allele and yet not affected. Thisalso contributed negatively to the LOD score. In four class IV families, disease inheritance was compatiblewith segregation of the apo B alleles. This, however, was not statistically significant (LOD score = 0.97 at0 = 0). Although heterogeneity in the genetic basis for ABLP cannot be excluded, the data indicate thatin most cases the genetic abnormality in the disease is not in the apo B gene.

Introduction

Two diseases, abetalipoproteinemia (ABLP) and homo-zygous hypobetalipoproteinemia (HBLP), have been de-scribed in which plasma apolipoprotein B (apo B) iseither absent or markedly reduced (Herbert et al. 1983).These patients have very little or no apo B containinglipoproteins such as chylomicrons, very-low-density li-poprotein (VLDL), and low-density lipoprotein (LDL).Both disorders are characterized by retinitis pigmen-tosa, fat malabsorption, ataxic neuropathy, and acan-

Received February 23, 1989; final revision received February 2,1990.

Address for correspondence and reprints: Li-Shin Huang, Ph.D.,Laboratory of Biochemical Genetics and Metabolism, RockefellerUniversity, 1230 York Avenue, New York, NY 10021.i 1990 by The American Society of Human Genetics. All rights reserved.0002-9297/90/4606-0014$02.00

thocytosis (Kayden 1972; Herbert et al. 1983). The dis-tinction between these two diseases is that obligateheterozygotes for ABLP have normal levels of plasmaLDL whereas obligate heterozygotes for HBLP have30%-50% of normal levels (Herbert et al. 1983). Thisdifference suggests these two diseases are caused bydifferent genetic mechanisms. A recent study showedcosegregation of an apo B allele with heterozygousHBLP in a large kindred (Leppert et al. 1988). In someother HBLP patients, structural defects in the apo Bgene have actually been demonstrated (Collins et al.1988; Young et al. 1988; Huang et al. 1989). In con-trast, the cause of ABLP is not known. A recent studyby Talmud et al. (1988) showed the absence of linkageof apo B alleles with ABLP in two families, suggestingother genes are responsible for the diseases, at least inthese families. In the present report, we have also ex-amined, by linkage analysis in eight families with at

1141

Huang et al.

least one affected individual, the question of whetherapo B gene abnormalities could underlie ABLP. Ouranalysis was based on the assumption that, if the apo

B gene is the cause for such a rare disease as ABLP,then the two defective alleles present in affected indi-viduals must be the same in a given family. These twoalleles should not be present simultaneously in otherunaffected family members. These assumptions also dic-tate that, in families with consanguinity, affected pa-

tients should be homozygotes- and unaffected parentsshould be heterozygotes -at the apo B gene locus. Inthe present study, LOD score analysis excluded linkagebetween the apo B gene and ABLP in three differentfamilies, proving that this disease and HBLP have differ-ent genetic bases.

Methods

Clinical Information

The diagnosis of ABLP was established by evalua-tion of serum lipid and lipoprotein levels in each pa-

tient and in his or her family. Total cholesterol andtriglyceride measurements were performed by auto-

analyzers using the method specified by the laboratorymanual of the Lipid Research Clinics Program (1974).Plasma apo B levels were determined by radioimmuno-assay using polyclonal antibodies. The immunoassaywas performed in a manner similar to that describedby Young et al. (1986). All propositi had clinical andlaboratory findings typical of ABLP (Kayden 1972). Ineach family, only the propositi were affected by classi-cal symptoms and laboratory findings, while no asymp-

tomatic siblings or parents had abnormally low plasmalipids, thus eliminating the possibility that the probandsmight have had homozygous HBLP. All families are Cau-casian. Families S-2 and K are of Askenazi Jewish ori-gin; families E and Y are of Sephardic Jewish origin.The clinical findings, lipoprotein profiles, and pedigreeof family R were documented by Schwartz et al. (1963),and those of both families A and S-1 were documentedby Scanu et al. (1974). In these families, no plasma apo

B was detected in the patients (i.e., R, A, and S-1) mea-sured by the radioimmunoassay. The available valuesfor total cholesterol and triglyceride in the other fami-lies are summarized in table 1.

Family histories recorded by physicians documentedabsence of consanguineous marriages in parents ofpropositi except in families R and A. The documenta-tion of consanguinity in family A was obtained from

Table I

Total Cholesterol Levels and Triglyceride Levels inABLP Family Members

Family and Total Cholesterol TriglycerideIndividual (mg/ml) (mg/ml)

L:1.1 ........ 189 284I.2 ........ 188 226II.3 ...... 34 6

S-2:I.1. ....... 133 94I.2 ........ 231 90II.2 ...... 32 11

E :1.1 ........ 202 1651.2 ........ 168 941I.la ..... . 33 25II.2 ...... 127 127

K:1.1 ........ 249 1441.2 ........ 237 237Il.ja ........27lila ~~~~~~~28 7II.2a ...... 29 5

Y:1.1 ........ 242 1061.2 ........ 282 82II.2 ...... 35 3

a Diagnosed as having ABLP.b 6 wk old at blood drawing.

the parents (V.1 and V.2) and confirmed by interviewwith the maternal grandmother (IV.4).

All propositi had some or all clinical symptoms de-scribed for ABLP (Kayden 1972) and had total choles-terol levels well below the fifth percentile. Family L hasbeen studied carefully, since the mother (I.2) is a labo-ratory technician. The propositi in families S-2, E, andK all presented with chronic diarrhea in infancy, thediagnosis of ABLP was reached after intestinal biopsyand findings of acanthocytosis and low plasma choles-terol and triglyceride levels. Intestinal biopsy of thesepropositi showed enterocytes with large fat-filled vacu-oles. No plasma apo B was detectable in the propositus(II.1) in family E. The propositus in family Y reportedboth recurrent diarrhea from early childhood and theonset of neurological and eye symptoms in her seconddecade. Definitive diagnosis was made in her third de-cade by intestinal biopsy, the finding of acanthocyto-sis, and the measurement of lipoprotein levels. Her in-testinal biopsy also showed enterocytes with largefat-filled vacuoles.

1142

Apo B Gene and Abetalipoproteinemia

DNA Polymorphisms

For haplotyping analysis, two kinds of RFLP mark-ers were used. RFLPs that are the result of a single basesubstitution in a restriction-enzyme cutting site weredetected with Avall, HincII, PvuII, XbaI, Mspl, andEcoRI (Hegele et al. 1986; Huang et al. 1986, 1988,1990). The fragment sizes of the alleles are as follows:AvaIl 1, 1.0 kb; AvaIl 2, 0.7 kb; HincIl 1, 7.4 kb;HincIl 2, 7.1 kb; PvuII 1, 8.0 kb; PvuII 2, 5.5 kb; XbaI1, 8.6 kb; XbaI 2, 5.0 kb; MspI 1, 9 kb; and MspI2, 2.6 kb (where 1 and 2 represent, respectively, theabsence and presence of the polymorphic restrictionenzyme site). The second type of RFLP, ID/VNTRRFLP, is due to variable numbers of tandem repeats(VNTRs) 3' to the gene and is detected by using XbaI(Huang and Breslow 1987) when Southern blottinganalysis is performed. The alleles are 1, 1.4 kb; 2, 1.35kb; 35 1.2 kb; 4, 1.15 kb; and 5, 1.10 kb. All seven ofthese RFLPs were used in each member of the ABLPfamilies to determine apo B haplotypes.Two single-base substitution RFLP markers, Alul and

BalI, (Wang et al. 1988; Huang et al. 1990) were alsoused in the haplotyping analysis, if one of the parentsin the nuclear family was an apparent homozygote af-ter the haplotyping with the seven RFLPs describedabove. The alleles defined by these two enzymes areAlul 1, 250 bp; Alul 2, 201 bp; BalI 1, 7 kb; and BalI2, 6 kb. Because of the size of the Alul fragments,genotyping of this RFLP was done with allele-specificoligonucleotide (ASO) hybridization as described be-low. The apo B gene 3' VNTRs of the apparentlyhomozygous individuals were compared by sequenc-ing as described below.

Isolation of Genomic DNA

White blood cells were collected from members ofABLP families. Cells were lysed in a solution contain-ing proteinase K (140 jg/ml), 3% Sarkosyl, 10 mMTris-Cl (pH 8.0), 100mM NaCl, and 1 mM EDTA andwere rocked gently at 40C overnight. The samples werethen treated with phenol and subsequently were ex-tracted with chloroform and isoamylalcohol (v/v =24:1). DNAs were precipitated with absolute ethanoland then were resuspended in 1 x TE (10 mM Tris-HCR, pH 8.0, and 1 mM EDTA).

Probe Preparation

Apo B gene subclones were derived according tomethods described elsewhere (Hegele et al. 1986; Hu-ang et al. 1986, 1988, 1990). The inserts in these cloned

apo B DNA sequences were released from vector DNAby restriction-enzyme digestion and then were isolatedby electrophoresis in low-melting agarose gels. The in-serts were labeled with 32P-dCTP by nick-translation(Maniatis et al. 1982) and used as probes in Southernblotting analysis.

Detection of RFLPs by Southern Blotting Analysis

Genomic DNAs were digested with restriction en-zymes, subjected to agarose gel electrophoresis, trans-ferred to nylon membranes (Gelman, Biotrace), andhybridized with apo B probes at 65°C in a buffer con-taining 3 x SSC (1 x SSC = 15 mM sodium citrate,150 m NaCl), 0.2% Ficoll, 0.2% polyvinylpyrrolidone,0.2% BSA, albumin, and salmon sperm DNA (100ig/ml). Probes containing repetitive sequences were pre-hybridized to sonicated human placental DNA (5 mg/ml; Sigma) prior to hybridization with membranes(Sealey et al. 1985). These probes were then added tothe hybridization buffer. After overnight hybridization,excess probe was washed off with 0.1 x SSC contain-ing 0.1% SDS, and the nylon membranes were then ex-posed to X-ray film.

Detection of Alul RFLP by ASO Hybridization

Oligonucleotides were synthesized by phosphorami-dite chemistry on a DNA synthesizer (model 381A; Ap-plied Biosystems). Two ASOs distinguishing the AlulRFLP were used as probes for hybridization. Probe 207(TGAAAGAAGTTCTGAAAGA) contains sequences ofallele 1, which is missing the AluI site (AGCT), andprobe 217 (TCTTTCAGAGCTTCTTTCA) contains se-quences complementary to that of allele 2, which hasthe Alul site. DNA sequences spanning the AluI sitewere amplified by the polymerase chain reaction (PCR)(Saiki et al. 1988) using two synthetic primers: primer205 (AGATCTAGACCCAAAGACTTA) and primer206 (TCTAAGCTTCCTCTGGGTAGCT). The PCR-amplified DNAs were denatured with 0.5M NaOH/1.5M NaCl, neutralized with 1 M Tris-HCI, pH 7.5, 1.5M NaCl, and were dot blotted onto nylon membranes.The membranes were hybridized with either the Alul -probe (207) or the AluI+ probe (217) at 460C over-night. The membranes were washed twice with 6 xSSC, 0.05% sodium pyrophosphate at room tempera-ture for a total of 1 h and were washed once at 370Cfor 30 min. They were then washed at 520C (when probe207 was used) or 54°C (when probe 217 was used) for5 min. The membranes were exposed to X-ray film forseveral hours.

1143

Huang et al.

Detection of Polymorphisms by DNA Sequencing

The 3' VNTRs of the apo B genes in apparent homo-zygotes were amplified by PCR as described by Boer-winkle et al. (1989). The methods used for cloningand sequencing of amplified DNA were as describedelsewhere (Huang et al. 1989).

Statistical Analysis

Linkage analysis between the apo B gene and ABLPwas carried out with the LIPED computer program ac-

cording to a method described by Ott (1974). The anal-ysis was performed by designating ABLP as a recessivedisease. Haplotype frequencies were estimated on thebasis of the approximate allele frequencies of eachmarker (Huang et al. 1990).

Results

Haplotyping of Apo B Alleles in ABLP Families

Seven apo B gene RFLP markers-AvaIl, HincII,PvuII, XbaI, MspI, EcoRI, and ID/VNTR- shown infigure 1 were used for haplotyping analysis of the apo

B alleles in the ABLP patients and in their families. Atotal of 12 different haplotypes were observed in theeight families studied and are summarized in table 2.Haplotypes of the apo B alleles in each individual testedare shown in the pedigrees (fig. 2). In families A, R,and S-2, one parent-V.2, V.1, and I.2, respectively-appeared to be homozygous by haplotyping analysiswith the seven RFLPs. Therefore, additional apo Bmarkers were used in these families. In family A, thehaplotypes of individual V.2 changed from E3E3 toE3E3' after analysis of the AluM RFLP (fig. 2 and 3).In families R and S-2, individuals V.1 and 1.2, respec-

tively, remained homozygous at the apo B locus afterhaplotyping analysis with both AluM (fig. 3) and BalI

4o

ApoB RFLP

Table 2

Haplotypes of Apo B Genes in ABLP Patients andin Their Families

RESTRICTION ENZYME

HAPLOTYPE AvaIl HincII PvuII XbaI MspI EcoRI ID/VNTR

Al ....... 1 2 2 1 2 2 1A3 ....... 1 2 2 1 2 2 3A4 ....... 1 2 2 1 2 2 4A5 ....... 1 2 2 1 2 2 5B, ....... 2 1 1 1 2 1 1C1 ....... 2 1 1 1 2 2 1C3 ....... 2 1 1 1 2 2 3C4 ....... 2 1 1 1 2 2 4C5 ....... 2 1 1 1 2 2 5D3 ........ 2 1 1 2 1 2 3E3 ........ 2 1 1 2 2 2 3F5 ....... 2 2 2 1 2 2 5

NOTE. -Allele number is designated according to the size of res-triction fragment in Southern blotting analysis. With the exceptionof the ID RFLP, allele 1 does not have the restriction-enzyme siteand gives a larger fragment, whereas allele 2 has the site and there-fore gives two fragments of smaller sizes. In the case of the ID RFLP,the number of the allele is inversely related to the fragment size.

(data now shown) RFLPs. The VNTRs 3' to the apoB gene in these apparent homozygotes were cloned andsequenced for possible allelic differences due to micro-heterogeneity of sequences in this region (Huang andBreslow 1987). The apo B alleles were still not distin-guishable in these individuals (data not shown).The parental phases of the apo B alleles in the ABLP

patients were established by the haplotyping analysis.The linkage of the disease and these apo B alleles ineach family was tested byLOD score analysis. TheLODscores for each family at various recombination frac-tions are shown in table 3. These families were catego-

(K)s .

Probe 68 61 62

-10 0 10

58

20 30

m27 2423

40 50 60kbI

5 _.M.31

Figure I Restriction map of apo B gene RFLPs. The polymorphic restriction-enzyme sites of nine RFLPs are shown. The ID RFLPis the length polymorphism containing the 3' VNTR (Huang and Breslow 1987). The apo B gene is shown as a black bar. Probes usedto detect RFLPs are shown in hatched bars below the gene. The scale is indicated (in kilobases below the map).

1144

Apo B Gene and Abetalipoproteinemia

Cls Ill

1 2A

A4C1 A4C I

Cls IV

Faidy E

1 2

0D3 3 3D3E11~ 111

F,,dy* l

D3 3 D3E3Fat* K

1 2

Al 3 1Cr3

F11

F.I* Y

1 2

AIC4 AIE3

1 2

C3 OE343

C3E3 E3E3

o 0N0eWAW* .U_

Figure 2 Pedigrees ofABLP families. Class I comprises familyL; class II comprises families R and A; class Ill comprises familyS-2; and class IV comprises families E, K, S-i, and Y. Square symbolsdenote males, and circle symbols denote females. An open symbolrepresents a normal or heterozygous individual, and a solid symbolrepresents an ABLP patient. A Roman numeral indicates the genera-tion in each pedigree, and an Arabic number indicates the individualin the family. Letters with numeric subscripts are haplotypes for theapo B gene which are indicated below squares or circles. The desig-nation of haplotypes is shown in table 2. There are E3 and E3' haplo-types for individual V.2 in family A because this person's apo B al-leles differ in the Alul RFLP, which is not shown in table 2.

rized arbitrarily as class I, II, III, or IV because of differ-ences in the results derived from both haplotyping andLOD score analysis.

Class I Family: Incompatible with LinkageIf there is linkage of the apo B gene and ABLP, then

all affected children in a family should have the samegenotype. The pedigree in family L (fig. 2) shows thattwo of the affected children (II.1 and II.2) have the sameapo B genotype (AsE3), whereas the third affectedchild (11.3) has a different one (AsC4). This strongly

1 2 3 4 5 6 7 8I 191 1111ilil_Wi-$] A.] _ E | ___.,.,$,,8,..;.-,...,',,!,,.ffi!,w* * 1iZ 11 i..r''.... 2 : l1 l_ _S!_h; k SEf8 t-i-g- g N!_EM MA Alu I-

Alu IfB

Figure 3 Detection of Alul RFLP by ASO hybridization.Genomic DNAs from a normal control and from some members ofABLP families were used for PCR to detect the AluI RFLP by usingASO hybridization as described in Methods. A, ASO probe 207 de-tecting the Alul - allele was used. B, ASO probe 217 detecting theAluI allele was used. Lane 1, Plasmid DNA of pB113 containingthe sequence of the Alu- allele. Lane 2, Plasmid DNA of pB114containing the sequence of the Alul+ allele. Lane 3, Normal in-dividual heterozygous for the Alul RFLP. Lane 4, Individual 1.2 offamily S-2. Lane 5, Individual V.1 of family R. Lane 6, IndividualV.2 of family A. Lane 7, Individual V.1 of family A. Lane 8, IndividualVI.2 of family A.

suggests that in this family the gene is not linked tothe disease. In fact, LOD score analysis shows an infinitenegative number at 0 = 0 (table 3).

Class II Families: Probands That Result fromConsanguineous Marriages

If one assumes that the diseased alleles are very rarein the population, then it is likely that patients fromconsanguineous families are homozygotes for a defec-tive allele inherited from a common ancestor (Landerand Botstein 1987). If the apo B gene causes ABLP, thenpatients in such families should be homozygotes at thislocus. In family R, the parents of the proband are bothdescended from individuals 1.1 and 1.2. The affectedindividual (VI.4) is heterozygous at the apo B locus(C3D3) (fig. 2). Similarly, in family A, the parents ofthe proband are descended from individuals I.1 and 1.2(fig. 2). However, the patient (VI.2) is heterozygous atthe apo B locus with two different alleles (BlE3). TheLOD scores for families R andA are -0.75 and -0.95,respectively, at 0 = 0. The sum of theLOD scores fromthese two class II families is -1.7 (at 8 = 0), whichis very suggestive in excluding linkage (Morton 1955)of the apo B gene to the disease.

Class Ill Family: One Parent Is an Apparent HomozygoteA family was identified in which affected and un-

affected siblings had the same apparent haplotype, butthis family could not be included as a class I family.This was because one parent (family S-2, individual1.2) appeared to be a homozygote at the apo B locus

Class IFURilyL

1 2

AsB1 C4 3

AsE3 A5E3 AsC4

Class 11

1 2

t12 3 4

_ | 1~~~~~~~~2

C3C3C3 I C3D3 33C3D3 C3C3 C3C3C3D3 C3C3

Famiy R

IV

Vl

VaIb

1 2

1'

1' 3IV+ )

B1E3 3OE3E

BrE3

1145

Huang et al.

Table 3

Test of Disease Linkage to APO B Gene Locus (LOD score) in Eight ABLP Families

FAMILY

L R A S-2 E K S-1 Y

0:.50 ...... .000 .000 .000 .000 .000 .000 .000 .000.40 ...... .031 .005 - .005 - .006 .000 .034 .000 .000.30 ...... .094 .018 - .019 - .024 .004 .129 .004 .004.20 .124 .014 - .058 - .056 .018 .267 .018 .018.10 ...... .022 - .077 - .183 - .104 .056 .430 .056 .056.05 ...... -.186 -.228 -.352 -.137 .086 .515 .086 .086.04 ...... - .265 - .281 - .410 - .144 .093 .533 .093 .093.03 ...... -.372 -.348 -.483 -.152 .100 .550 .100 .100.01 ...... -.813 -.559 -.720 -.168 .116 .585 .116 .116.00 .....a - .754 - .950 - .176 .125 .602 .125 .125

Class ...... I II II III IV IV IV IV

NOTE. -LOD scores of each family are shown. A LOD score of 3.0 represents odds of 1,000:1 thatthe observations are the result of linkage at the specified recombination frequency rather than of in-dependent segregation. On the contrary, a LOD score of -2.0 suggests nonlinkage (Morton 1955).The analysis was performed by designating ABLP as a recessive disease. Haplotype frequencies wereestimated on the basis of approximate allele frequency of each RFLP marker.

a Infinite negative number.

(A4A4) after evaluation of all nine RFLPs, includingDNA sequence analysis of the 3'; VNTR (the A4 al-lele is estimated to have a population frequency of<.001). This suggests that the parent was in fact homo-zygous at the apo B locus and yet was unaffected. Thiscould only be the case if ABLP was caused by anothergene locus. LOD score analysis of this family gave asmall negative number (-0.176 at 0 = 0). The datafrom class I, class II, and class III families strongly sup-port the hypothesis that the apo B gene is not the directcause of ABLP in these families.

Class IV Families: Compatible with Linkage

Class IV families are those in which the hypothesisthat the apo B gene segregates with the disease is notviolated. In family E (fig. 2), the affected child (II.1)has one allele different (D3D3) than those of theunaffected sibling (11.2, D3E3). In family K (fig. 2),both affected children (II.1 and II.2) have the same apoB alleles (AlC1). In family S-i (fig. 2), the affected (11.2,A1E3) and the unaffected (11.1, AjC4) siblings onlyshare one apo B allele. Similarly, in family Y (fig. 2),the affected child (11.2, E3E3) has only one allele thatwas shared by the unaffected sibling (11.1, C3E3). Al-though these families gave positive LOD scores that fa-vor linkage (table 3), the sum from these families isonly 0.977 at 0 = 0. This is not statistically significant.

Overall, LOD score analysis of all eight families ex-cludes any absolute linkage between the apo B geneand ABLP in three families, whereas the possibility oflinkage in the rest of families cannot be excluded.

Discussion

In the present report, the hypothesis that the apo Bgene is linked to ABLP was tested. A total of eight fami-lies with at least one affected individual with ABLP werestudied. RFLP markers were used to establish the haplo-types of the apo B alleles in family members. From twotypes of families (class I and class II), strong suggestiveevidence was obtained that precluded absolute linkageof the apo B gene to the disease. In class I families,the affected siblings had different apo B alleles. In twoclass II families, in which probands were the result ofconsanguineous marriages, the affected patients wereheterozygotes at the apo B locus. One other type offamily, class IV, appeared to be compatible with thelinkage, but this was not statistically significant. Ourresults are compatible with those ofTalmud et al. (1988),who studied two class I families in which affected sib-lings did not share the same two apo B alleles. Althoughwe cannot conclude that all cases of ABLP are not dueto defects in the apo B gene, both the current studyand that of Talmud et al. allow us to conclude rather

1146

Apo B Gene and Abetalipoproteinemia 1147

strongly that the underlying genetic abnormality in mostcases of ABLP is not in the apo B gene.A related issue is whether the cause of ABLP is the

same in each affected individual. Although no plasmaapo B has been observed in the ABLP patients, conflict-ing observations at the cellular level have been described(Glickman et al. 1979; Dullaart et al. 1986; Lackneret al. 1986). An earlier study showed no detectable apoB in intestinal cells of one ABLP patient (Glickman etal. 1979). A more recent study showed elevated levelsof hepatic apo B mRNA and accumulation of intracel-lular hepatic apo B protein in two ABLP patients, sug-gesting a posttranslational defect (Lackner et al. 1986).Another recent study showed apo B protein detectablein both the endoplasmic reticulum and Golgi complexin both hepatocytes and intestinal mucosal cells in tis-sues from different patients (Dullaart et al. 1986). Thesephenotypic differences at the cellular level in the pa-tients described above do suggest genetic heterogeneityin the cause of this disease.

Besides the apo B gene which can be excluded in mostcases, candidate genes that could cause ABLP mightbe those that code for proteins that regulate apo B genetranscription, control the glycosylation of the protein,or play a role in the assembly or secretion of apo Bcontaining lipoprotein particles. When candidate genesresponsible for these processes are identified, haplotyp-ing at these loci and linkage analysis in families as de-scribed here can be used to test whether any of thesegenes might be causative. The causative gene may alsobe localized by homozygosity mapping as described byLander and Botstein (1987). This method involves theuse of mapped human DNA RFLPs as markers to de-tect the disease locus in consanguineous ABLP fami-lies. The hypothesis is that the region adjacent to thedisease gene will be homozygous in such inbred chil-dren. It has been shown that 50% of ABLP patientsare the result of consanguineous marriages (Herbertet al. 1983). If adequate numbers of consanguineousABLP families could be obtained, this approach mightbe useful in mapping the causative gene for ABLP.

AcknowledgmentsWe wish to thank Michael E. Ripps for his excellent tech-

nical assistance, Dr. Walter E. Nance for his advice on LODscore analysis, and Lorraine Duda and Alex McNear for theirexpertise in preparing the manuscript. This research was sup-ported by National Institutes of Health grants HL36461,HL32435, HL30842, and HL40404, by an award from theSinsheimer Foundation to L.-S.H., and by general support

from the Pew Trusts. J.L.B. is an Established Investigator ofthe American Heart Association.

ReferencesBoerwinkle E, Xiong W, Fourest E, Chan L (1989) Rapid

typing of tandemly repeated hypervariable loci by the poly-merase chain reaction: application to the apolipoproteinB 3' hypervariable region. Proc Natl Acad Sci USA 86:212-216

Pullinger CR, et al (1988) Truncated variants of apolipoproteinB cause hypobetalipoproteinaemia. Nucleic Acids Res 16:8361-8374

Dullaart RPF, Speelberg B, Schuurman H-J, Milne RW, Ha-vekes LM, Marcel YL, Geuze HJ, et al (1986) Epitopesof apolipoprotein B-100 and B-48 in both liver and intes-tine: expression and evidence for local synthesis in reces-sive abetalipoproteinemia. J Clin Invest 78:1397-1404

Glickman RM, Green PH, Lees RS, Lux SE, Kilgore A (1979)Immunofluorescent studies of apolipoprotein B in intesti-nal mucosa, absence in abetalipoproteinemia. Gastroen-terology 76:288-292

Hegele RA, Huang L-S, Herbert PN, Blum CB, Buring JE,Hennekens CH, BreslowJL (1986) Apolipoprotein B-geneDNA polymorphisms associated with myocardial infarc-tion. N Engl J Med 315:1509-1515

Herbert PN, Assmann G, Gotto AM Jr, Frederickson DS(1983) Familial lipoprotein deficiency: abetalipoproteine-mia, hypobetalipoproteinemia. In: Stanbury JB, Wyn-gaarden JB, Fredrickson DS (eds) The metabolic basis ofinherited disease. McGraw-Hill, New York, pp 589-621

Huang L-S, Breslow JL (1987) A unique AT-rich hypervaria-ble minisatellite 3' to the apo B gene defines a high infor-mation restriction fragment length polymorphism. J BiolChem 262:8952-8955

Huang L-S, de Graaf J, Breslow JL (1988) Apo B gene MspIRFLP in exon 26 changes amino acid 3611 from Arg toGln. J Lipid Res 29:63-67

Huang L-S, Miller DA, Bruns GAP, Breslow JL (1986) Map-ping of the human apo B gene to chromosome 2 and demon-stration of a two-allele restriction fragment length poly-morphism. Proc Natl Acad Sci USA 83:644-648

Huang L-S, Ripps ME, BreslowJL (1990) The molecular ba-sis of five apolipoprotein B gene polymorphisms in non-coding regions. J Lipid Res 31:71-77

Huang L-S, Ripps ME, Korman SH, Deckelbaum RJ, Bres-low JL (1989) Hypobetalipoproteinemia due to an apoli-poprotein B gene exon 21 deletion derived by Alu-Alu recom-bination. J Biol Chem 264:11394-11400

Kayden HJ (1972) Abetalipoproteinemia. Annu Rev Med3:285-296

Lackner KJ, MongeJC, Gregg RE, HoegJM, Triche TJ, LawSW, Brewer HB Jr (1986) Analysis of the apolipoproteinB gene and messenger ribonucleic acid in abetalipoproteine-mia. J Clin Invest 78:1707-1712

1148 Huang et al.

Lander ES, Botstein D (1987) Homozygosity mapping: a wayto map human recessive traits with the DNA of inbred chil-dren. Science 236:1567-1570

Leppert M, Breslow JL, Wu L, Hasstedt S, O'Connell P,Lathrop M, Williams RR, et al (1988) Inference of a mo-lecular defect of apolipoprotein B in hypobetalipoprotein-emia by linkage analysis in a large kindred. J Clin Invest82:847-851

Lipid Research Clinics Program (1974) Manual of labora-tory operations. DHEW 75. Government Printing Office,Washington, DC

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular clon-ing: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, NY

Morton NE (1955) Sequential tests for the detection of link-age. Am J Hum Genet 7:277-318

Ott J (1974) Estimation of the recombination fraction in hu-man pedigrees: efficient computation of the likelihood ofhuman linkage studies. Am J Hum Genet 26:588-597

Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, HornGT, Mullis KB, et al (1988) Primer-directed enzymatic am-plification ofDNA with a thermostable DNA polymerase.Science 239:487-491

Scanu AM, Aggerbeck LP, Kruski AW, Lim CT, Kayden HJ(1974) A study of the abnormal lipoproteins in abetali-poproteinemia. J Clin Invest 53:440-453

Schwartz JF, Rowland LP, Eder H, Marks PA, Osserman EF,Hirschberg E, Anderson H (1963) Bassen-Kornzweig syn-drome: deficiency of serum P-lipoprotein. Arch Neurol8:438-454

Sealey PG, Whittaker PA, Southern EM (1985) Removal ofrepeated sequences from hybridization probes. NucleicAcids Res 13:1905-1922

Talmud PJ, Lloyd JK, Muller DPR, Collins DR, ScottJ, Hum-phries S (1988) Genetic evidence from two families thatthe apolipoprotein B gene is not involved in abetalipopro-teinemia. J Clin Invest 82:1803-1806

Wang X, Schlapfer P, Ma Y, Butler R, Elovson J, SchumakerVN (1988) Apolipoprotein B: the Ag (al/d) immunogeneticpolymorphism coincides with a T to C substitution atnucleotide 1981, creating an Alul restriction site. Arterio-sclerosis 8:429-435

Young SG, Bertics SJ, Curtiss LK, Casal DC, Witztum JL(1986) Monoclonal antibody MB19 detects genetic poly-morphism in human apolipoprotein B. Proc Natl Acad SciUSA 83:1101-1105

Young SG, Northey ST, McCarthy BJ (1988) Low plasma cho-lesterol levels caused by a short deletion in the apolipoproteinB gene. Science 241:591-593