expert committee on biological ......who/bs/2019.2373 english only expert committee on biological...

WHO/BS/2019.2373

ENGLISH ONLY

EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION

Geneva, 21 to 25 October 2019

Report on a Collaborative Study

for the Proposed WHO 1st International Reference Panel (19/158) for the

Quantitation of Lentiviral Vector Integration Copy Numbers

Yuan Zhao1, Christopher Traylen, Peter Rigsby, Eleanor Atkinson, Stifani Satkunanathan, Participants2 and

Christian K Schneider

National Institute for Biological Standards and Control, Blanche Lane, South Mimms, Potters

Bar, HERTS EN6 3QG, UK 1Email address: [email protected]

2 Table 1

NOTE:

This document has been prepared for the purpose of inviting comments and suggestions on the

proposals contained therein, which will then be considered by the Expert Committee on

Biological Standardization (ECBS). Comments MUST be received by 27 September 2019 and

should be addressed to the World Health Organization, 1211 Geneva 27, Switzerland, attention:

Technologies, Standards and Norms (TSN). Comments may also be submitted electronically to

the Responsible Officer: Dr Ivana Knezevic at email: [email protected].

© World Health Organization 2019

All rights reserved.

This draft is intended for a restricted audience only, i.e. the individuals and organizations having received this draft. The draft

may not be reviewed, abstracted, quoted, reproduced, transmitted, distributed, translated or adapted, in part or in whole, in any

form or by any means outside these individuals and organizations (including the organizations' concerned staff and member

organizations) without the permission of the World Health Organization. The draft should not be displayed on any website.

Please send any request for permission to:

Dr Ivana Knezevic, Technologies Standards and Norms, Department of Essential Medicines and Health Products, World Health

Organization, CH-1211 Geneva 27, Switzerland. Email: [email protected].

The designations employed and the presentation of the material in this draft do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its

authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines

for which there may not yet be full agreement.

mailto:[email protected]

WHO/BS/2019.2373

The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended

by the World Health Organization in preference to others of a similar nature that are not mentioned. Errors and omissions

excepted, the names of proprietary products are distinguished by initial capital letters.

All reasonable precautions have been taken by the World Health Organization to verify the information contained in this draft.

However, the printed material is being distributed without warranty of any kind, either expressed or implied. The responsibility

for the interpretation and use of the material lies with the reader. In no event shall the World Health Organization be liable for

damages arising from its use.

This draft does not necessarily represent the decisions or the stated policy of the World Health Organization.

Summary

This report describes the development and characterisation of four candidate materials and

evaluation of their suitability to serve as WHO standards for lentiviral vector (LV) integration

analysis. The development of the 1st WHO standard for lentiviral vector integration is to meet a

high demand from the community to ensure delivery of a safe and efficacious dose of LV products

to patients and to facilitate patient follow-up worldwide. The materials comprise human genomic

DNA containing zero, low or high copies of a lentiviral vector integration. The lentiviral vector

integration copy number per cell was determined in an international collaborative study using three

principal methods: TaqMan qPCR, SYBRGreen qPCR and digital PCR, and supplementary

sequencing-based methods. A total of thirty-one laboratories from fifteen countries participated in

the collaborative study, including eight National Regulatory/Control laboratories; six academic

laboratories/hospitals and seventeen companies (Table 1). Based on the results obtained in this

study, three of the candidate materials are proposed as a reference panel for LV copy number with

assigned values of 0 LV copies/cell (coded 18/142), 1.42 LV copies/cell for the low value material

(coded 18/126) and 8.76 LV copies/cell for the high value material (coded 18/132) It is also

proposed that the other candidate material (coded 18/144) is established as a stand-alone

qualitative reference reagent for the integration site analysis, with 10 defined integration sites.

The intended use of the WHO 1st Reference panel (19/158) of three materials (18/126, 18/132 and

18/142) is for end-users to generate a genomic DNA standard curve from sample 18/132 using

18/142 as the diluent and to include 18/126 as a positive control (in order to confirm comparable

LV copies/cell to the consensus value for the sample 18/126 to validate the assay for unknown

sample quantitation). The WHO 1st Reference Reagent (18/144) is to be used as a standard-alone

qualitative reference reagent for the integration site analysis, with a confident detection of the ten

defined integration sites, in order to validate end-users’ integration-site study protocols. The

stability studies at eight months so far indicated that the candidate preparations are stable for long-

term storage at -20˚C.

Introduction

Lentiviral vectors (LV) have been successfully used in a cure for monogenic immunodeficiency

disorders and CAR T cell cancer immunotherapies. Two Chimeric Antigen Receptor CAR-T-cell

therapies Kymriah and Yescarta, and an ex vivo therapy for monogenic immunodeficiency,

Strimvelis, using integrating vectors have been approved to be used in EU and US markets. There

are currently a total of 138 LV clinical trials worldwide (6 in Phase III/IV), and 58 Chimeric

WHO/BS/2019.2373

Antigen Receptor CAR-T-cell trials (18 in Phase II/IV) (https://clinicaltrials.gov/). In addition, the

number of potential patients using LV based products will be significant, given that a number of

products in development using CRISPR, TALEN, nucleases, Zinc Finger or iPSC technologies

also use a lentiviral vector as tools or delivery system for genetical modification of the products.

Nevertheless, the number of patients is only one of the factors important for estimating the public

health impact; the severity of disease, impact of a given disease on both the patient and society,

and its unmet medical need are also important determinants for the impact of lentiviral vector-

based products. This is confirmed by experiences across jurisdictions from orphan medicinal

products where the number of patients is by definition very small, but the clinical impact of

medicines can be considerable.

Manufacture of LV based products used in ex vivo autologous therapies is often a de-centralized

or near-patient process. The complexity and intrinsic disparity of decentralized manufacture will

benefit significantly from an enhanced in-process control and standardization to ensure product

consistency. Significant efforts have been made in the field of CAR-T cell therapies using lentiviral

vectors to move from autologous to allogenic therapies and from near-patient to centralized

manufacturing processes. Well-controlled and standardized processes as well as well-understood

and consistent products are particularly important for LV based ex vivo therapies; therefore,

standardization of manufacturing processes for ex vivo lentiviral products is one that is best put in

place early in product development.

The need for standardization of LV integration is recognised due to uncontrolled LV integrations

potentially leading to insertional mutagenesis and overexpression or disruption of adjacent genes

at the site of integration. For example, the lentiviral vector used was found to disrupt the HMGA2

transcript in a Thalassemia trial2. Intragenic insertions of lentiviral vectors leading to aberrant gene

regulation have been identified in preclinical studies4-8. Therefore, using the lowest LV copy

numbers per cell that have been demonstrated to provide clinical benefit is, currently, an effective

measure to minimize the risk of insertional mutagenesis in target cells and reduce the genotoxic

and tumorigenic potential.

In addition, patients need to be monitored for long-term safety, often lifelong, for the level of

vector copies in blood cells. This level may be used to determine further treatment options.

Because cell modification occurs at multiple sites, assay standardisation is vital to ensure delivery

of a safe and efficacious dose, including allowing determining if a negative test result is “truly”

negative – a false negative test result may have far reaching consequences for the patient and the

benefit/risk assessment of a particular medicinal product. Global patient follow-up with rare

disease needs to be consistent for the individual and for the patient population.

Currently quantitative PCR, e.g. TaqMan qPCR, SYBRGreen qPCR, digital PCR and high-

throughput sequencing are the common methods used in integration analysis. All current methods

have significant limitations in terms of sensitivity, accurate quantification and data interpretation.

It has been previously shown that using the currently available methods, the integration vector

copy numbers (VCN) were often underestimated9. This is because the choice and design of

amplification target sequences and the conditions of reaction impact on the specificity and

sensitivity of PCR based methods, which makes it difficult to compare data across clinical trials,

assays and laboratories.

https://clinicaltrials.gov/

WHO/BS/2019.2373

The European Medicines Agency (EMA) and US Food and Drug Administration (FDA) require

integration studies and long-term follow-up on products like Lentiviral vectors that have a capacity

to permanently integrate into the host cells and to persist for a long time in treated individuals. The

EMA requirement for supporting marketing authorization applications includes integrated vector

copies per genome, integration profile and integration sites [EMA/CAT/190186/2012,

EMA/CAT/80183/2014]. An EMA reflection paper [EMA/CAT/190186/2012] on the

‘management of clinical risks deriving from insertional mutagenesis’ also highlighted the high

vector copy number as a risk factor for oncogenesis and recommended risk assessment and

management of the integration copy numbers, integration profile and sites in products. FDA

recommends limiting the integration copy number to under 5 copies per cell (presentation by Dr.

Vatsan/FDA at ISBioTech conference on March 7, 2017).

In 2016, an International Workshop was held at NIBSC with representation from Regulatory

agencies, pharmaceutical manufacturers, control laboratories and academia to discuss the logistics

of developing the 1st WHO lentiviral integration standard. The discussion included 1) the type of

standard materials, e.g. plasmid DNA, freeze-dried cells or genomic DNA, 2) the type of cell to

be used, e.g. MRC-5 cells, T cell line, 293T or hematopoietic cells, 3) production methods, e.g.

using bulk cell population or single cell clone for standard production, 4) composition of the

standard, a single standard material or a panel (>3) of standards, containing zero, 1 or up to 10

copies of LV integration. It was agreed at the Workshop to develop a panel of genomic DNA

standards from a single cloned cell line containing 0, 1 or up to 10 of LV integration with an

assigned unitage of LV copies/cell using as wide a range as possible of detection methods, e.g.

qPCR, digital PCR, LAM-PCR, whole genome sequence and Southern blot, to assign an unitage

of LV copies/cell to individual materials of the standard panel. Subsequently, a paper was

published in 2017 in Human Gene Therapy Methods (Appendix XI

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5628571/)10 to provide further information on the

history, rationale, proposed production and evaluation process and preliminary results for the

establishment of the candidate standard panel. The collaborative study (NIBSC study code CS633)

was conducted in 2018 with the participation of thirty-one laboratories from fifteen countries and

the aim of evaluating the candidate materials for their suitability to serve as the WHO 1st International

Reference panel (19/158) and Reference Reagent (18/144) for LV integration analysis.

The development of the 1st WHO standard for lentiviral vector integration will meet a high demand

from the community. The WHO standard is primarily for standardizing three milestone stages of

LV product development, that is, establishment of the manufacturing process, clinical dose

determination and patient safety follow-up. During manufacture, the standard could be used to

standardise the LV production process by measuring the number of vectors integrated in an in vitro

testing cell line with methods that are independent of the therapeutic transgene or the promoter.

Standardised LV potency assay is important for batch to batch comparability and consistency

assessment, also allowing for establishing changes and optimization of the manufacturing process

more reliably. Here, the standard could be used as a measurement of potency rather than safety

(insertional mutagenesis is an expression of potency, albeit medically unwanted). Secondly, the

genomic standard can be used to standardise the clinical dose of ex vivo LV products, where the

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5628571/

WHO/BS/2019.2373

medicinal product in these applications is the LV modified cells. The clinical protocols set an

average copy number of vector integrants for such products, usually an average of approximately

one copy to ensure efficacy and an upper limit of four copies to minimise the risk of toxicity. In

situations where the gene therapy medicinal product is intended to treat an orphan condition, this

will be particularly useful, since the access to patients for dose optimization is limited, and animal

models may not be sufficiently relevant, depending on the situation.

The development of this genomic DNA reference material for gene therapy supports the WHO’s

objectives to improve global access to Advanced Therapies (ATMPs) by 2030, WHO’s desire to

harmonise global regulation and the UK government’s long-standing task to enable innovation.

The development of a WHO International Reference for gene therapy has been in consideration

for several years, involving discussions with companies, clinicians and the academic community

in order to assess where such standard would be most useful in addressing unmet needs. As a

result, in 2016 the WHO’s Expert Committee on Biological Standardization (ECBS) endorsed the

proposal from NIBSC to develop the first WHO gene therapy genomic DNA standard panel for

the quantitation of lentiviral vector integration copy numbers – a significant milestone in the field

of standardization of biological medicines.

Materials

Bulk material and processing

Full details of the production and validation process for the candidate materials are detailed in

Appendix IV and schematically shown in Figure 3 (Appendix IV). Briefly, 293T cells were

transduced with a 3rd generation of lentiviral vector carrying a reporter gene GFP (kindly donated

by Professor Didier Trono, EPFL, detailed in Figure 2, Appendix IV) at MOI 0.5 to 10 and were

single cell cloned based on LV copies and GFP intensity to establish 18/126 and 18/132.

Candidate material 18/144 was established from double transduction of 18/132 with LV at MOI

~5 before multi-round of single cell cloning. Master cell banks and Working cell banks were

derived from the established single cell clones and were subjected to full characterization including

sterility test, karyotyping, qPCR and ddPCR quantitation of LV copies/cell and sequencing

analysis of LV integration sites (Figure 3, Appendix IV). Bulk genomic DNA were extracted and

purified from Working cell banks for individual candidate materials and were lyophilized at

5ggenomic DNA/ampoule in 10 mM Tris, 1 mM EDTA buffer with 5 mg/mL D-(+)-trehalose

dehydrate, as detailed in Appendix IV.

Cell line choice

HEK293T cells were used in this study on the basis of their performance in lentiviral transduction

experiments and also their rapid growth rates and ease of cloning. Concerns about aneuploidy and

genomic instability have been circumvented by proving this material in DNA-form with a unitage

of LV copies/diploid genome mass. The standard may be used to harmonies the measurement of

LV integrations in patient cells as LV copies/cell by comparison of LV measurement in the

standard and the patient DNA, and then extrapolating back to LV/cell in the patient on the basis

of patient cells being diploid (nLV copies/6.6pg DNA =nLV copies/ diploid cell).

WHO/BS/2019.2373

LV integration

The LV integration copies per cell (diploid genome mass) adopted in this study were derived from

using Albumin as the housekeeping gene with the sequence copy number N=2 per diploid cell

genome mass. The use of LV copies/cell as the unitage instead of International Units (IU) for the

candidate Reference panel is because 1) as shown in a summary table of 43 publications over last

10 years between 2000 and 2019 (Appendix XII), three types of Unitage have been used to express

LV integration copies in cells, i.e. LV copies/cell, LV copies/genome or LV copies/genome mass

e.g. ng or g with LV copies/cell being most common - the three Unitage expressions are in effect

inter-changeable and traceable to each other, this is because, one cell has one diploid cell genome

weight of 6.6pg; 2) current regulatory requirement is to limit LV integration to less than 5

copies/cell; 3) the gene therapy community is relatively new to WHO standardization and would

be unlikely to adopt IU given the common practice of expressing data as LV copies/cell at the

present time.

Stability assessment Multiple samples were reserved for in-house long-term accelerated degradation studies by storage

at temperatures (-150°C, -70°C, -20°C, +4°C, +20°C, +37°C, and +56°C), as well as for real-time

stability monitoring at -20°C. Accelerated degradation studies were performed to predict the long-

term stability of the candidate standard. Ampoules of the lyophilised preparation were stored at

different temperatures, namely +56 oC, +45 °C, +37 oC, 20 oC and 4 °C and tested at indicated

time points together with ampoules stored at the recommended temperature of -20 °C and -70 °C

as baseline reference temperature. Stability study results up to 8 months are detailed in Appendix

V (Figures 5-7 and Tables 11-13). Real time monitoring of stability is ongoing.

Collaborative Study

Aims of the Collaborative Study The purpose of the collaborative study (NIBSC study code CS633) was to evaluate the candidate

materials for their suitability to serve as the WHO 1st International Reference panel for PCR based

quantitation of Lentiviral vector integration copy numbers and to assign a consensus value (LV

integration copy number per cell) to each of the materials.

Participants A total of forty laboratories were willing to participate in the collaborative study, thirty-three

participating laboratories from fifteen countries were dispatched samples, due to the time

constraint, seven laboratories did not received the materials and thirty-one laboratories from

thirteen countries returned data contributing to this study report. The participating laboratories

include eight National Regulatory/Control laboratories; six academic laboratories/hospitals and

seventeen companies (Table 1).

WHO/BS/2019.2373

Table 1. List of participants in the collaborative study Country Contacts Address Affiliation

Canada Prof. Amine Kamen,

Michelle Yen Tran, Aline

Minh, David Sharon,

McGill University Academia/hospitals

France Dr. Xavier Leclerc Clean Cells Companies

France Dr. Bastian Herve Sangamo Therapeutics Companies

France Dr. Xavier Chenivesse ANSM Official Control

laboratories

Germany Drs. Manfred Schmidt,

Wei Wang, Irene Gil-

Farina, Marco Zahn

Genewerk GmbH Companies

Germany Drs Carsten Kintscher,

Susanne Knoll

Miltenyi Biotec GmbH Companies

Germany Drs. Csaba Miskey,

Zoltan Ivics

Paul Ehrlich Institute Official Control

laboratories

Italy Drs. Ilaria Visigalli,

Albertini Paola, Michela

Vezzoli, Naldini Luigi

Ospedale San Raffaele Academia/hospitals

Italy Drs. Francesca Rossetti,

Claudia Piovan

MolMed SPA Companies

Italy Drs. Filomena Nappi,

Pisani Giulio

Instituto Superiore di Sanita Official Control

laboratories

Japan Dr. Eriko Uchida National Institute of Health

Sciences

Official Control

laboratories

Korea Dr. Lee Jun-Ho Research Institute of

PharosVaccine

Academia/hospitals

Korea Professor Keerang Park,

Heesoon Change

CdmoGen Co Ltd Companies

P. R. China Drs. Yonghong Li,

Chunming Rao

National Institute for Food and

Drug Control (NIFDC)

Official Control

laboratories

P.R. China Dr. Guodong Javier Jia Obio Technology

(Shanghai)Corp.Ltd

Companies

P.R. China Drs. Haoquan Wu, Ying

Dang

Kanglin Biotech (hangzhou)Co.

Ltd

Companies

P.R. China Dr. Ling He Fundamenta Therapeutics Companies

P.R. China Drs. Wang Yu, Lei Sun Immunotech Applied Science

Ltd

Companies

Portugal Drs. Ana Sofia

Coroadinha, Pedro Cruz

iBET Companies

Singapore Drs. Lucas Chan, Paula

Lam, Wei Xiang Sin

CellVec Pte. Ltd Official Control

laboratories

Switzerland Dr. Caroline Bellac Swissmedic Official Control

laboratories

WHO/BS/2019.2373

Taiwan Drs. Yi-Chen Yang, Po-

Chih Wu

Taiwan Food and Drug

Administration

Official Control

laboratories

UK Drs. Daniel Chipchase,

Nicholas Clarkson,

Oxford BioMedica plc Companies

UK Drs. Jorge Soza Ried,

Martijn Brugman, John

Barlow, Steven Howe

GSK Companies

UK Drs. Christopher Perry,

Yasu Takeuchi

Wohl Virion Centre, UCL Academia/hospitals

UK Dr. Christopher Traylen,

Stifani Saktkunanathan

NIBSC/MHRA Official Control

laboratories

USA Dr. Christine Mitchell WuXi AppTec Companies

USA Dr. Clifford Froelich St. Jude Children's Research

Hospital

Academia/hospitals

USA Bradley Hasson, Audrey

Chang

Millipore-Sigma (BioReliance) Companies

USA Drs Deb Bhattacharya,

Alberta Colakovic

Bluebird Bio Companies

USA Dr. Brigitte Senechal MSKCC Academia/hospitals

Collaborative Study Materials Four materials (Table 2) were produced at NIBSC as detailed in Appendix IV_Bulk Material

and Processing and, were evaluated as candidates as the proposed WHO 1st International

Reference panel for the quantitation of Lentiviral vector integration copy numbers. All materials

were of freeze-dried, purified gDNA extracted from four cell lines containing either 0, low or high

copies of lentiviral vector integration.

Table 2. Code, stock number of candidate materials

Ampoule

code Fill date

Study

code

No of

ampoules

offered to

WHO

Excipients

18/126 01/06/2018 B ~2000

2.0 mM Tris,

0.2 mM EDTA,

5 mg/mL D-(+)-trehalose dehydrate

18/132 21/06/2018 C ~2000

18/142 28/06/2018 A, E ~4,000

18/144 28/06/2018 D ~1000

WHO/BS/2019.2373

Collaborative Study Design and protocol The collaborative study protocol is summarized as following:

• The panel of four genomic DNA materials coded A/E (18/142), B (18/126), C (18/132)

and D (18/144) were dispatched to participating laboratories. Of the five coded candidate

materials, samples A and E are identical (18/142) and were coded separately merely for the

technical convenience in sample preparation.

• Three principal methods, i.e. TaqMan qPCR, SYBRGreen qPCR, digital PCR and a

supplementary sequencing-based method, were conducted to evaluate the candidate

materials.

• Absolute quantitation, i.e. LV copies per cell, was sought for each candidate material.

• Candidate material C (18/132) was also evaluated in a format of five serial 3-fold dilutions,

i.e. C, C1, C2, C3 and C4, in the presence of the combined sample A/E (18/142) for its

suitability to serve as a quantitative genomic calculation standard.

• Qualitative data was also sought for individual candidate materials for LV integration sites

in human genomic DNA.

• Optional DNA quantitation data was also sought for each of materials for genomic DNA

quantity per ampoule.

Depending on the number of methods to be performed by individual laboratories, at least four sets

of five ampoules of gDNA materials coded A, B, C, D and E were sent to each laboratory. Of the

five coded candidate materials, samples A and E are identical and were coded differently merely

for the technical convenience in sample preparation. One plasmid DNA sample coded as ‘NIBSC

DNA standard’ and two sets of synthesized DNA oligos, coded “NIBSC LV_primer set” or

“NIBSC HK_primer set” were also sent to each laboratory, in case some of the laboratories did

not have in house standard or primers available. Detailed information on NIBSC plasmid standards

and primers sent to the participating laboratories is given in Appendix VI.

Instructions for use (IFU) (Appendix V) detailing the reconstitution, testing sample preparation

and storage conditions together with data reporting sheets were sent to each laboratory. Detailed

example protocols (termed NIBSC protocols, Appendix VII and VIII) were also provided to the

participants although participants were encouraged to use their individual (in house) protocols

wherever possible.

After being reconstituted and prepared as detailed in IFU (Appendix VI), each set of 8 samples

i.e. A+E, B, C, C1, C2, C3, C4 and D, were tested using qPCR or each set of four samples A/E, B,

C and D were tested using digital PCR. Each method was performed 3 times on each of three

separate days using three separate sets of samples in triplicate wells, preferentially by different

operators.

Laboratories were asked to report raw data and quantitative results for each sample, e.g. qPCR Ct

values or ddPCR droplet counts, together with details of the methods used and comments or issues

observed.

Summary of Collaborative Study Methods Three principal methods. i.e. TaqMan qPCR, SYBRGreen qPCR and digital PCR, were used by

thirty-one laboratories for the quantitation of LV integration copy numbers per cell (Table 3). Two

WHO/BS/2019.2373

supplementary methods were also used, i.e. sequencing-based methods for LV integration site

analysis and NanoDrop or QuBit for DNA quantitation (g/ampoule). Twenty-nine laboratories

used TaqMan qPCR, thirteen laboratories used SYBRGreen qPCR and eleven laboratories used

digital PCR to evaluate LV copy numbers, four laboratories performed sequencing-based methods

to evaluate integration sites and fifteen laboratories evaluated DNA quantity (g/ampoule). All

studies were performed using participants’ individual laboratories’ reagents and equipment. In

terms of study protocols, twenty-three sets of all PCR data were obtained from independent

laboratories’ (in-house) protocols and thirty-seven data sets from the provided NIBSC protocols

for SYBRGreen qPCR, TaqMan qPCR or digital PCR. Some laboratories provided two sets of

data for one method using different protocols. For one sample, each set of data (n=9) comprise

results from triplicate experiments tested in triplicate wells and performed on three independent

days using three independent sets of materials.

A total of sixty PCR (qPCR or ddPCR) data sets contribute to the quantitation of LV copy numbers

per cell, including thirty-one data sets from TaqMan qPCR, fifteen sets from SYBRGreen qPCR

and fourteen sets from digital PCR. A total of sixty-six operators performed PCR copy number

quantitation (Table 3).

Table 3. Methods performed by individual participating laboratories

Lab Code

Number of

PCR

Protocols

Number of

Operators

Methods

Performed

AA 3 1 STC

AB 1 1 T

AC 1 3 TC

AD 1 2 TC

AE 2 1 DTQ

AF 2 1 T

AH 2 3 STC

AI 1 3 T

AK 4 2 DSTQC

B 2 3 ST

C 2 2 ST

D 1 2 T

E 1 1 TC

F 1 3 T

H 3 2 STC

I 2 1 DTC

J 3 2 DST

L 3 3 DST

M 3 3 DST

N 3 3 DT

WHO/BS/2019.2373

O 1 2 T

P 3 3 DT

Q 1 3 T

S 2 3 STC

T 2 3 ST

U 3 2 ST

V 1 1 D

W 2 3 TQQvcnC

X 1 1 S

Y 2 1 DTQC

Z 4 3 STC

PCR Data sets from in house protocols 23

PCR Data Sets from NIBSC Protocols 37

Total PCR

operators

Total PCR Data Set 60 66

Total Sequencing Data set 4

Total DNA quantitation Data set 15

Notes for Table 3: D=digital PCR, S=SYBRGreen qPCR, T=TaqMan qPCR, Q=Sequencing

based Methods, C= DNA quantitation.

Results

Stability results Stability studies over 8 months indicated that the candidate preparations are stable for long term

storage at -20˚C. Furthermore, the LV copy number is not diminished after samples were stored

at +56˚C for 8 months, nor after repeated freeze-thaw cycles (Appendix V, Figures 5-7 and

Tables 11-13). As no loss in LV quantity was detected at any of the elevated temperatures, no

predicted loss in gDNA quantities can be calculated, and the panel is likely to be highly stable

when stored at -20˚C.

Collaborative Study Results

Statistical Analysis For quantitative PCR estimates of LV copies/cell calculated using individual laboratories’ plasmid

DNA standards, raw Ct data from all laboratories were analysed centrally at NIBSC in order to

obtain estimates of copies per cell for the study samples tested. Some extreme dilutions not in the

linear range were excluded from the LV and housekeeping (HK) standard curves when fitting the

linear regression model for Ct response against log concentration (copies/5µl per well) and the r2

values for both curves were confirmed to exceed 0.98 before concluding the plate results as

acceptable. Where the slope of results obtained for dilutions of sample C (18/132) did not appear

directly proportional to their expected values (assessed by confirming a slope within the range

WHO/BS/2019.2373

0.80-1.25) dilutional linearity was considered unacceptable and all results from the assay were

excluded from further analysis.

Integration copy numbers per cell (diploid genome mass) were calculated based on the equation:

LV copies/cell = (the copy numbers of integrated LV/the copy numbers of a housekeeping (HK)

gene) x HK target sequence copy number12-14; given that an equal mass of the DNA same sample

was tested for LV or HK on the same plate. Using Albumin as the HK gene, the sequence copy

number N=2 per diploid genome mass was used in this collaborative study to estimate the LV

copies/diploid cell genome of candidate materials. This was determined using diploid MRC-5 cells

as a calculation reference for the Albumin gene copy number, as detailed in Appendix IV and

Table 8.

To obtain quantitative PCR estimates (LV copies/cell) calculated directly using sample C (18/132)

as standard, Ct data from dilutions C, C1, C2 and C3 of sample C were used to construct a standard

curve and express the results for samples B (18/126) and D (18/144) relative to sample C (18/132),

as illustrated by the example in Appendix III. The r2 value for the linear regression was confirmed

to exceed 0.98 before concluding the plate results as acceptable.

For digital PCR (ddPCR), calculated estimates of copies per cell were used directly in further

analysis. Estimates relative to sample C were obtained by dividing by the corresponding assay

estimate for sample C and multiplying by its proposed assigned consensus value.

All mean results shown in this report are unweighted geometric means (GM). Variability has been

expressed using geometric coefficients of variation (GCV = {10s-1}×100% where s is the standard

deviation of the log10 transformed estimates). In order to mitigate the effect of any outliers or

anomalous results, Huber’s robust geometric mean was also calculated using the R package

‘WRS2’ (mest() function)15-16.

Individual Laboratory Data and Assay Validity

A summary of estimated copies per cell is shown in Table 4, Figure 1a (boxplot) and Figure 1b

(individual laboratory mean plot) calculated using laboratory geometric mean estimates for each

sample. Individual plate estimates are shown in Appendices I and II. Estimates from TaqMan and

SYBR-Green qPCR are presented separately and combined to give overall qPCR results. For the

calculation of results relative to C, this sample was assumed to contain 8.76 copies/cell, based on

the robust GM estimate obtained from qPCR assays.

Valid estimates were obtained for the majority of laboratories, including 38 of the 46 data sets

from qPCR and all from ddPCR. As shown in Appendix I, exclusions from further analysis were:

laboratories H2P and X where only one test gave valid estimates due to low r2 values (<0.98) in

LV or HK standard curves; laboratories AD, AH, H2R and J where estimates obtained for dilutions

of sample C did not appear to be directly proportional to the dilutions used (fitted slope < 0.80 in

all cases). Results from laboratory AF (in-house) were excluded as the poor PCR amplification

efficiency.

WHO/BS/2019.2373

The qPCR amplification efficiency was also calculated based on individual laboratories’ plasmid

DNA standards using the equation (qPCR efficiency E=10-1/slope -1). The majority of qPCR assays

gave a qPCR efficiency (E) within the acceptable range of 0.9-1.117. Two data sets H2P and H2R

with qPCR efficiency (E) values were noted to be outside the acceptable range (0.9-1.1) and had

already been excluded from further analysis as noted above. Sample A/E (18/142) was reported

by all laboratories with zero copies of LV integration (Appendix I), thus excluded from further

analysis.

Overall Estimates of Integration Copy Numbers Per Cell Table 4, Figure 1a and Figure 1b summarise overall results from all valid assays. Estimates from

TaqMan and SYBRGreen qPCR are presented separately and combined to give overall qPCR

results. Table 4 shows that inter-laboratory GCV values ranged from 14.9% to 20.2% in combined

qPCR assays (n=38) with robust geometric mean values of 8.76 (8.26 - 9.29) LV copies/cell for

sample C (18/132), 1.42 (1.37 – 1.48) for sample B (18/126) and 10.67 (10.05 – 11.33) for sample

D (18/144). The TaqMan qPCR estimates were in relatively good agreement with SYBRGreen

qPCR estimates for individual samples (Table 4, Figure 1a and Figure 1b).

Two formats of digital PCR were performed, that is simplex (n=5) and multiplex ddPCR (n=9)

ddPCR. The inter-laboratory GCV values ranged from 2.5% to 7.6% in simplex ddPCR, lower

than in multiplex ddPCR (21.5% to 27.9%) and qPCR assays (10.3% to 21.4%), although the high

variability in values for multiplex ddPCR was noted to be due to the results from laboratory P

being discrepant (higher) than the other laboratories performing this method. There was no

observed variation between results obtained from probe-based or dye, e.g. eva green-based digital

PCR. However, digital PCR results were not in good agreement between the two formats (simplex

and multiplex) used (Figure 1a and Figure 1b), with simplex ddPCR overestimating LV copy

numbers/cell for samples C and D when compared to multiplex ddPCR in laboratories AE, V and

N. Digital PCR results from either simplex or multiplex ddPCR were also not generally in good

agreement with the combined qPCR data. Due to the laboratories that used multiplex ddPCR

reporting only the final calculated LV copies/cell without raw data on droplet counts for either LV

or HK targets, it is unclear whether the absolute droplet counts in both formats of ddPCR were

comparable; therefore, it remains to be explored why there is a disparity between simplex and

multiplex ddPCR. As a result, data from digital PCR were not included in determining the

consensus values for individual samples.

Table 4. Summary of estimated LV copies per cell calculated using individual laboratories’ plasmid DNA

standards or sample C as genomic DNA standard Method Sample Standard* Min Max N GM 95% LCL 95% UCL GCV Robust GM 95% LCL 95% UCL

qPCR

(MS&MT)

C Plasmid 4.86 11.73 38 8.65 8.14 9.18 20.2% 8.76 8.26 9.29

B Plasmid 0.93 1.94 38 1.43 1.36 1.49 14.9% 1.42 1.37 1.48

D Plasmid 6.15 13.61 38 10.51 9.91 11.15 19.7% 10.67 10.05 11.33

B C 1.09 1.81 38 1.52 1.47 1.57 10.8% 1.53 1.48 1.57

D C 6.46 14.63 38 11.11 10.59 11.66 15.7% 11.24 10.83 11.68

qPCR

(MS)

C Plasmid 6.64 11.73 12 8.94 7.90 10.11 21.4% 8.94 7.90 10.11

B Plasmid 1.33 1.91 12 1.53 1.44 1.63 10.3% 1.52 1.42 1.62

D Plasmid 7.65 13.61 12 10.05 8.96 11.28 19.8% 9.99 8.66 11.52

B C 1.09 1.73 12 1.51 1.39 1.64 14.0% 1.54 1.42 1.66

D C 6.46 12.04 12 10.43 9.22 11.80 21.5% 10.90 9.88 12.01

qPCR

(MT)

C Plasmid 4.86 11.12 26 8.51 7.91 9.16 19.8% 8.76 8.22 9.33

B Plasmid 0.93 1.94 26 1.38 1.30 1.46 15.4% 1.37 1.32 1.43

D Plasmid 6.15 13.17 26 10.73 9.99 11.54 19.6% 10.96 10.27 11.70

B C 1.23 1.81 26 1.52 1.47 1.58 9.4% 1.52 1.47 1.58

D C 9.18 14.63 26 11.44 10.94 11.96 11.6% 11.39 10.88 11.93

ddPCR (Simplex)

C Plasmid 9.76 11.59 9 10.81 10.41 11.23 5.1% 10.87 10.47 11.27

B Plasmid 1.37 1.48 9 1.43 1.40 1.45 2.5% 1.43 1.41 1.46

D Plasmid 11.64 14.26 9 13.34 12.61 14.11 7.6% 13.47 12.60 14.41

B C 1.07 1.22 9 1.16 1.11 1.20 5.0% 1.16 1.11 1.20

D C 9.54 11.35 9 10.80 10.37 11.25 5.5% 10.87 10.49 11.25

ddPCR (Multiplex)

C Plasmid 6.54 11.15 5 8.43 6.21 11.44 27.9% 8.32 4.66 14.88

B Plasmid 1.24 1.92 5 1.52 1.19 1.93 21.5% 1.51 1.07 2.13

D Plasmid 8.17 12.93 5 10.18 7.74 13.37 24.6% 9.84 6.07 15.96

B C 1.45 1.64 5 1.63 1.52 1.74 5.4% 1.58 1.46 1.71

D C 10.01 10.79 5 10.92 10.54 11.31 2.9% 10.60 10.07 11.14

Notes for Table 4: N: Number of data sets; GM: Geometric Mean; LCL: Lower Confidence Limit; UCL: Upper Confidence Limit;

GCV: Geometric Coefficient of Variation (%); Robust GM: Huber’s Robust Geometric Mean; * Sample C assumed 8.76 copies per

cell; methods: MS=SYBRGreen qPCR, MT=TaqMan qPCR.

WHO/BS/2019.2373

Figure 1a. Boxplot of estimated LV copies per cell calculated using individual laboratories’ plasmid DNA

standards or sample C as genomic DNA standard

Notes for Figure 1a: B:C and D:C indicate results determined using sample C as reference standard (qPCR) or expressed relative to

sample C (ddPCR), both assuming sample C to contain 8.76 copies/cell; boxes are inter-quartile ranges with line showing median

value

WHO/BS/2019.2373

Figure 1b. Individual laboratory mean value plot of estimated LV copies per cell calculated using individual

laboratories’ plasmid DNA standards or sample C as genomic DNA standard

Notes for Figure 1b: B:C and D:C indicate results determined using sample C as reference standard (qPCR) or expressed relative to

sample C (ddPCR), both assuming sample C to contain 8.76 copies/cell

WHO/BS/2019.2373

Table 5. Inter-method variability in estimated copies/cell for qPCR(MS), qPCR(MT), ddPCR(M) and

ddPCR(S)

Methods Sample Standard* Variance Components (as GCV)

Inter-lab Inter-method Total

qPCR (MS) &

qPCR (MT)

B Plasmid 13.8% 7.0% 15.7%

C 11.5% 0.0% 11.5%

D Plasmid 19.5% 0.6% 19.5%

C 15.2% 5.1% 16.2%

ddPCR (Simplex) &

ddPCR (Multiplex)

B Plasmid 12.1% 0.0% 12.1%

C 5.1% 24.5% 25.2%

D Plasmid 15.1% 20.1% 25.9%

C 4.8% 0.0% 4.8%

qPCR (MS),

qPCR (MT) &

ddPCR (Multiplex)

B Plasmid 14.7% 5.7% 15.9%

C 11.0% 0.0% 11.0%

D Plasmid 20.0% 0.0% 20.0%

C 14.5% 3.9% 15.1%

Notes for Table 5: GCV: Geometric Coefficient of Variation (%); * Sample C assumed 8.76 copies per cell; MS=SYBRGreen qPCR,

MT=TaqMan qPCR.

Estimates obtained relative to sample C For the estimated LV copy numbers per cell calculated using sample C (18/132) as standard,

sample C was assumed to contain 8.76 copies/cell based on the robust GM estimate obtained from

qPCR assays (Table 4), whereas sample B and D were used as theoretical ‘unknowns’ to evaluate

the utility of using sample C in harmonising data between laboratories in future applications. A

variance components analysis was performed separately for qPCR and ddPCR results in order to

determine inter-laboratory and inter-method components of variability, as shown in Table 5.

The variability in qPCR results for both samples B and D was reduced when LV copy number per

cell was determined using sample C as standard (Table 5 and Figure 1; total GCV reduces from

15.7% to 11.5% for sample B and from 19.5% to 16.2% for sample D) indicating improved

agreement across laboratories performing qPCR when using sample C as reference standard. For

ddPCR, improved agreement was noted for sample D (total GCV reducing from 25.9% to 4.8%)

but not for sample B (total GCV increasing from 12.1% to 25.2%). It was further noted (Figure 1

and Table 4) that multiplex ddPCR results for both samples B and D showed improved agreement

with qPCR results when expressed relative to sample C (Table 5 and Figure 1; total GCV reduces

from 15.9% to 11.0% for sample B and from 20.0% to 15.1% for sample D), but this was not the

case for simplex ddPCR due to the results obtained for sample B.

LV Integration Site Analysis Four laboratories evaluated LV integration sites for candidate materials B (18/126), C (18/132)

and D (18/144) using sequencing-based methods following individual laboratories’ in-house

protocols. Table 6 shows that two identical integration sites were detected by all four laboratories

for sample B (18/126); seven identical integration sites were reported for sample C (18/132) by all

laboratories and one further site was shared by 3/4 laboratories for sample C (18/132). LV

integration copy number per cell were reported ranging from 8 to 10 LV copies/cell for sample C.

Sample D (18/144) was produced from double LV transduction of sample C (18/132); therefore,

some of the integration sites are expected to be shared by samples C and D. Table 6 shows that

ten identical integration sites were reported by all laboratories and an additional common site

detected by 3 out of 4 laboratories for sample D (18/144), of which seven identical integration

sites were shared by samples C (18/132) and D (18/144). The LV copy numbers per cell for sample

D were reported ranging from 11-13 copies/cell by individual laboratories.

Ampoule gDNA Quantitation

A total of fifteen laboratories evaluated DNA concentrations after reconstituting the samples in

200 L/ampoule nuclease-free water, of which 12 laboratories used a Nanodrop spectrophotometer

and 3 laboratories used a QuBit fluorometer (Table 7). Using QuBit quantitation, the intra-

laboratory GCV values ranged from 2.69-15.14% for all samples tested, with Geometric Mean

values between 5.16 and 5.65 g gDNA/ampoule, which were less than 12% deviation from the

origin-vialling quantity at 5g gDNA /ampoule (Table 8). The gDNA quantity measured using

NanoDrop was 15%-18% greater than that measured using QuBit fluorometer, giving GM values

between 6.25-6.61g /ampoule and intra-laboratory GCV values ranging from 3.13% to 3.53% in

NanoDrop DNA quantitation.

Table 6. Summary of LV integration site analysis

Notes for Table 6: Highlighted in green: shared by all laboratories; in orange: differ among laboratories; in yellow: number of LV

integration sites as reported by individual laboratories; in grey: detected at low level and low confidence; *1: detected at a low level as

reported by the lab; *2: detected at low level <1%.

WHO/BS/2019.2373

Table 7. Ampoule gDNA quantity g/ampoule)

Quantitation using QuBit (gDNA g/ampoule)

Lab

Code AK W AC GM GCV 95% LCL 95% UCL N

A+E 5.03 5.37 5.19 5.19 3.28 4.79 5.63 3

B 5.11 5.92 5.21 5.40 8.37 4.42 6.59 3

C 5.14 6.62 5.24 5.63 15.14 3.96 7.99 3

D 5.00 5.24 5.24 5.16 2.69 4.83 5.51 3

Quantitation using Nanodrop (gDNA g/ampoule)

Lab

Code I AA Y AH S H2R H2P Z Z(IN) AD AA(T) E GM GCV

95%

LCL

95%

UCL N

A+E 5.96 7.94 6.47 6.30 6.56 6.08 6.11 6.27 6.19 6.36 8.92 5.58 6.25 3.13 6.11 6.40 9

B 6.29 8.75 6.68 6.47 7.04 6.45 6.45 6.58 6.60 6.65 8.51 5.71 6.58 3.22 6.42 6.74 9

C 6.35 8.14 6.93 6.58 7.06 6.49 6.49 6.43 6.64 6.57 8.60 5.65 6.61 3.54 6.44 6.79 9

D 6.14 8.39 6.41 6.16 6.75 6.14 6.15 6.16 6.21 6.16 7.22 5.25 6.25 3.27 6.10 6.41 9

Notes for Table 7: Data from Labs AA, AA(T), E (shaded in grey) were excluded due to number of outliers in result. N: number of

laboratories; GM: Geometric Mean; GCV: Geometric Coefficient of Variation (%); LCL: Lower Confidence Limit; UCL: Upper

Confidence Limit.

Discussion

The collaborative study (CS633) was designed to seek absolute quantitation of LV integration

copy number and integration sites from 31 laboratories across 13 countries using four proposed

methods, i.e. TaqMan qPCR, SYBRGreen qPCR, digital PCR or sequencing-based methods, in

order to derive a consensus value i.e. LV integration copy number per cell, for four candidate

genomic DNA materials coded A/E (18/142), B (18/126), C (18/132) and D (18/144).

As is normal practice for WHO collaborative studies, participating laboratories were asked to

provide raw data, i.e. Ct values from qPCR and droplet counts from ddPCR, so that a common

analysis approach could be applied to the data from different laboratories, allowing them to be

compared to each other. Applying the global analysis showed that most data sets (38/46) from 24

out of 30 laboratories using qPCR gave valid estimates, indicating the study data were of high

quality, even with stringent validity parameters applied.

Combining the data from all valid qPCR (n=38) gave consensus robust geometric mean LV copies

per cell of 0 for sample A/E (18/142), 1.42 for sample B (18/126), 8.76 for sample C (18/132) and

10.67 for sample D (18/144). The inter-laboratory GCVs ranged from 14.9% for sample B (18/126)

to 20.2% for sample C (18/132). The large disagreement between some laboratories performing

simplex and multiplex digital PCR data and their disagreement with qPCR data resulted in only

the qPCR data being used to assign a consensus value for individual samples.

The use of sample C (18/132) to generate a genomic DNA standard curve for LV copy quantitation

by qPCR reduced the inter-laboratory variability in estimates obtained for the other panel samples

B and D, demonstrating the power of a common reference standard in harmonizing study results

across methods and laboratories. The advantages of using sample C as genomic DNA reference

standard include minimizing the potential variations being introduced from using varied individual

laboratories’ plasmid DNA standards.

It is noteworthy that the difference in the reported data between one laboratory and another can be

as great as ~2-fold for the same sample. For example, the reported value for the same sample D

was 6.15 copies/cell from one laboratory and 13.61 from another laboratory, highlighting intrinsic

issues in PCR quantitation and the importance of using well characterized reference materials for

LV integration copy number quantitation.

Over 70% of all reported integration sites for individual samples were confidently detected and

shared by all laboratories using four different sequencing-based methods, that is 2/2 detected sites

for sample B (18/126), 7/10 for sample C (18/132) and 10/13 for sample D (18/144). As the

genomic DNA were produced from single cell clones, this provides supporting evidence that the

reported LV copies from integration site analysis represent LV copies per cell.

It is important to note that the reported numbers of LV integration sites obtained from different

sequencing-based analyses are in good agreement with the values obtained from PCR quantitation,

that is, a consensus value of 2 LV integration sites vs PCR robust GM of 1.42 LV copies/cell for

18/126, a consensus value of 8 integration sites vs PCR robust GM 8.76 for 18/131 and a consensus

WHO/BS/2019.2373

value of 10 integration sites vs PCR robust GM 10.67 LV copies/cells for 18/144, demonstrating

the robustness of the value assignment for individual materials.

The collaborative study results highlighted that there exists disagreement between simplex and

multiplex digital PCR data and their disagreement with qPCR data, resulting in only qPCR data

being used to assign a consensus value for individual samples. As shown in Appendix XII, only

2/43 publications used ddPCR in LV quantitation, indicating that qPCR is still the most common

method used in LV copy quantitation. Nevertheless, the use of the qPCR assigned consensus value

of 18/132 as a common standard reduced the inter-laboratory variability in LV quantitation for

18/126 and 18/144 across data from qPCR and ddPCR methods, demonstrating the power of an

International Standard in harmonizing study results across methods and laboratories. It is

noteworthy that the consensus values for individual laboratories were derived not only results from

using NIBSC plasmid standards and study protocols, but also from diverse formats of calculation

standards including individual laboratories’ plasmid DNA or genomic DNA based on copy

numbers or DNA mass, and individual PCR primer target sequences, providing the confidence in

robustness of consensus values obtained in the study. It is also important to note that the results

obtained from PCR and sequencing based methods are in good agreement, demonstrating the

robustness of the value assignment for individual candidate materials.

International reference reagents are intended to be long-lasting, stable preparations suitable for

global distribution, thus formulation and process development was optimized to fulfil this

requirement whilst preserving bioactivity required for the standard’s intended use. Stability studies

over 8 months indicated that the candidate preparations are stable for long term storage at -20˚C.

These standards are to be presented as a panel (coded 19/158) of three materials (individually

coded as 18/126, 18/132 and 18/142). The high copy number standard 18/132 is for end-users to

generate a genomic DNA standard curve using 18/142 as the diluent, with 18/126 used as a

positive control (in order to confirm comparable LV copies/cell to the consensus value for the

sample 18/126 to validate the assay for unknown sample quantitation). The advantages of using

sample 18/132 as a genomic DNA reference standard include minimizing the potential variations

introduced from using varied individual laboratories’ plasmid DNA standards. The WHO 1st

Reference panel will primarily be used for the validation of internal in-house standards used in

different laboratories and will be applicable to a wide range of DNA and sequencing based

detection methods– a major step forward in obtaining reliable and reproducible data on insertional

mutagenesis, the assessment of which is a major point of interest for regulatory authorities.

End-users will be referred to the WHO ECBS report (via the Instructions for Use, Appendix X)

for further details of this data analysis. All (raw) data are stored at NIBSC and are available on

request to WHO (Secretary, Expert Committee on Biological Standardization) for a period of at

least 20 years, or longer if the standard is still in use.

Data from this study indicates that the introduction of the first International Reference panel

(19/158) will be an important tool for the inter-laboratory harmonization of lentiviral vector

quantitation in LV based gene therapy products. The availability of the LV integration Reference

panel (19/158) should improve the quality, confidence and comparability in LV integration

analysis.

WHO/BS/2019.2373

Proposal to WHO

Based on the results of the multi-centre collaborative study and the combined qPCR quantitation,

it is proposed that the panel of three genomic DNA preparations, i.e. 18/142 (sample A/E), 18/126

(sample B) and 18/132 (sample C), is established as the WHO 1st International Reference panel

(19/158) for the quantitation of lentiviral vector copy number in cells, with assigned values of 0

LV copies/cell for 18/142, 1.42 LV copies/cell for 18/126 (95% CI: 1.37 – 1.48; k=2.03) and 8.76

LV copies/cell for 18/132 (95% CI: 8.26 – 9.29; k=2.03), to be used in PCR based quantitation

methods. It is recommended for future end-users to make serial dilutions of sample C (18/132) in

the presence of sample A/E (18/142) to produce a genomic DNA standard curve for the estimation

of LV copy numbers/cell in unknown samples. It is also recommended the end-users to use 18/142

as a negative control and 18/126 as a positive control (robust GM 1.42 LV copies/cell) in order to

validate the assay for unknown sample LV copy number quantitation.

It is also proposed to WHO ECBS for sample D (18/144) to be established as a stand-alone

qualitative reference reagent for the integration site analysis, with ten defined integration sites, that

is, AGPAT3 (at chromosome 21), NUDT3 (Chr. 6), SEMA3F-AS1 (Chr. 3), GRID2 (Chr. 4),

ADAM9 (Chr. 8), R3HDM2 (Chr. 12), CBWD1 (Chr. 9), FOXP2 (Chr. 7), ENTHD1 (Chr. 22)

and SMYD4 (Chr. 17), as highlighted in green in Table 6, to validate end-users’ integration-site

study protocols.

WHO/BS/2019.2373

Comments from the Participants on the Draft Report

Significant comments and NIBSC responses

Lab 1

This lab disagreed to all the proposals made to WHO, i.e. consensus values, a panel of 3 standards

and RM for integration site analysis.

Comments: It appears that sample B is the only sample, which has two copies per cell, that was

confirmed by integration site analysis from 4 different labs. And based on the standard developed

in our company, which have one copy number per cell determined by integration site analysis, we

have determined that sample B have two copies per cells. Thus, we would suggest that sample B

to be the standard for VCN, while sample C and D will need to be further evaluated since the

integration site analysis results contradicted from different labs. Before the precise number was

determined for sample C and D, they are not good for either copy number or integration site

analysis references.

Response: This study shows that both PCR and integration site analysis methodologies have an

inherent high-variation tendency, it is unrealistic, at the current time, to expect 100% data match

from qPCR and sequencing-based methods. The high variation tendency makes WHO standards

more valuable in harmonizing data and data presentation across laboratories.

Lab 2

This lab agreed to all proposals to WHO.

Comments: The WHO Collaborative Study to establish a Lentiviral integration standard is an

excellent idea to serve a rapidly expanding and exciting market. However, we believe that the

reliance on qPCR to determine copy number is flawed as this study demonstrates the tendency of

this technology to produce very high variance and has several drawbacks that render it less accurate

and precise when compared to newer ddPCR technology. As shown in this study, the ddPCR data

is very consistent across and within labs, and the geometric mean (GM) is close to the qPCR data

in most cases. The results are excluded without sufficient explanation, and the qPCR results are

used to generate the standard values regardless of the drawbacks. We acknowledge that few labs

were able to conduct this study with ddPCR, leading to a less robust dataset relative to qPCR.

However, the ddPCR data should not be compared to qPCR data and discarded simply because it

does not match. We request that a discussion on the ddPCR results be included in the report. We

additionally suggest that additional statistical modeling, beyond geometric means, be used to

analyze to compare the different means.

Response: We acknowledge the limitation in current qPCR and ddPCR methods. We received 46

sets of data for qPCR, but only 5 sets of data for multiplex ddPCR, indicating that qPCR is, at the

present time, still a common method and widely used in DNA quantitation. 5 sets of multiplex

ddPCR data is rather small in representing a true consensus.

We propose to re-evaluate these standards at a later stage when ddPCR becomes more widely used

and more participants are able to perform ddPCR.

WHO/BS/2019.2373

Other comments: Why do simplex ddPCR at all? The lab P ddPCR undigested data should be

excluded as CN by ddPCR requires restriction digestion.

Response: We do not have enough experience or data to support exclusion of this procedure and

exclusion. The simplex ddPCR results have not been used in determining consensus values and

have been presented for information and discussion in this report.

Lab 3

This lab agreed to establish A, B and C as a standard panel and D as integration site analysis

Reference Reagents, but disagreed with the consensus values, due to changes to some data

reported.

Response: All consensus values have been recalculated to reflect the changes in some of the

reported data in the final report.

Comments: For establishing an international standard, the use of aneuploid target cell line may not

be the preferred choice, as we may expect instability of the genotype upon serial passage eventually

affecting the VCN determination. Even we independently determine and monitor the actual ploidy

of the reference gene there is no warranty that the obtained value applies to the whole genome,

thus providing a potential confounding factor for the determination. Thus, the use of a human cell

line with euploid genome would be preferable (many such T cell lines are available).

Response: The genetic stability of target cells has been discussed in the Introduction of this report.

Furthermore, unless we used primary cells, there will be no true diploid cell line unless we

characterize individual cells before extracting the DNA. This is because the number of cells and

the ‘purity of LV/cell clones’ we need for the standard production require a significant

amplification of the cells. Even primary cells let alone a T cell line, after such cell expansion and

multiple round of single cell cloning if possible, the euploidy nature of the cells would not sustain

unless proved by individual cell characterization.

We appreciate the comments and recognize the limitation in current standard. We considered that

gene therapy is a fast-evolving field, it is envisaged a rapid evolving in standard development as

well; therefore. we are prepared to develop a T cell line-based standard if there is the need from

the community and a fully characterized diploid T cell lines become attainable by us in the future.

Lab 4

This lab agreed to all proposals.

Comments: Suggest to include confidence intervals and list the HUGO approved names of the 10

genes in the proposal section. Unclear to me in which tables dilutions of C were used as a standard

and in which tables the laboratories estimates of copy numbers per cell were used

Response: Both confidence intervals and gene names are added in the final report. A new table

showing VCN from using C as standard has now been included as Appendix II in the final report.

WHO/BS/2019.2373

Lab 5

This lab agreed to use samples A/E, B and C as reference standard and Sample D as RM for

integration site analysis, disagreed to the consensus values

Comment 1: Would like to see these consensus values rather as a range reflecting the results of

this study.

Response: We have added the confidence interval to individual consensus values.

Comment 2: It would also be interesting for us to see what was the difference observed across

laboratories that analysed these samples following NIBSC or in-house qPCR protocols.

Response: The plot below shows the results split according to the protocol followed. No

statistically significant differences between the results obtained using the different protocols

(NIBSC or in-house) was observed.

Comment 3: With regards to vector integration site data: table 6 shows vector integration results

from four laboratories. Both integrations for sample A are consistently reported. Clone C and D

show some differences, indicated in orange in the table. Laboratory Y reports an integration in the

NPW transcript, while the other laboratories report integrations near ZNF598. These genes are

located next to each other on chromosome 16. This highlights and issue with annotation of vector

integration sites. Depending on the reference genome and annotation files used, slight variations

between methods of annotations might give conflicting results. Clarity on the version of the

WHO/BS/2019.2373

genome and annotation files used is necessary and some uncertainty can be avoided by reporting

the chromosome and location of the integration site rather than the nearest gene.

Responses: both the chromosome and gene locations of sample D integration sites are provided to

end-users as a reference.

Lab 6

This lab was unable to support the proposed consensus values as the estimates obtained by their

laboratory were lower, but they agreed to the panel A, B, C being established as WHO Reference

panel for quantitation and D as RM for integration site analysis.

Comment: It’s difficult to agree with this proposed unitage because we obtained lower LV copies

per cell in this study.

Lab 7

This lab agreed to all proposals.

Comments: We agree with the proposal for sample D (18/144) to be used as international reference

material in LV integration site analysis, as a positive control. In line with authority agencies

requirement, the quantitative measurement of each clone, which is represented by the composition

of individual integration sites in a bulk population, should be also described in detail.

Response: Not all labs reported the abundance (%) for each IS. Also, the % abundance for a given

IS, if reported, varied between labs. At moment, only 4 labs were able to report data for integration

sites, we considered it is difficult to extrapolate too much information from the rather small data

set at moment. Therefore, we propose to use Sample D as a positive control for time being. This

can be changed if we have more data.

Acknowledgements

We would like to thank Professor Didier Trono (EPFL, Lausanne) for his donation of the Lentiviral

plasmids to make the project possible. We gratefully acknowledge the significant contributions of

all participants to the collaborative study. We would also like to thank Drs. Pia Sanzone, Robin

Thorpe, Jennifer Boyle, Chris Bird, Chris Burns, Jackie Ferguson, Clive Metcalfe, Paul Stickings,

Clare Morris, Mary Collins, Ross Hawkins, Jack Price and Malcolm Hawkins for invaluable

discussions. Thanks to Drs. Hannah Stepto, Anna Nowocin, Paul Matejtschuk and the Standards

Processing Division at NIBSC for their contributions to the development and processing of the

materials. This project is funded by UK Department of Health.

List of Appendices

Appendix I: Individual laboratory estimates of LV copies per cell using individual laboratories’

standard

WHO/BS/2019.2373

Appendix II: Individual laboratory estimates of LV copies per cell calculated using sample C as

reference standard

Appendix III: Example of using sample C as a genomic DNA calculation standard

Appendix IV: Bulk materials and production

Appendix V: Accelerated degradation and stability studies

Appendix VI: Instructions for Use (IFU) sent to participants for the collaborative study

Appendix VII: Example qPCR protocols for the collaborative study

Appendix VIII: Example digital PCR protocol for the collaborative study

Appendix IX: Response form on the draft report sent to participants

Appendix X: Instruction for Use (IFU) for the to be established Reference panel

Appendix XI: NIBSC Publication

Appendix XII: relevant publications (2019-2000) on LV copy quantitation

Appendix XIII: References

WHO/BS/2019.2373

Appendix I

Individual laboratory estimates of LV copies per cell

calculated using individual laboratories’ standards

Method Lab Test A+E B C C1 C2 C3 C4 D

MS L 1 0.03 1.56 10.36 2.73 0.91 0.32 0.13 13.06

MS L 2 0.04 1.27 7.34 2.16 0.70 0.26 0.11 9.73

MS L 3 0.05 1.32 7.84 2.24 0.78 0.27 0.13 n/a

MS T 1 0.00 1.37 7.41 2.44 0.86 0.29 0.11 9.52

MS T 2 0.00 1.37 8.52 2.21 0.74 0.29 0.10 9.13

MS T 3 0.00 1.45 9.11 2.80 0.84 0.28 0.10 8.36

MS X 1 LV standard r2<0.98

MS X 2 LV standard r2<0.98

MS X 3 0.00 1.58 10.00 3.21 1.03 0.39 0.23 11.05

MS J 1 0.14 1.75 7.70 2.71 1.07 0.48 0.33 8.91

MS J 2 0.18 1.47 7.49 2.28 0.84 0.40 0.25 7.24

MS J 3 0.17 1.24 5.08 1.68 0.68 0.35 0.26 6.94

MS B 1 0.00 1.81 10.51 5.35 1.17 0.32 0.12 11.82

MS B 2 0.00 1.49 10.51 2.44 0.79 0.27 0.10 9.14

MS B 3 0.00 1.77 12.24 3.57 1.18 0.33 0.14 5.27

MS AH 1 0.21 1.81 8.09 2.60 1.02 0.51 0.31 9.42

MS AH 2 0.11 1.51 6.46 2.80 0.64 0.24 0.16 9.78

MS AH 3 0.19 1.54 7.88 2.31 0.86 0.46 0.28 9.35

MS S 1 0.00 1.79 14.32 3.36 1.46 0.42 0.21 12.03

MS S 2 0.00 1.90 10.00 4.17 1.61 0.45 0.22 12.69

MS S 3 0.00 2.05 11.28 3.96 1.18 0.41 0.12 16.51

MS H2R 1 C slope < 0.80



MS H2P 1 C slope < 0.80

MS H2P 2 HK standard r2<0.98

MS H2P 3 HK standard r2<0.98

MS Z 1 0.01 1.39 11.92 3.26 1.12 0.40 0.14 14.10

MS Z 2 0.01 1.32 10.36 3.33 1.09 0.40 0.13 12.51

MS Z 3 0.01 1.28 10.70 3.20 1.18 0.44 0.17 4.62

MS M 1 0.46 0.97 27.58 3.19 1.00 0.55 0.43 64.50

MS M 2 0.26 1.56 7.90 2.45 1.00 0.45 0.22 9.82

MS M 3 0.17 1.53 7.93 2.63 0.97 0.43 0.26 9.63

MS AK 1 LV standard r2<0.98

MS AK 2 0.01 1.56 11.92 3.14 0.95 0.30 0.11 13.35

WHO/BS/2019.2373

MS AK 3 0.01 1.43 11.08 2.98 1.05 0.35 0.11 13.06

MS U 1 0.24 1.83 7.80 2.21 0.90 0.41 0.26 6.75

MS U 2 0.13 1.35 6.58 2.06 0.73 0.33 0.22 9.36

MS U 3 0.18 1.35 7.46 1.97 0.78 0.33 0.20 10.18

MS C 1 0.00 1.58 9.41 2.97 0.99 0.35 0.12 11.64

MS C 2 0.00 1.57 8.13 2.40 0.84 0.28 0.10 11.16

MS C 3 0.00 1.59 9.35 2.85 0.93 0.32 0.10 11.82

MS Z (IH) 1 0.00 1.53 9.05 3.52 1.25 0.44 0.15 11.22

MS Z (IH) 2 0.00 1.58 8.68 3.24 1.09 0.39 0.13 9.92

MS Z (IH) 3 0.00 1.59 9.04 3.19 1.10 0.41 0.15 11.13

MT AD 1 C slope C slope < 0.80



MT H 1 n/a 1.57 7.73 2.52 0.93 0.35 0.11 10.22

MT H 2 n/a 1.37 5.70 2.30 0.93 0.41 0.13 6.86

MT H 3 n/a 1.24 6.75 2.18 0.78 0.31 0.11 8.85

MT I 1 n/a 1.58 8.67 2.23 0.73 0.27 0.09 11.85

MT I 2 n/a 1.56 8.78 2.28 0.77 0.27 0.10 12.10

MT I 3 n/a 1.50 8.85 2.42 0.76 0.28 0.10 11.94

MT L 1 n/a 1.50 12.28 3.00 1.01 0.37 0.11 14.83

MT L 2 n/a 1.18 9.40 2.56 0.82 0.25 0.09 11.40

MT L 3 n/a 1.11 7.02 1.89 0.55 0.09 0.00 n/a

MT T 1 0.00 1.33 7.69 2.55 0.93 0.46 0.19 11.88

MT T 2 HK standard r2<0.98

MT T 3 0.00 1.68 8.75 2.56 1.00 0.45 0.16 11.73

MT AE 1 n/a 1.48 8.87 2.76 0.89 0.30 0.11 10.91

MT AE 2 n/a 1.41 8.84 2.56 0.91 0.31 0.12 12.62

MT AE 3 n/a 1.37 8.91 2.53 0.88 0.28 0.10 11.46

MT AA 1 0.00 1.57 9.11 2.74 0.90 0.30 0.10 9.87

MT AA 2 n/a 1.47 9.63 2.67 0.87 0.32 0.11 9.15

MT AA 3 n/a 1.49 9.70 2.99 0.98 0.34 0.11 10.06

MT Q 1 0.00 1.77 9.33 3.32 1.09 0.35 0.11 11.83

MT Q 2 0.00 1.91 11.33 3.73 1.20 0.34 0.11 12.50

MT Q 3 0.00 2.15 13.01 4.19 1.34 0.42 0.13 15.45

MT P 1 n/a 1.95 9.58 3.68 1.28 0.43 0.16 11.32

MT P 2 n/a 1.86 8.42 3.09 1.23 0.37 0.13 11.16

MT P 3 n/a 1.73 9.94 3.28 1.05 0.33 0.12 9.31

MT D 1 n/a 1.23 8.56 2.51 0.82 0.29 0.12 10.10

MT D 2 n/a 1.31 9.59 2.86 0.88 0.33 0.11 12.16

MT D 3 n/a 1.22 8.92 2.45 0.80 0.27 0.11 10.58

MT J 1 C slope < 0.80



MT B 1 n/a 1.37 8.83 2.46 1.00 0.32 0.14 7.97

WHO/BS/2019.2373

MT B 2 n/a 1.41 9.21 2.61 1.19 0.42 0.12 10.25

MT B 3 n/a 1.40 10.42 2.94 0.85 0.25 0.14 12.06

MT AH 1 C slope < 0.80



MT S 1 0.00 1.70 8.75 2.58 0.77 0.31 0.11 10.66

MT S 2 0.00 1.29 5.73 2.71 0.73 0.32 0.12 9.42

MT S 3 n/a 1.08 5.86 1.96 0.85 0.19 0.07 9.99

MT M 1 n/a 1.38 9.00 2.52 0.81 0.29 0.10 12.16

MT M 2 LV standard r2<0.98

MT M 3 n/a 1.27 8.17 2.20 0.73 0.25 0.09 11.25

MT Z 1 n/a 1.44 10.30 2.97 0.97 0.36 0.12 12.90

MT Z 2 n/a 1.43 9.14 2.93 1.00 0.33 0.12 12.69

MT Z 3 n/a 1.58 10.44 2.96 1.06 0.41 0.15 13.18

MT AI 1 n/a 1.29 9.00 2.56 0.84 0.28 0.10 11.58

MT AI 2 n/a 1.41 10.27 2.78 0.84 0.29 0.10 12.41

MT AI 3 n/a 1.30 8.86 2.51 0.79 0.27 0.09 11.15

MT W 1 n/a 1.31 9.18 2.56 0.84 0.26 0.10 10.12

MT W 2 n/a 1.26 9.32 2.89 0.84 0.31 0.10 11.44

MT W 3 n/a 1.23 10.94 2.91 0.94 0.30 0.09 13.26

MT AC 1 n/a 1.63 9.38 2.99 1.04 0.36 0.14 11.97

MT AC 2 n/a 1.38 7.55 2.46 0.85 0.31 0.12 9.44

MT AC 3 n/a 1.19 6.49 2.13 0.72 0.26 0.09 8.40

MT F 1 n/a 1.61 8.21 2.40 0.77 0.29 0.10 13.33

MT F 2 n/a 1.07 6.32 2.46 0.71 0.20 0.06 11.96

MT F 3 n/a 1.24 8.97 2.91 0.92 0.25 0.09 13.63

MT AK 1 LV & HK standards r2<0.98

MT AK 2 n/a 1.43 8.62 2.64 0.84 0.29 0.04 8.58

MT AK 3 0.01 1.25 7.63 2.10 0.73 0.29 0.04 10.19

MT U 1 n/a 0.91 4.64 1.42 0.43 0.14 0.03 6.07

MT U 2 n/a 0.81 4.30 1.34 0.42 0.14 0.03 5.90

MT U 3 n/a 1.11 5.77 1.78 0.59 0.19 0.03 6.48

MT C 1 n/a 1.46 9.95 2.86 0.93 0.30 0.09 11.66

MT C 2 n/a 1.26 8.99 2.89 0.85 0.28 0.11 12.70

MT C 3 n/a 1.32 9.99 2.70 0.80 0.29 0.07 10.71

MT N 1 n/a 1.21 8.42 2.34 0.78 0.26 0.09 10.47

MT N 2 n/a 1.29 8.25 2.34 0.70 0.23 0.08 10.97

MT N 3 n/a 1.54 8.82 2.80 0.85 0.29 0.10 11.10

MT Y 1 0.00 1.37 11.37 3.19 1.00 0.30 0.11 13.93

MT Y 2 0.00 1.12 9.49 2.75 0.83 0.31 0.10 12.19

MT Y 3 0.00 1.19 9.62 2.67 0.84 0.28 0.09 11.82

MT E 1 n/a 1.18 8.46 2.43 0.75 0.23 0.07 11.02

MT E 2 n/a 1.09 7.27 1.94 0.59 0.19 0.07 8.82

MT E 3 n/a 1.13 7.37 2.04 0.69 0.22 0.08 9.07

WHO/BS/2019.2373

MT Z (IH) 1 n/a 1.75 6.22 2.68 1.08 0.39 0.14 7.10

MT Z (IH) 2 n/a 1.50 5.94 2.59 1.00 0.34 0.11 7.39

MT Z (IH) 3 n/a 1.69 6.47 2.70 1.03 0.35 0.11 8.21

MT AF(IH) 1

Low PCR efficiency MT AF(IH) 2

MT AF(IH) 3

MT AF 1 n/a 1.46 9.83 2.77 1.11 0.26 0.07 12.85

MT AF 2 n/a 1.51 9.82 2.82 1.12 0.26 0.07 12.20

MT AB 1 n/a 0.21 1.94 0.64 0.25 0.10 0.02 5.67

MT AB 2 HK standard r2<0.98

MT O 1 n/a 1.33 10.49 2.72 0.82 0.22 0.04 11.40

MT O 2 n/a 1.34 9.28 2.68 0.85 0.23 0.04 10.50

MT O 3 n/a 1.30 9.35 2.75 0.89 0.25 0.04 10.81

MD (Simplex) I 1 0.00 1.41 11.30 13.79

MD (Simplex) I 2 0.00 1.43 11.27 13.48

MD (Simplex) I 3 0.00 1.34 10.94 13.57

MD (Simplex) L (IH) 1 0.05 1.42 11.19 14.69

MD (Simplex) L (IH) 2 0.12 1.49 10.87 15.25

MD (Simplex) L (IH) 3 0.06 1.43 10.77 12.78

MD (Simplex) L (NIBSC) 1 0.06 1.48 10.78 13.00



MD (Simplex) AA 1 0.04 1.44 10.32 12.77

MD (Simplex) AA 2 0.08 1.33 9.21 11.73

MD (Simplex) AA 3 0.01 1.34 9.80 11.81

MD (Simplex) J 1 0.00 1.47 11.18 13.55

MD (Simplex) J 2 0.01 1.27 12.82 14.51

MD (Simplex) J 3 0.03 1.60 10.87 13.79

MD (Simplex) M 1 0.00 1.44 10.44 14.56

MD (Simplex) M 2 0.00 1.39 11.08 13.77

MD (Simplex) M 3 0.00 1.49 11.05 13.87

MD (Simplex) N 1 0.00 1.45 11.25 13.73

MD (Simplex) N 2 0.00 1.42 11.00 13.25

MD (Simplex) N 3 0.00 1.45 11.52 13.50

MD (Simplex) AK 1 0.10 1.36 10.94 9.03

MD (Simplex) AK 2 0.12 1.53 10.37 13.39

MD (Simplex) AK 3 0.09 1.46 10.27 13.04

MD (Simplex) Y 1 0.01 1.36 10.60 14.54

MD (Simplex) Y 2 0.01 1.42 11.07 14.72

MD (Simplex) Y 3 0.01 1.39 10.85 13.53

MD (Multiplex) AE 1 0.00 1.32 7.37 8.97

MD (Multiplex) AE 2 0.00 1.36 7.23 8.68

MD (Multiplex) AE 3 0.00 1.33 7.19 8.98

MD (Multiplex) P 1 0.00 1.91 11.66 13.61

WHO/BS/2019.2373

MD (Multiplex) P 2 0.00 1.76 10.1 11.7

MD (Multiplex) P 3 0.00 2.08 11.7 13.49

MD (Multiplex) P (undigested) 1 0.00 1.61 11.1 12.59



MD (Multiplex) V 1 0.00 1.40 7.38 8.94

MD (Multiplex) V 2 0.00 1.38 7.36 9.22

MD (Multiplex) V 3 0.00 1.40 7.58 8.92

MD (Multiplex) N 1 0.00 1.22 6.49 8.07

MD (Multiplex) N 2 0.00 1.26 6.63 8.32

MD (Multiplex) N 3 0.00 1.23 6.49 8.14

Notes for Appendix I: methods MD=digital PCR, MS=SYBRGreen qPCR, MT=TaqMan qPCR.

WHO/BS/2019.2373

Appendix II

Individual laboratory estimates of LV copies per cell

calculated using sample C (robust GM 8.76)

as a genomic DNA calculation standard

Method Lab Test B D

MS L 1 1.57 11.83

MS L 2 1.64 12.27

MS L 3 1.62 n/a

MS T 1 1.60 11.40

MS T 2 1.64 10.39

MS T 3 1.57 8.18

MS J 1 1.64 11.14

MS J 2 1.61 9.49

MS J 3 1.78 14.62

MS B 1 1.46 8.16

MS B 2 1.66 8.54

MS B 3 1.49 4.04

MS AH 1 1.69 11.94

MS AH 2 1.97 11.99

MS AH 3 1.58 12.67

MS S 1 1.30 8.17

MS S 2 1.36 10.26

MS S 3 1.62 12.56

MS Z 1 1.16 11.14

MS Z 2 1.13 10.90

MS Z 3 1.03 3.92

MS M 1 n/a n/a

MS M 2 1.52 12.69

MS M 3 1.49 11.76

MS AK 1 n/a n/a

MS AK 2 1.49 10.13

MS AK 3 1.32 10.95

MS U 1 1.97 8.63

MS U 2 1.69 14.24

MS U 3 1.64 14.04

MS C 1 1.54 11.14

MS C 2 1.77 12.51

MS C 3 1.62 11.39

MS Z (IH) 1 1.23 10.77

MS Z (IH) 2 1.42 9.92

MS Z (IH) 3 1.40 11.03

WHO/BS/2019.2373

MT H 1 1.68 12.29

MT H 2 1.52 11.25

MT H 3 1.51 12.39

MT I 1 1.90 12.89

MT I 2 1.83 12.94

MT I 3 1.73 12.50

MT L 1 1.34 11.64

MT L 2 1.37 10.86

MT L 3 1.98 n/a

MT T 1 1.27 15.96

MT T 2 n/a n/a

MT T 3 1.58 13.81

MT AE 1 1.57 10.94

MT AE 2 1.50 13.19

MT AE 3 1.51 11.63

MT AA 1 1.65 9.72

MT AA 2 1.53 8.93

MT AA 3 1.43 9.32

MT Q 1 1.61 10.81

MT Q 2 1.59 9.35

MT Q 3 1.55 10.23

MT P 1 1.56 10.08

MT P 2 1.68 11.40

MT P 3 1.59 18.30

MT D 1 1.39 10.82

MT D 2 1.33 11.52

MT D 3 1.42 10.86

MT B 1 1.42 8.47

MT B 2 1.25 10.91

MT B 3 1.51 10.01

MT S 1 1.87 11.37

MT S 2 1.57 14.09

MT S 3 1.56 14.12

MT M 1 1.54 12.41

MT M 2 n/a n/a

MT M 3 1.59 12.76

MT Z 1 1.35 11.62

MT Z 2 1.40 12.30

MT Z 3 1.39 12.12

MT AI 1 1.43 11.68

MT AI 2 1.48 10.98

MT AI 3 1.50 11.32

MT W 1 1.48 9.93

MT W 2 1.33 10.91

WHO/BS/2019.2373

MT W 3 1.25 10.93

MT AC 1 1.53 11.53

MT AC 2 1.56 11.40

MT AC 3 1.58 11.62

MT F 1 1.86 14.93

MT F 2 1.48 14.83

MT F 3 1.36 12.50

MT AK 1 n/a n/a

MT AK 2 1.59 8.96

MT AK 3 1.56 12.95

MT U 1 1.91 11.39

MT U 2 1.79 12.06

MT U 3 1.82 9.91

MT C 1 1.48 10.56

MT C 2 1.36 12.03

MT C 3 1.43 9.91

MT N 1 1.46 11.40

MT N 2 1.64 11.82

MT N 3 1.66 11.06

MT Y 1 0.34 16.15

MT Y 2 1.19 11.75

MT Y 3 1.30 11.10

MT E 1 1.45 11.42

MT E 2 1.63 10.97

MT E 3 1.55 11.20

MT Z (IH) 1 1.83 9.80

MT Z (IH) 2 1.67 10.52

MT Z (IH) 3 1.81 10.90

MT AF 1 1.49 11.19

MT AF 2 1.55 11.68

MT O 1 1.50 9.55

MT O 2 1.53 9.70

MT O 3 1.43 10.04

Notes for Appendix II: methods MS=SYBRGreen qPCR, MT=TaqMan qPCR. Reference to

Appendix III for an example calculation.

WHO/BS/2019.2373

Appendix III

Example of using sample C (robust GM 8.76)

as a genomic DNA calculation standard

Sample C data:

Sample Dilution Log10 copies/cell Ct (LV) Ct (HK) Ct difference

C - 0.943 22.263 24.953 -2.690

C 1:3 0.465 24.008 24.774 -0.766

C 1:9 -0.012 25.726 24.668 1.058

C 1:27 -0.489 27.489 24.643 2.846

Slope -3.863

Intercept 0.989

r2

>0.999

Unknown sample data:

Sample Ct (LV) Ct (HK) Ct difference

Estimated log10

copies/cell*

Estimated

copies/cell

B 24.789 24.423 0.366 0.161 1.45

*Estimate = (0.366 - 0.989) / (-3.863)

WHO/BS/2019.2373

Appendix IV

Bulk Material and Processing

The bulk candidate materials, i.e. A/E (NIBSC_18/142), B (18/126), C (18/132) and D (18/144),

were purified human genomic DNA in buffer containing 2.0 mM Tris, 0.2 mM EDTA and 5

mg/mL D-(+)-trehalose dehydrate (Sigma-Aldrich, St. Louis, MO, USA). They were produced at

NIBSC using four lentiviral packaging plasmids pMD2.G, pRSVRev, pMDLg/pRRE and

pRRLSIN.cppt.PGK-GFP.WPRE that were kindly donated by Professor Didier Trono (EPFL,

Lausanne) to produce the 3rd generation of lentiviral vector particles. The reason to select the 3rd

generation of lentiviral vector to produce the WHO 1st International Reference panel (19/158) is

because a homologous sequence, as highlighted in yellow in Figure 2, is shared by all three

generations of LV vectors and has been confirmed in our previous study to be suitable for LV

integration analysis in 18 different LV vectors across three generations of LV vectors10. The

biologically indispensable nature of this homologous sequence for lentiviral packaging and

production also means that the proposed WHO LV standards will stand the test of time and will

be applicable to future generations of lentiviral vector development.

Figure 2. LV indispensable homologous sequence

The production HEK293T cells (NIBSC_000617) were transduced with the lentiviral vectors at

various multiplicities of infection (MOI). A panel of LV-transduced single cell clones were

established and characterized for integration copy number using qPCR. Final four candidate cell

WHO/BS/2019.2373

lines containing 0 or various copies of lentiviral vector integration were subjected to a further 2-3

rounds of single cell sorting to ensure the homogeneity of the cell populations before being used

to produce bulk candidate genomic DNA, as detailed in Figure 3.

Figure 3. Summary of production process for candidate materials

Master cell banks were established from the selected single cell clones to ensure a continual future

cell supply for replacement standards. Master and working cell banks were tested and found

negative for HIV1, HTLV1, Hepatitis B, CMV and Hepatitis C by PCR. Large-scale cell

WHO/BS/2019.2373

production was carried out and genomic DNA was extracted from the LV transduced cells using

Gentra Puregene chemistry with a Gentra Autopure LS robot (Qiagen, Manchester, UK). The DNA

extraction process involved RNAse treatment, protein denaturation, protein removal, and 70%

ethanol washing. The use of 70% ethanol is an established method for viral inactivation11. Each of

the bulk gDNA materials was prepared at approximately 10 μg/mL DNA concentration in 2.0 mM

Tris, 0.2 mM EDTA, with 5 mg/mL D-(+)-trehalose dehydrate (Sigma-Aldrich, St. Louis, MO,

USA) before ampouling.

The concentration of the Albumin gene (ALB) in individual candidate materials (A, B, C and D)

was determined and monitored through the one years of development process by qPCR comparison

with MRC-5 DNA as a reference, which is expected to be diploid. In particular, equal amount of

genomic DNA extracted from MRC-5 cells and individual candidate materials were quantified

simultaneously, in order to derive the ratio of Albumin copy numbers of individual candidate

materials to MRC-5 in equal amount of gDNA. Specifically, Table 8 in Appendix IV shows that

copy numbers of 2.02 (95% CI: 1.92-2.12) were obtained for samples 18/142 (n=13); 2.04 (1.96-

2.12) for sample 18/126 (n=15), 2.03 (1.97-2.10) for 18/132 (n=28) and 1.98 (1.91-2.05) for

18/144 (n=16), indicating that Albumin copy numbers were stable overtime and were comparable

to that of MRC-5, i.e. 2 copies of Albumin genes diploid genome mass in 293T cells. The derivation

in copy numbers for the Albumin gene might result in a non-linear ALB dilution response; however,

it is not expected that this would cause any major measurement deviation.

It should be noted that this characterization does not define the ALB gene copy number in

HEK293T cells; but does determine the number of ALB copies per diploid genome mass of DNA.

This gene copy number enables ALB to be used to normalize DNA input in assays and to generate

LV/ALB copy number ratios. Integration copy numbers per diploid genome mass were calculated

based on the equation: LV copies/6.6pg genomic DNA = (the copy numbers of integrated LV/the

copy numbers of a housekeeping (HK) gene) x HK target sequence copy number per diploid

genome mass; given that an equal mass of the DNA same sample was tested for LV or HK on the

same plate.

Table 8 Quantitation of Albumin gene in candidate materials Reference Candidate Candidate Candidate Candidate MRC-5 18/142 (A) 18/126 (B) 18/132 (C) 18/144 (D)

Test (n=3) ALB

copies/cell

ALB

copies/cell

ALB

copies/cell

ALB

copies/cell

ALB

copies/cell

1 2 2.12 2.15 1.90 1.94

2 2 1.90 1.64 1.65 2.14

3 2 2.13 2.18 1.83 1.92

4 2 2.26 2.11 1.76 1.80

5 2 2.01 2.07 1.72 2.37

6 2 1.90 2.11 1.91 1.94

7 2 1.72 2.13 2.03 1.92

8 2 1.97 2.13 2.08 1.92

9 2 1.81 1.86 2.25 1.96

WHO/BS/2019.2373

10 2 1.90 1.95 1.97 1.97

11 2 2.12 1.92 2.01 1.92

12 2 2.24 2.16 2.16 1.98

13 2 2.12 2.11 2.27 1.92

14 2

2.06 2.35 2.10

15 2

1.96 2.05 1.83

16 2

2.17 2.00

17 2

2.05

18 2

2.27

19 2

2.23

20 2

1.95

21 2

2.03

22 2

2.16

23 2

2.17

24 2

1.98

25 2

1.92

26 2

2.01

27 2

2.05

28 2

2.03

n=13 n=15 n=28 n=16

Mean 2 2.02 2.04 2.03 1.98

SD

0.16 0.16 0.17 0.14

CV%

8.13 7.75 8.54 7.01

The definitive fills were performed on various dates and the four candidate materials were coded

as detailed in Table 2. Aliquots of 0.5 mL were dispensed into 3 mL autoclaved DIN glass

ampoules (Schott, Pont-sur-Yonne, France) using an automated AFV5090 ampoule filling line

(Bausch & Strobel, Ilfshofen, Germany) with the bulk materials continually stirred at a slow rate

using a magnetic stirrer whilst at ambient temperature. The homogeneity of the fill was determined

by on-line check-weighing of the wet weight of triplicate ampoules for every 90 ampoules filled.

The ampoules were partially stoppered with 13 mm Igloo stoppers (West, St Austell, UK) before

the materials were freeze-dried in a CS15 (Serail, Argenteuil, France) to ensure long-term stability:

the ampoules were frozen to -50°C, with primary drying at -35°C, 50 μbar, for 30 hours, followed

by secondary drying at +30°C, 30 μbar, for 40 hours. The vacuum was then released and the

ampoules back-filled using boil-off gas from high purity liquid nitrogen (99.99%), before

stoppering in situ in the dryer and flame sealing of the ampoules.

Measurement of the mean oxygen head space after sealing served as a measure of ampoule

integrity (Table 9). This was measured non-invasively by frequency modulated spectroscopy

(FMS 760, Lighthouse Instruments, Charlottesville, VA, USA), based upon the Near Infra-Red

absorbance by oxygen at 760 nm when excited using a laser. Controls of 0% and 20% oxygen

were tested before samples were analysed to verify the method. Twelve ampoules were tested at

random from each material; oxygen should be less than 1.14%. Residual moisture content was

WHO/BS/2019.2373

measured for the same 12 ampoules per material using the coulorimetric Karl Fischer method in a

dry box environment (Mitsubishi CA100, A1 Envirosciences, Cramlington, UK) with total

moisture expressed as a percentage of the mean dry weight of the ampoule contents. Individual

ampoules were opened in the dry box and reconstituted with approximately 1-3 mL Karl Fischer

analyte reagent which was then injected back into the Karl Fischer reaction cell and the water

present in the sample determined color metrically. Dry weight was determined for six ampoules

per material weighed before and after drying, with the measured water expressed as a percentage

of the dry weight. Residual moisture levels of less than 1% are typically obtained, but where the

dry weight is low (as here) the moisture level can be higher, with the materials still expected to

demonstrate long-term stability (as seen for the similarly prepared WHO 1st International

Reference Panel for Prader Willi & Angelman Syndromes, NIBSC panel code 09/140, which

continues to demonstrate high stability ten years post-manufacture). Ongoing stability is confirmed

by accelerated degradation studies (as detailed in Appendix IV).

Table 9. Production and measurement for gDNA contents and integrity NIBSC Code 18/126 18/132 18/142 18/144

Date Filled 01/06/2018 21/06/2018 28/06/2018 28/06/2018

Mean DNA

concentration upon

filling (µg/mL)

9.97 10.09 10.19 10.24

Mean fill mass (g) 0.5156g 0.5154g 0.5161g 0.5150g

Coefficient of variation

of fill mass (%) 0.16% 0.27% 0.15% 0.19%

Mean dry weight (g) 0.00249g 0.00268g 0.00233g 0.00278g


of dry mass (%) 3.90% 5.42% 2.89% 5.02%

Mean residual moisture

after lyophilisation 1.72% 1.36% 0.85% 2.07%


of residual moisture 77.44% 14.13% 58.40% 29.85%

Mean residual oxygen 0.39% 0.39% 0.42% 0.58%


of residual oxygen 45.25% 30.00% 20.23% 30.56%

Mean Qubit DNA

concentration upon

reconstitution in 100µl

H2O (ng/µl)

51.81 49.23 54.13 54.73

Mean OD ratio

(260/280nm) 1.84 1.92 1.89 1.90

Mean TapeStation DIN 9.13 9.87 9.80 9.77

Presentation Sealed, glass DIN ampoules, 3mL

WHO/BS/2019.2373

Excipient 5mg/mL Trehalose in 2.0 mM Tris, 0.2 mM EDTA buffer

Address of facility

where material was

processed

NIBSC, South Mimms, Hertfordshire, UK

Present custodian NIBSC, South Mimms, Hertfordshire, UK

Storage Temperature -20°C

Genomic DNA materials were freeze-dried in glass ampoules as an established format to ensure

long-term stability of gDNAs. Ideally, the formulation for reference reagents should be as close as

possible to the usual product or patient analyte, cover the entire analytical process, and be

applicable to methods in use throughout the world. However, it is essential that the formulation be

stable for many years, and that it is practically possible to produce batches of sufficient size to

satisfy demand over a similar period of time. Additionally, it should ideally be possible to generate

replacement standards from the same source material to ensure consistency in formulation and to

minimize value drift.

Homogeneity of each fill was determined by analysis of samples from the beginning, middle, and

end of the filling process with quality and quantity of the freeze-dried gDNAs confirmed by

260/280 nm absorbance (Nanodrop, Thermo Fisher Scientific, Wilmington, DE, USA), Qubit

fluorometric DNA quantification (Thermo Fisher Scientific), TapeStation electrophoresis

(Agilent, Santa Clara, CA, USA). Figure 4 shows that the genomic DNA retained from each step

of the process showed a consistent and high integrity as being represented by a DIN value between

9.13 -9.9 throughout the production, filling and freeze-drying process, demonstrating a high

fidelity of the adopted production and lyophilization process. Table 10 shows that the

concentration and purity of the bulk and the reconstituted lyophilized-gDNA were comparable

before and after lyophilization. Microbiological results were negative for all materials.

All ampoules are stored at -20°C at NIBSC under continuous temperature monitoring for the

lifetime of the products. Shipping will typically be at ambient temperature, as previous studies

have indicated the retained stability of the materials at elevated temperatures (8 months at +56°C,

as detailed in the section of Degradation Studies of this report). Upon reconstitution with 200 μL

nuclease-free water, the DNA concentration will be approximately 25 μg/mL in 10 mM Tris, 1

mM EDTA buffer with 5 mg/mL D-(+)-trehalose dehydrate, that is 5g gDNA/ampoule base on

QuBit quantitation (Table 10).

WHO/BS/2019.2373

Figure 4. Integrity of gDNA through the production process

18/142 (A/E) 18/144 (D) L

add

er

Po

siti

ve

Co

ntr

ol

Pre

-Pri

me

Po

st-P

rim

e

Beg

innin

g F

ill

Rec

onst

itu

ted

Beg

innin

g F

ill

Mid

dle

Fil

l R

eco

nst

itu

ted

Mid

dle

Fil

l

End

Fil

l R

eco

nst

itu

ted

End

Fil

l

Pre

-Pri

me

Po

st-P

rim

e

Beg

innin

g F

ill

Rec

onst

itu

ted

Beg

innin

g F

ill

Mid

dle

Fil

l R

eco

nst

itu

ted

Mid

dle

Fil

l

End

Fil

l R

eco

nst

itu

ted

End

Fil

l

18/126 (B)

Lad

der

Po

siti

ve

Co

ntr

ol

Pre

-Pri

me

Po

st-P

rim

e

Beg

innin

g F

ill

Rec

onst

itu

ted

Beg

innin

g F

ill

Mid

dle

Fil

l R

eco

nst

itu

ted

Mid

dle

Fil

l

End

Fil

l R

eco

nst

itu

ted

End

Fil

l

WHO/BS/2019.2373

Lad

der

Po

siti

ve

Co

ntr

ol

Pre

-Pri

me

Po

st-P

rim

e

Beg

innin

g F

ill

Rec

onst

itu

ted

Beg

innin

g F

ill

Mid

dle

Fil

l R

eco

nst

itu

ted

Mid

dle

Fil

l

End

Fil

l R

eco

nst

itu

ted

End

Fil

l

18/132 (C)

WHO/BS/2019.2373

Table 10. Quality and Quantity of gDNA before and after production process

NIBSC Code

Study Code DNA quantitation

Bulk material

before vialing

n=3

Reconstituted

after freeze-dried

n= 3

18 / 142

A/E

Nanodrop (260/280nm) 1.85 1.90

Nanodrop (g/ampoule) - 6.42

Qubit (g/ampoule) 5.09 4.91

18 / 126

B

Nanodrop (260/280nm) 1.85 1.86



18 / 132

C

Nanodrop (260/280nm) 1.86 1.86



18 / 144

D

Nanodrop (260/280nm) 1.84 1.91



WHO/BS/2019.2373

Appendix V

Accelerated Degradation and Stability Studies

Multiple samples were reserved for in-house long-term accelerated degradation studies by storage

at temperatures (-150°C, -70°C, -20°C, +4°C, +20°C, +37°C, and +56°C), as well as for real-time

stability monitoring at -20°C. Accelerated degradation studies were performed to predict the long-

term stability of the candidate standard. Ampoules of the lyophilised preparation were stored at

different temperatures, namely +56 oC, +45 °C, +37 oC, 20 oC and 4 °C and tested at indicated

time points together with ampoules stored at the recommended temperature of -20 °C and -70 °C

as baseline reference temperature. There was no observed loss in quantity so no attempt to predict

degradation rates has been undertaken. Real time monitoring of stability is ongoing.

Upon reconstitution with 200 μl nuclease-free water, the DNA concentration was approximately

25 μg/mL in 10 mM Tris, 1 mM EDTA buffer with 5 mg/mL D-(+)-trehalose dehydrate,

Homogeneity of each fill was determined by analysis of ampoules from the beginning, middle,

and end of the filling process with quality and quantity of the freeze-dried gDNAs confirmed by

260/280 nm absorbance (Nanodrop, Thermo Fisher Scientific, Wilmington, DE, USA), Qubit

fluorometric DNA quantification (Thermo Fisher Scientific), TapeStation electrophoresis

(Agilent, Santa Clara, CA, USA), qPCR and ddPCR, which also acted as a pilot study to determine

the performance of the materials in this increasingly-used diagnostic technique. Microbiological

results were negative for all materials. The ampoules are stored at -20°C at NIBSC under

continuous temperature monitoring for the lifetime of the product. Shipping will typically be at

ambient temperature, as studies have indicated the retained stability of the materials at elevated

temperatures (8 months at +56°C, see Degradation Studies, below).

Preliminary samples were assessed after four months’ and eight months’ storage and demonstrated

no apparent degradation at all temperatures measured (-150°C, -70°C, -20°C, +4°C, +20°C,

+37°C, and +56°C), as measured by electrophoresis (TapeStation; Figure 5 and Table 11),

260/280 nm absorbance (Nanodrop), DNA quantification (Qubit), with data comparable to that

seen at the time of manufacture (Table 12 and 13), including a retained lower DIN for materials

18/126, 18/132, 18/142 and 18/144, as compared with the other materials.

The absence of degradation at elevated temperature resulted in the inability to predict loss of real-

time stability. However, assurance that the materials are suitable for shipping at ambient

temperatures was provided. Samples will continue to be assessed on a regular basis (typically

annually) to ensure ongoing long-term stability for the lifetime of the panel. Previous experience

with similar gDNA reference panels has demonstrated ongoing real-time stability at least twelve

years post-manufacture.

WHO/BS/2019.2373

Figure 5. Genomic DNA integrity by TapeStation analysis after four (a) and

eight (b) month accelerated degradation studies

(a)

(b)

TapeStation analysis of the four materials of the proposed WHO 1st International Reference Panel

for following 8 months’ storage at various temperatures. High quality gDNA as indicated by a

high molecular weight band and the absence of lower molecular weight fragmented gDNA, and as

quantified by a high DIN, was apparent for all materials, including at elevated temperature,

indicating the absence of degradation. Lane 1, DNA ladder (catalogue number 5190-6292,

Agilent); lane 2, positive control (catalogue number G3041, Promega); lanes 3-28, ampoules

stored for eight months at -150°C, -70°C, -20°C, +4°C, +20°C, +37°C, and +56°C for each

material as follows: 18/126, 18/132, 18/142, and 18/144.

WHO/BS/2019.2373

Table 11. Genomic DNA integrity after 4 and 8-month accelerate degradation

studies 18/126 18/132 18/142 18/144 Average DIN Average DIN Average DIN Average DIN

Temperature

(oC)

4

months

8

months

4

months

8

months

4

months

8

months

4

months

8

months

-150 9.23 9.47 9.77 9.70 9.03 9.17 9.03 9.77

-70 8.93 9.47 9.53 9.83 9.73 9.67 9.73 9.67

-20 8.70 9.40 9.60 9.77 9.70 9.77 9.70 9.67

+4 9.07 9.57 9.70 9.63 9.70 9.80 9.70 9.77

+20 9.20 9.50 9.53 9.73 9.70 9.73 9.70 9.80

+37 8.60 9.53 9.20 9.50 9.63 9.77 9.63 9.73

+56 8.87 9.37 9.37 9.53 8.73 9.63 8.73 9.67

Note: Average DIN tested using TapeStation analysis after samples were kept at -150 to +56 oC

for four and eight months

Table 12. Genomic DNA quantity and quality after four-month accelerated

degradation studies Temperature oC

NIBSC

Code DNA quantitation -150 -70 -20 +4 +20 +37 +56

18/126

Nanodrop (ng/µL; n=3) 41.97 41.50 33.63 33.17 31.83 37.33 37.20

Nanodrop (260/280nm;

n=3) 1.85 1.86 1.86 1.86 1.85 1.85 1.87

Qubit (ng/µL; n=3) 28.30 26.70 24.93 24.53 24.73 25.50 27.47

18/132

Nanodrop (ng/µL; n=3) 38.10 39.10 35.73 36.80 36.17 35.83 36.50


n=3) 1.86 1.82 1.86 1.89 1.83 1.86 1.81

Qubit (ng/µL; n=3) 30.23 29.43 23.47 23.67 30.07 27.30 26.23

18/142

Nanodrop (ng/µL; n=3) 35.37 32.90 32.10 43.00 39.97 34.67 33.50


n=3) 1.85 1.86 1.90 1.84 1.87 1.85 1.87

Qubit (ng/µL; n=3) 24.37 25.37 28.20 30.03 24.53 29.27 30.07

18/144

Nanodrop (ng/µL; n=3) 36.27 36.00 34.87 39.33 35.70 35.80 34.77


n=3) 1.84 1.84 1.91 1.89 1.84 1.84 1.82

Qubit (ng/µL; n=3) 30.83 30.27 28.17 27.80 25.03 24.30 25.50

WHO/BS/2019.2373

Table 13. Genomic DNA quantity, quality and LV copy quantitation

after eight-month accelerated degradation studies Temperature oC

NIBSC

Code DNA quantitation -150 -70 -20 +4 +20 +37 +56

18/126

Nanodrop (ng/µL; n=3) 32.53 31.47 32.00 34.27 33.03 32.37 33.17

Nanodrop (260/280nm; n=3) 1.89 1.86 1.86 1.89 1.91 1.92 1.94

Qubit (ng/µL; n=3) 27.93 28.93 27.80 28.53 28.73 28.67 27.13

18/132

Nanodrop (ng/µL; n=3) 32.93 32.53 33.43 33.00 33.37 33.60 35.37

Nanodrop (260/280nm; n=3) 1.87 1.84 1.84 1.87 1.87 1.85 1.87

Qubit (ng/µL; n=3) 29.00 27.83 28.50 28.67 29.00 29.63 27.93

qPCR copy numbers/cell

(SYBRGreen) 8.10 8.52 7.35 6.57 7.32 8.62 8.18

95% LCL 9.57 7.80 10.26 9.08 4.52 10.19 9.30

95% UCL 11.29 16.11 12.43 13.74 14.87 11.32 13.00

qPCR copy number/cell

(TaqMan) 10.43 11.96 11.34 11.42 9.35 10.75 11.12

95% LCL 3.96 3.33 5.86 4.13 6.08 5.37 4.32

95% UCL 12.51 13.76 8.86 9.21 8.57 11.92 12.23

18/142

Nanodrop (ng/µL; n=3) 31.23 31.67 31.53 31.03 31.83 32.20 32.20

Nanodrop (260/280nm; n=3) 1.87 1.86 1.88 1.93 1.91 1.89 1.92

Qubit (ng/µL; n=3) 28.33 28.40 27.37 27.80 29.13 28.37 28.07

18/144

Nanodrop (ng/µL; n=3) 31.37 31.57 34.73 31.73 31.67 32.03 31.83

Nanodrop (260/280nm; n=3) 1.93 1.90 1.86 1.91 1.83 1.83 1.85

Qubit (ng/µL; n=3) 28.30 27.17 27.67 27.30 28.03 28.10 27.67

Post-Reconstitution Stability Studies

End-users are recommended to use the materials on the day of reconstitution. However, in-house

analysis determined reconstituted freeze-dried gDNA to be stable for at least four days at +4°C,

or for one months at -20°C (Figures 6 and 7), with data comparable to that seen at the time of

manufacture (Table 8), including a retained high DIN for materials 18/126, 18/132, 18/142 and

18/144, as compared with the other materials.

WHO/BS/2019.2373

Figure 6. Genomic DNA integrity by TapeStation analysis after reconstitution

in water and storage at 4 oC for four days

Lad

der

Po

st-f

ill

(10

ng/µ

L)

4 d

ays

Rec

onst

ituti

on

4°C

(5

0 n

g/µ

L)

Po

siti

ve

contr

ol

18/126

Po

st-f

ill

(10

ng/µ

L)

4 d

ays

Rec

onst

ituti

on

4°C

(5

0 n

g/µ

L)

Po

st-f

ill

(10

ng/µ

L)

4 d

ays

Rec

onst

ituti

on

4°C

(5

0 n

g/µ

L)

Po

st-f

ill

(10

ng/µ

L)

4 d

ays

Rec

onst

ituti

on

4°C

(5

0 n

g/µ

L)

18/132 18/142 18/144

WHO/BS/2019.2373

Figure 7. Genomic DNA integrity by TapeStation analysis after reconstitution

in water and storage at -20oC for one months

18/1

26

18/1

32

18/1

42

18/1

44

Appendix VI

Instructions for Use (IFU) Sent to Participants

Thank you for participating in the collaborative study to evaluate the proposed World Health

Organization (WHO) 1st International Reference panel for lentiviral vector integration copy number

quantitation.

Introduction

Lentiviral vectors (LV) have emerged as the benchmark for gene therapy applications and have been

successfully used in a cure for monogenic immunodeficiency disorders and chimeric antigen receptor

(CAR) T-cell cancer immunotherapies. In 2016, World Health Organization (WHO) approved the

development of the WHO 1st International Reference panel for lentiviral vector integration copy

number quantitation, which is suitable for the standardization of assays and enabling comparison of

cross-trial and cross-manufacturing results for this important vector platform. The Reference panel

will be expected to optimize the development of gene therapy medicinal products, which is especially

important, given the usually orphan nature of the diseases to be treated, naturally hampering

reproducibility and comparability of results.

Aim of the Study

The purpose of this collaborative study (CS633) is to evaluate the provided five freeze-dried

genomic DNA samples using proposed methods, i.e. TaqMan qPCR, SYBRGreen qPCR, digital

PCR, or sequencing-based methods, in order to assign a consensus, i.e. LV integration copy

number per cell, to each of the materials.

The panel of five genomic DNA samples (A, B, C, D and E) have been produced from lentiviral

vector transduced single cell clones and freeze-dried at 2000 to 5,000 ampoules per sample. The

provided samples have been selected as candidate standards containing either zero, low or high

copies of LV integration.

Your agreement will be sought on the consensus value assignment before a report is submitted to

the World Health Organization in June 2019 for the establishment of the candidate materials as

the WHO 1st International Reference panel for the quantitation of lentiviral vector integration. It

is anticipated that the study results will be published in a WHO annual report and an international

journal with your consent and with individual participants’ data blind coded.

It is anticipated that the panel of genomic DNA standards can be used individually as zero, low or

high copy standard alongside individual laboratories’ in-house standards or can be used in

combination to generate a genomic DNA standard curve for the calibration of individual

laboratories’ in-house standards.

Before starting the study, please read this Instruction for Use (IFU) document completely. If

you intend to use the provided NIBSC standard and primer sets, please also read Appendix for

the ‘Example NIBSC Protocols’. If anything is unclear, please contact Yuan Zhao

([email protected]; telephone +44 (0)1707 641000).


WHO/BS/2019.2373

Samples provided:

Lyophilised samples are genomic DNAs freeze-dried in TE buffer and presented in sealed glass

DIN ampoules. Participants will receive multiple sets of five ampoules of the samples. Each set of

samples consists of one ampoule of each of samples A, B, C, D and E. The amount of genomic

DNA in each ampoule is approximately 5µg and the concentration after reconstitution in 200µl

water (Table 1) will be approximately 25ng/µL in 1x TE (as determined by Qubit quantification).

Liquid forms of samples include

• 80µL ‘NIBSC DNA standard’ at a concentration of 109 copies/5µL, which can be used to

generate a quantitation standard curve from 108 to 102 copies/5µl per well.

• 120µL of ‘NIBSC LV_primer set’ that includes forward and reverse primers targeting

lentivirus (LV) sequences at a concentration of 100µM solution in H2O

• 120µL ‘NIBSC HK_primer set’ that includes forward and reverse primers targeting house-

keeping (HK) gene sequences at a concentration of 100µM solution in H2O

All samples (lyophilised and liquid) are to be stored at -20°C upon receipt and until use.

Important Note:

1) The provided lyophilised genomic DNA samples carry a 3rd generation of lentiviral vector

(kindly donated by Professor Didier Trono, EPFL/Geneva) with a reporter gene GFP. You may

reference the publication by Zufferey et al 1998 (J Virology 72:9873-9880)4 when designing

or confirming the suitability of your in-house primers/probes before the tests.

2) Participants are recommended to use transgene independent primers/probe to evaluate

lentivirus copy number.

3) Due to the stability issue, we cannot send out the DNA probes for TaqMan qPCR testing.

Participants performing TaqMan qPCR testing are required to order the probes before

testing. The probe sequences that should be used with the corresponding NIBSC primer sets

are:

LV-probe 5’- [6FAM] – CCTCCAGGTCTGAAGATCAGCGGCCGC - [TAMRA] - 3’

HK-probe 5’- [6FAM] – CCTGTCATGCCCACACAAATCTCTCC - [TAMRA] - 3’.

4) All participants will receive the liquid NIBSC ‘DNA standard’, ‘LV_primer set’ and

‘HK_primer set’; however, you do not need to use these standards and/or primers if you have

an in-house standard and/or primers available. You can use the provided two NIBSC primer

sets together in a test, or you can use one set of the provided NIBSC primers, e.g. NIBSC HK

primers, in combination with a set of your in-house primers, e.g. in-house LV primers, or vice

versa, in a test. The provided primer sequences are given in Table 6.

5) After being prepared as instructed in Table 1, each set of 8 testing samples i.e. A+E, B, C, C1,

C2, C3, C4 and D will be sufficient for loading onto 2 plates, i.e. to test each sample once using

WHO/BS/2019.2373

2 methods (e.g. SYBRGreen and TaqMan or TaqMan and digital PCR). Therefore, we are

sending 4 sets of samples - 3 sets for triplicate tests and one extra set as a backup - to the

participants who have proposed to perform two methods or one method, with both your in-

house standard/primers and NIBSC standard/primers.

Preparation of Sample Ampoule:

The samples should be handled as follows:

1. Due to the inherent stability of freeze-dried material, all materials will be shipped at

ambient temperature.

2. Store all unopened ampoules of the freeze-dried and liquid materials at -20°C until use.

3. A disposable plastic ampoule breaker is provided with each DIN ampoule.

4. DIN ampoules have an ‘easy-open’ coloured stress point, where the narrow ampoule stem

joins the wider ampoule body. Tap the ampoule gently to collect the material at the

bottom (labelled) end of the wider ampoule body.

5. Ensure that the disposable plastic ampoule safety breaker provided is pushed down on the

stem of the ampoule and against the shoulder of the ampoule body.

6. Hold the body of the ampoule in one hand and the disposable ampoule breaker

covering the ampoule stem between the thumb and first finger of the other hand.

7. Apply a bending force to open the ampoule at the coloured stress point, primarily

using the hand holding the plastic collar.

8. Care should be taken to avoid cuts and projectile glass fragments that might enter the

eyes, for example, using suitable gloves and an eye shield. Take care that no material

is lost from the ampoule and no glass falls into the ampoule. Within the ampoule is dry

nitrogen gas at slightly less than atmospheric pressure.

9. It is highly recommended that the materials are used on the day they are reconstituted and

are not stored. However, our analysis determined reconstituted freeze-dried genomic DNA

to be stable for up to 1 week at +4°C (or 1 month at -20°C). Care should be taken to avoid

cross-contamination with other samples.

WHO/BS/2019.2373

Overview of Sample Testing

Table 1. Sample Reconstitution and Preparation

To ensure the comparability of study results, participants are required to follow the

instruction given below:

10. To reconstitute the lyophilised samples in 200µL H2O as detailed in Table 1. It Is

recommended to reconstitute one set of samples at a time and on the day of testing. Each

set of samples consists of one ampoule of each of sample A, B, C, D and E.

11. Using Digital PCR, to test 0.4µL per well (i.e.~10ng per well) each of the 4 reconstituted

samples, i.e. A+E, B, C and D (Table 1), in triplicate wells for each sample and follow the

plate layout given in Table 3A-C for digital PCR. Please note that using digital PCR, you

do not need to prepare samples C1, C2, C3 and C4 and do not need to use DNA standards.

It is required to digest the genomic DNA samples with an appropriate restriction enzyme,

e.g. DraI, before digital PCR testing.

12. Using qPCR, to test 5 µL per well (i.e.~125ng per well) each of the 8 reconstituted

samples i.e. A+E, B, C, C1, C2, C3, C4 and D (Table 1), in triplicate wells for each sample

and follow the plate layout given in Table 2A-C for qPCR.

WHO/BS/2019.2373

13. To include a series of dilutions of your in-house or NIBSC DNA standards in qPCR, e.g.

a series of 1/10 dilutions and ranging from 108 to 102 copies. To test 5µL per well of the

DNA standards in triplicates following the plate layout given in Table 2A-C for qPCR.

DNA standards are not required for digital PCR.

14. Each method, e.g. SYBRGreen, TaqMan or digital PCR, should be tested 3 times on 3

separate days using 3 separate sets of samples, preferentially by 3 operators.

15. Participants are encouraged to use your own in-house methods to test the materials, given

that 5 µL sample per well (i.e.~125ng sample per well) or 5 µL standard per well (i.e.108

to 102 copies per well) were tested in qPCR and, 0.4 µL sample per well (i.e.~10ng per

well) were tested in digital PCR. In the case of no in-house methods available, example

NIBSC protocols are provided in Appendix III for qPCR and Appendix IV for digital PCR.

16. To complete the Data Reporting File as provided in a separate excel file and as outlined

in Table 4 for qPCR and Table 5 for digital PCR and, as further detailed below.

17. For Digital PCR, to complete “Digital PCR Data Reporting” file as shown Tale 5 and, to

provide the Mandatory Data in the area highlighted in orange. Within one reporting excel

file, there are 4 tabs, i.e. “Simplex digital PCR 1,2,3”, “Multiplex digital PCR 1,2,3”,

“digital PCR Result Summary” and “DNA concentration” (Table 5A-C). Please also

submit raw data in a format of csv file, as provided by the BioRad Quantasoft software.

18. For qPCR, to complete “qPCR Data Reporting” file as shown in Table 4 and, to provide

the Mandatory data (e.g. Ct in LightCycler qPCR) in the area highlighted in orange. There

are 5 tabs in Table 4, i.e. “qPCR Plate 1”, “qPCR Plate 2”, “qPCR Plate 3”, “qPCR Results

Summary” and “DNA concentration” (Table 4A-C).

19. If possible, please also provide the optional quantitative results in Table 4 Tab 4 in the area

shaded in grey, e.g. LV copies per cell, using your routine quantitation method, e.g. excel,

prism or Combi stats.

20. One Reporting excel file is for reporting one set of qPCR data, i.e. from 3 plates using one

method to test 3 times on 3 separate sets of samples. If more than one method is used for

qPCR, e.g. TaqMan and SYBRGreen qPCR, please complete one file (copy) for one

method.

21. Please submit raw data files exported from qPCR software, e.g. Roche Lightcycler 480,

Qiagen Q-Rex, Agilent MxPro or ThermoFisher StepOneTM software.

22. Using Sequencing based methods, to test 4 samples A+E, B, C and D and to report LV

integration sites for each sample in a word document.

23. Using Southern blot, to test 4 samples A+E, B, C and D and to report copy numbers for

Lentivirus (LV) and House-keeping gene (LV) separately and in your chosen format.

24. Please give details if you are unable to report results for any samples or encounter any

difficulties during the study.

25. Please provide any comments related to the study that may help the statistical analysis.

26. Please retain all original data files. We will contact you if further clarification is required

on your data reports.

WHO/BS/2019.2373

27. The results should be sent electronically before 18th January 2019 to Yuan Zhao

([email protected]) to ensure the submission of our study results to WHO before June

2019.

Contacts:

Project Leader: Yuan Zhao ([email protected] )

Statistician: Peter Rigsby ([email protected])

Study Coordinators: Christopher Traylen ([email protected]),

James Condron ([email protected])

Table 2A – qPCR Day 1 Plate Layout

1 2 3 4 5 6 7 8 9 10 11 12

A 108 108 108 5µl A+E 5µl A+E 5µl A+E 108 108 108 5µl A+E 5µl A+E 5µl A+E

B 107 107 107 5µl B 5µl B 5µl B 107 107 107 5µl B 5µl B 5µl B

C 106 106 106 5µl C 5µl C 5µl C 106 106 106 5µl C 5µl C 5µl C

D 105 105 105 5µl C1 5µl C1 5µl C1 105 105 105 5µl C1 5µl C1 5µl C1

E 104 104 104 5µl C2 5µl C2 5µl C2 104 104 104 5µl C2 5µl C2 5µl C2

F 103 103 103 5µl C3 5µl C3 5µl C3 103 103 103 5µl C3 5µl C3 5µl C3

G 102 102 102 5µl C4 5µl C4 5µl C4 102 102 102 5µl C4 5µl C4 5µl C4

H H2O H2O H2O 5µl D 5µl D 5µl D H2O H2O H2O 5µl D 5µl D 5µl D

Table 2B – qPCR Day 2 Plate Layout

1 2 3 4 5 6 7 8 9 10 11 12

A 108 108 108 5µl A+E 5µl A+E 5µl A+E 108 108 108 5µl A+E 5µl A+E 5µl A+E

B 107 107 107 5µl B 5µl B 5µl B 107 107 107 5µl B 5µl B 5µl B

C 106 106 106 5µl C 5µl C 5µl C 106 106 106 5µl C 5µl C 5µl C

D 105 105 105 5µl C1 5µl C1 5µl C1 105 105 105 5µl C1 5µl C1 5µl C1

E 104 104 104 5µl C2 5µl C2 5µl C2 104 104 104 5µl C2 5µl C2 5µl C2

F 103 103 103 5µl C3 5µl C3 5µl C3 103 103 103 5µl C3 5µl C3 5µl C3

G 102 102 102 5µl C4 5µl C4 5µl C4 102 102 102 5µl C4 5µl C4 5µl C4

H H2O H2O H2O 5µl D 5µl D 5µl D H2O H2O H2O 5µl D 5µl D 5µl D

qPCR target LV sequence qPCR target house-keeping gene







WHO/BS/2019.2373

Table 2C – qPCR Day 3 Plate Layout

1 2 3 4 5 6 7 8 9 10 11 12

A 5µl A+E 5µl A+E 5µl A+E 108 108 108 5µl A+E 5µl A+E 5µl A+E 108 108 108

B 5µl B 5µl B 5µl B 107 107 107 5µl B 5µl B 5µl B 107 107 107

C 5µl C 5µl C 5µl C 106 106 106 5µl C 5µl C 5µl C 106 106 106

D 5µl C1 5µl C1 5µl C1 105 105 105 5µl C1 5µl C1 5µl C1 105 105 105

E 5µl C2 5µl C2 5µl C2 104 104 104 5µl C2 5µl C2 5µl C2 104 104 104

F 5µl C3 5µl C3 5µl C3 103 103 103 5µl C3 5µl C3 5µl C3 103 103 103

G 5µl C4 5µl C4 5µl C4 102 102 102 5µl C4 5µl C4 5µl C4 102 102 102

H 5µl D 5µl D 5µl D H2O H2O H2O 5µl D 5µl D 5µl D H2O H2O H2O

Table 3A – Digital PCR Day 1 Plate Layout 1 2 3 4 5 6 7 8 9 10 11 12

A H2O A+E A+E A+E

B H2O B B B

C H2O C C C

D H2O D D D

E H2O A+E A+E A+E

F H2O B B B

G H2O C C C

H H2O D D D

Table 3B – Digital PCR Day 2 Plate Layout 1 2 3 4 5 6 7 8 9 10 11 12

A H2O A+E A+E A+E

B H2O B B B

C H2O C C C

D H2O D D D

E H2O A+E A+E A+E

F H2O B B B

G H2O C C C

H H2O D D D


Digital PCR targeting LV

Digital PCR targeting HK



WHO/BS/2019.2373

Table 3C – Digital PCR Day 3 Plate Layout

1 2 3 4 5 6 7 8 9 10 11 12

A H2O A+E A+E A+E

B H2O B B B

C H2O C C C

D H2O D D D

E H2O A+E A+E A+E

F H2O B B B

G H2O C C C

H H2O D D D

Table 4A – qPCR Data Reporting Form for Plate 1, 2 and 3 (Tabs 1, 2 and 3)

Lentivirus Date: xx/xx/2018 Plate Row Dilutions LV Standard (copies/5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%) Sample (5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%)

Please Circle below A P1 1.00E+08 e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!

Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!

TaqMan qPCR: Yes / No C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!

SybrGreen qPCR: Yes / No D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

In house Standard: Yes / No E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

NIBSC Standard: Yes / No F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

in House Primers/probe: Yes / No G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

NIBSC LV_Primers/Probe: Yes / No H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!

Note: Pink area is Mandatory area to fill in Grey area is optional to fill in

House -Keeping (HK) gene Plate Row Dilutions HK Standard (copies/5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%) Sample (5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%)

Please Circle below A P1 1.00E+08 #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!


TaqMan qPCR: Yes / No C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!

SybrGreen qPCR: Yes / No D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

In house Standard: Yes / No E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

NIBSC Standard: Yes / No F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

in House Primers/probe: Yes / No G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

NIBSC HK_Primers/Probe: Yes / No H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!


qPCR Data Report for Plate 1qPCR Data Report for Plate 1

Comments:




C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!

D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!

H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!













Comments:



WHO/BS/2019.2373

Table 4B –qPCR Reporting form for Summary Quantitation of LV

copies/cell (Tab 4)

Table 4C – Reporting Form for the Concentration of Reconstituted Samples

(Tab 5)






















Comments:

Plate 1 Plate 2 Plate 3

Sample (5L per well) Mean LV Copies of 3 Wells Mean HK Copies of 3 Wells Mean LV Copies per Cell Mean LV Copies of 3 Wells Mean HK Copies of 3 Wells Mean LV Copies per Cell Mean LV Copies of 3 Wells Mean HK Copies of 3 Wells Mean LV Copies per Celli.e. (mean LV copies of 3 Wells/mean HK copies of 3 wells) x2 i.e. (mean LV copies of 3 Wells/mean HK copies of 3 wells) x2 i.e. (mean LV copies of 3 Wells/mean HK copies of 3 wells) x2

A+E

B

C

C1

C2

C3

C4

D

Comments:

qPCR Result Summary

Set 1 Samples for Plate 1 Concentration (ng/ul) Mean

Method used: Please Circle below Read 1 Read 2 Read 3 concentration

Nanodrop Yes/No A+E 1 2 3 2 1 0.707106781 50

QuBit Yes/No B #DIV/0! #### #DIV/0! ####

others (please specify): C #DIV/0! #### #DIV/0! ####

D #DIV/0! #### #DIV/0! ####

Set 2 Samples for Plate 2 Concentration (ng/ul) Mean


Nanodrop Yes/No A+E #DIV/0! #### #DIV/0! ####



D #DIV/0! #### #DIV/0! ####

Set 3 samples for Plate 3 Concentration (ng/ul) Mean


Nanodrop Yes/No A+E #DIV/0! #### #DIV/0! ####



D #DIV/0! #### #DIV/0! ####

Grey area is optional to fill in

Plate 3 Stdev SEM CV%



WHO/BS/2019.2373

Table 5A –Digital PCR Raw Data Reporting Form for Plate 1, 2 and 3 (Tab 1 and 2)

Table 5B –Digital PCR Summary Quantitation of LV copies per cell (Tab 3)

Date: xx/xx/2018 Sample LV Copies per Well LV Copies per Well LV Copies per Well Mean LV Copies per Well Stdev SEM CV (%) Sample LV Copies per Well LV Copies per Well LV Copies per Well Mean LV Copies per Well Stdev SEM CV (%) Sample LV Copies per Well LV Copies per Well LV Copies per Well Mean LV Copies per Well Stdev SEM CV (%)

Please Circle below A+E e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!

Eva Green Yes / No B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!

Probe Yes / No C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!

in House Primers: Yes / No D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!

NIBSC LV_Primers: Yes / No


Date: xx/xx/2018 Sample HK Copies per Well HK Copies per Well HK Copies per Well Mean HK Copies per Well Stdev SEM CV (%) Sample HK Copies per Well HK Copies per Well HK Copies per Well Mean HK Copies per Well Stdev SEM CV (%) Sample HK Copies per Well HK Copies per Well HK Copies per Well Mean HK Copies per Well Stdev SEM CV (%)

Please Circle below A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!




NIBSC LV_Primers: Yes / No

Operator Operator OperatorNote: Pink area is Mandatory area to fill in Grey area is optional to fill in

Comments:

1 or 2 or 3 1 or 2 or 3 1 or 2 or 3

Data Report for Digital PCR Plates 1, 2, 3. Plate 1 Plate 2 Plate 3

Lentivirus

House -Keeping (HK) gene

Date: xx/xx/2018 Sample LV Copies per Cell LV Copies per Cell LV Copies per Cell Mean LV Copies per Cell Stdev SEM CV (%) Sample LV Copies per Cell LV Copies per Cell LV Copies per Cell Mean LV Copies per Cell Stdev SEM CV (%) Sample LV Copies per Cell LV Copies per Cell LV Copies per Cell Mean LV Copies per Cell Stdev SEM CV (%)

Please Circle below A+E e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!




NIBSC Primers: Yes / No

Operator Operator Operator


Comments:

Data Report for Multiplex Digital PCR Plates 1, 2, 3.

PCR Amplification of Lentivirus and HK in the same well

1 or 2 or 3 1 or 2 or 3

Note: LV Copies/Cell = (LV copies/HK copies) x2


1 or 2 or 3


Mean LV Copies per Cell Mean LV Copies per Cell Mean LV Copies per Cell

Digital PCR Result Summary

Comments:

Sample

A+E

B

CD

Note: Mean LV Copies per Cell = (mean LV copies of three wells /mean HK copies of three wells ) x2

WHO/BS/2019.2373

Table 5C – Digital PCR Reporting Form for the Concentration of

Reconstituted Samples (Tab 4)

Table 6 - Sequences for NIBSC LV and HK Primers and Probes

NIBSC

Primers/Probes Sequence

Storage

temperature

Lentivirus (LV)

Forward primer 5’-AGTAAGACCACCGCACAGCA-3’ -20°C

Reverse primer 5’-CCTTGGTGGGTGCTACTCCT-3’ -20°C

House-keeping (HK)

Forward primer 5’-GCTGTCATCTCTTGTGGGCTGT-3’ -20°C

Reverse primer 5’-ACTCATGGGAGCTGCTGGTTC-3’ -20°C

Lentivirus (LV) probe

5’-[6FAM]-

CCTCCAGGTCTGAAGATCAGCGGCCGC-

[TAMRA]-3’

Follow

manufacturer’s

instructions

House-keeping (HK)

probe

5’-[6FAM]-

CCTGTCATGCCCACACAAATCTCTCC-[TAMRA]-

3’

Follow

manufacturer’s

instructions

WHO/BS/2019.2373

Appendix VII

Example TaqMan and SYBRGreen qPCR Protocols

for Collaborative Study

Participants are encouraged to use their in-house study protocol to evaluate the samples. In

the case of no in-house protocol available, the following example protocols can be considered.

Materials

• Samples A, B, C, D and E are provided as lyophilised genomic DNA in glass ampoules

• NIBSC DNA standard is provided in solution at a concentration of 109 copies/5µL in H2O.

The provided DNA standard encodes both LV and house-keeping (HK) gene sequences;

therefore, one standard can be used for qPCR targeting both LV and HK sequences

• Primers for LV and HK are provided as primer sets and as a 10-fold strength of a stock

solution at 100µM solution in H2O. You can use the provided two NIBSC primer sets

together in a test, or you can use one set of the provided NIBSC primers, e.g. HK, in

combination with a set of your in-house primers, e.g. in-house LV primers, and vice versa,

in a test. The provided primer sequences are given in Table 5 below.

• You do not need to use the standard and primers provided if you have an in-house standard

and primers available.

Reagents are required but not provided and hence, are to be provided or procured by participants:

• Probes for TaqMan qPCR are NOT provided and thus must be procured by participants.

The sequences for the required probes are: LV_probe 5’- [6FAM] –

CCTCCAGGTCTGAAGATCAGCGGCCGC - [TAMRA] - 3’ and HK_probe 5’- [6FAM] –

CCTGTCATGCCCACACAAATCTCTCC - [TAMRA] - 3’.

• qPCR master mix, such as Taq DNA Polymerase: Light Cycler® 480 Probes Master

(Roche Life Science) (# 04707494001) for TaqMan qPCR, or SensiMix™ SYBR® No-

ROX Kit (Bioline) (#QT650-05) for SYBRGreen qPCR.

• RNAse/DNAse-free H2O.

• DNAse/RNAse-free microtubes.

• DNAse/RNAse-free filter tips.

• 96-well qPCR plates and seals.

• qPCR appliance, e.g. LightCycler1.5 and capillary centrifuge or LightCycler 480, Roche

or equivalent.

• A spectrophometer for measuring the DNA concentrations.

It is recommended to prepare all solutions and perform the assays in a PCR cabinet or suite

with usual precautions for PCR experiments.

Methods

Sample Preparation:

WHO/BS/2019.2373

• Prepare the glass ampoules as instructed in the IFU (Instruction for Use).

• Reconstitute and prepare the 5 provided samples A, B, C, D and E as detailed in Table 1 to

give rise to 8 testing samples A+E, B, C, C1, C2, C3, C4 and D.

Primer and Probe Preparation:

• Centrifuge the 3 provided plastic tubes containing the provided primers or DNA standard,

to collect the sample liquid at the bottom of the tube and to ensure sufficient materials for

subsequent testing

• Make 1 in 10 dilution of the provided 10x primer sets (100uM) for LV or HK with

RNAse/DNAse-free H2O, to give rise to 10uM working primer solutions (1x).

• Prepare a 1.5uM working probe solutions for LV or HK from the probes purchased by

participants.

A series of DNA Standard Solution Preparation for qPCR

• Make a series of 1 in 10 dilutions of DNA standards with RNAse/DNAse-free H2O, to give

rise to 7 working DNA standard solutions at a concentration of 1x108, 107, 106, 105, 104,

103 or 102 copies/5µL, as detailed below and in the dilution Table 7.

• The provided 80µL DNA standard is a stock solution at a concentration of 1x109

copies/5µL and named P0 in the following steps and in the dilution Table 7 given below.

• Take 22µL of P0 and add to 198µL of nuclease-free water to make 220µL of P1

(1x108copies/5µL) standard solution.

• Vortex and tap the tube to collect all solution at the bottom of the tube.

• Change to a new pipetting tip

• Take 22µL of P1 and add to 198µL of nuclease-free water to make 220µL of P2

(1x107copies/5µL)

• Vortex and tap the tube to collect all solutions at the bottom of the tube

• Change pipetting tips between each dilution.

• Repeat with each new diluted standard solution to create a panel of P1 to P7 standards at

concentrations from 1x108 to 1x102 copies/5µL, as detailed in the following Table 6.

Please note that the ~200µL prepared DNA standard solution series for individual dilutions will

be sufficient for assays using two methods and testing 3 times, that is, sufficient to be used in 6

plates with a loading of 5µL per well in triplicate for both LV and HK assays.

WHO/BS/2019.2373

Table 7 – Dilutions of a Series of 1:10 DNA Standards

Copy Number Dilutions Dilution

Factor

Volume

P1 = 108/5µL 22µL of P0 109 + 198µL

H2O

1:10 220µL

P2 = 107/5µL 22µL of P1 108 + 198µL

H2O

1:10 220µL

P3 = 106/5µL 22µL of P2 107 + 198µL

H2O

1:10 220µL

P4 = 105/5µL 22µL of P3 106 + 198µL

H2O

1:10 220µL

P5 = 104/5µL 22µL of P4 105 + 198µL

H2O

1:10 220µL

P6 = 103/5µL 22µL of P5 104 + 198µL

H2O

1:10 220µL

P7 = 102/5µL 22µL of P6 103 + 198µL

H2O

1:10 220µL

TaqMan qPCR Master Mix Preparation:

• Prepare a 750µL of TaqMan qPCR Master Mix for qPCR targeting lentivirus (LV) using

LV primer/probe as detailed in the following Table. The prepared 750µL Master mix

solution is intended for loading into 48 wells at 15µL per well.

• Prepare a 750µL of TaqMan qPCR Master Mix for qPCR targeting House-keeping gene

(HK) using HK primer/probe as detailed in the following Table. The prepared 750µL

Master mix solution is intended for loading into 48 wells at 15µL per well.

Reagent For 1 well

(µL)

For 50 wells

(µL)

Final

concentration

H2O 3 150 -

LV primer set (10µM) 1 50 0.5µM

LV Probe (1.5µM) 1 50 0.075µM

TaqMan Master Mix (2x) 10 500 1x

Total Master Mix 15 750

Then:

Add the above Master Mix per well to the plate

(µL) 15 15

Add a standard or a sample per well (µL) 5 5

Total volume per well (µL) 20 20

WHO/BS/2019.2373

TaqMan qPCR Plate Preparation:

• Vortex and briefly centrifuge the LV and HK Master Mix solutions before loading to

collect the solutions and to ensure they are sufficient for loading to 48 wells in a plate.

• Load 15µL per well of the LV Master Mix containing LV primers/probe to 48 wells that

are designated for qPCR targeting Lentivirus sequences and are highlighted in green, e.g.

columns 1-6 on plate 1 and 2 and columns 7-12 on Plate 3 (Table 2A-C in the main IFU).

• Load 15µL per well of the HK Master Mix containing HK primers/probe to 48 wells that

are for qPCR targeting HK sequences and are highlighted in blue, e.g. columns 7-12 on

plate 1 and 2 and columns 1-6 on Plate 3 (Table 2A-C in the main IFU).

• Load 5µL per well of the prepared 7 DNA standards from each dilution of P1 to P7

standards (Table 6) in triplicate following the qPCR plate layout provided (Table 2A-C in

the main IFU).

• Load 5µL per well of the prepared 8 testing samples, i.e. A+E, B, C, C1, C2, C3, C4 and

D (Table 1), in triplicate following the qPCR plate layout provided (Table 2A-C in the

main IFU).

• Load 5µL per well of RNAse/DNAse-free H2O in triplicate into the corresponding wells

designated for H2O as a negative control, following the qPCR plate layout provided (Table

2A-C in the main IFU).

• Mix gently by pipetting up and down after individual loadings of DNA standards or

samples or H2O. Avoid air bubbles.

• Each well in the plate contains a final volume of 20µL, consisting of 15µL appropriate

Master Mix and 5µL sample or DNA standards or H2O.

• Seal the plate with a film and centrifuge the plate at ~400g for 1 minute to collect all

samples at the bottom of the wells.

• Load the plate to a qPCR thermo-cycler, e.g. LightCycler 480 (Roche)

• Run qPCR reaction following the temperature and cycle conditions as giving in the Table

below for TaqMan thermo-cycle conditions.

• Repeat the test twice using two separate new sets of samples on two separate days as day

2 or day 3 assay, following the plate layout for the corresponding days (Table 2A-C).

Reagent For 1 well

(µL)

For 50 wells

(µL)

Final

concentration

H2O 3 150 -

HK primer set (10µM) 1 50 0.5µM

HK Probe (1.5µM) 1 50 0.075µM

TaqMan Master Mix (2x) 10 500 1x


Then:


(µL) 15 15



WHO/BS/2019.2373

TaqMan qPCR Thermo-Cycle Conditions:

Denaturation (1 cycle)

Temperature Time Ramp Rate

95°C 15 minutes 4.4°C /s

Amplification (45

cycles)


95°C 15 seconds 4.4°C /s

58°C 1 minute 2.2°C /s


Cooling (1 cycle)


40°C 30s 1.5°C/s

Wavelength Channel: 450-533

SYBRGreen qPCR Master Mix Preparation:

• Prepare a 750µL of SYBRGreen qPCR Master Mix for qPCR targeting lentivirus using LV

primer as detailed in the following Table 9A. The prepared 750µL solution is intended for

loading into 48 wells at 15µL per well.

Reagent For 1 well

(µL)

For 50 wells

(µL)

Final

concentration

H2O 3.8 190 -

LV primer set 10µM 1.2 60 0.5µM

SYBRGreen Master Mix (2X) 10 500 1x


Then:


(µL) 15 15



• Prepare a 750µL of SYBRGreen qPCR Master Mix for qPCR targeting House-keeping

gene (HK) using HK primer as detailed in the following Table. The prepared 750µL

solution is intended for loading into 48 wells at 15µL per well.

◄ Single Acquisition

WHO/BS/2019.2373

Reagent

For 1

well

(µL)

For 50

wells (µL)

Final

concentration

H2O 3.8 190 -

HK primerset 10µM 1.2 60 0.5µM

SYBRGreen Master Mix (2X) 10 500 1x


Then:


(µL) 15 15



SYBRGreen qPCR Plate Preparation:

• Vortex and briefly centrifuge the LV and HK Master Mix solutions before loading to

collect the solutions and to ensure they are sufficient for loading to 48 wells.

• Load 15µL per well of the LV Master Mix containing LV primers to 48 wells that are

designated for assay of Lentivirus sequences and are highlighted in green, e.g. columns 1-

6 on plate 1 and 2 and columns 7-12 on Plate 3 (Table 2A-C in the IFU).

• Load 15µL per well of the HK Master Mix containing HK primers to 48 wells that are

designated for assay of HK sequences and are highlighted in blue, e.g. columns 7-12 on

plate 1 and 2 and columns 1-6 on Plate 3 (Table 2A-C in the IFU).

• Load 5µL per well of the prepared 7 DNA standards from each dilution of P1 to P7

standards (Table 6) in triplicate following the qPCR plate layout provided (Table 2A-C in

the IFU).

• Load 5µL per well of the prepared 8 testing samples, i.e. A+E, B, C, C1, C2, C3, C4 and

D (Table 1), in triplicate following the qPCR plate layout provided (Table 2A-C in the

main IFU).

• Load 5µL per well of RNAse/DNAse-free H2O in triplicate in the corresponding wells

designated for H2O as a negative control, following the qPCR plate layout provided (Table

2A-C in the main IFU).

• Mix gently by pipetting up and down after individual loadings of DNA standards or

samples or H2O. Avoid air bubbles.


Master Mix and 5µL sample or DNA standards.

• Seal the plate with a film and centrifuge the plate at ~400g for 1 minutes to collect all

samples at the bottom of the wells.

• Load the plate to a qPCR thermo-cycler, e.g. LightCycler 480 (Roche)

• Run SYBRGreen qPCR reaction following the temperature and cycle conditions as giving

in the Table below for SYBRGreen qPCR thermo-cycle conditions.

WHO/BS/2019.2373

• Repeat the test twice using two separate new sets of samples on two separate days as day

2 or day 3 assay, following the plate layout for the corresponding days (Table 2A-C).

SYBRGreen qPCR Thermo-cycle Conditions:

Denaturation (1 cycle)


95°C 10 minutes 4.4°C /s

Amplification (40

cycles)





Cooling (1 cycle)



Wavelength Channel: 450-533

qPCR Data reporting and analysis

Please following the main IFU (instruction for use) to complete and submit the data reporting file

for qPCR.

◄ Single Acquisition

WHO/BS/2019.2373

Appendix VIII

Example Digital PCR Protocol for Collaborative Study

Participants are encouraged to use their in-house study protocol to evaluate the samples. In

the case of no in-house protocol available, the following example protocols can be considered.

Materials

• Samples A, B, C, D and E are provided as lyophilised genomic DNA in glass ampoules

• Primers for LV and HK are provided as primer sets and as a 10-fold strength of a stock

solution at 100µM solution in H2O. You can use the provided two NIBSC primer sets

together in a test, or you can use one set of the provided NIBSC primers, e.g. HK, in

combination with a set of your in-house primers, e.g. in-house LV primers, and vice versa,

in a test. The provided primer sequences are given in Table 5.

• You do not need to use the primers provided if you have in-house primers available.

Reagents are required but not provided and hence, are to be provided or procured by participants:

• QX200™ ddPCR™ EvaGreen Supermix #1864034 (BioRad)

• RNAse/DNAse-free H2O.

• DNAse/RNAse-free microtubes.

• DNAse/RNAse-free filter tips.

• 96-well qPCR plates and seals.

• Droplet generator in the QX200™ Droplet Digital™ PCR System

• ddPCR™ 96-Well Plates #12001925 (BioRad)

• Pierceable Foil Heat Seal #1814040 (BioRad)

• Automated Droplet Generation Oil for EvaGreen #1864112 (BioRad)

• DG32™ Cartridge for Automated Droplet Generator #186-4108

• PX1 PCR Plate Sealer #1814000 (BioRad)

• QX100™ Droplet Reader and QuantaSoft™ Software #186-3001

• A spectrophometer for measuring the DNA concentrations.

It is recommended to prepare all solutions and perform the assays in a PCR cabinet or suite

with usual precautions for PCR experiments.

Digital PCR Sample Preparation:

• Prepare the glass ampoules as instructed in the IFU (Instruction for Use).

• Reconstitute the 5 provided samples A, B, C, D and E as detailed in Table 1, to give rise to

4 samples A+E, B, C and D. Please note that you do not need to prepare and test samples

C1, C2, C3 and C4 for digital PCR.

WHO/BS/2019.2373

• Using restriction enzyme DraI to digest the 4 reconstituted samples A+E, B, C and D as

detailed below

• Prepare 1:50 dilution of DraI (20U/µL) in 1x CutSmart buffer as below to give rise to

working DraI solution at 0.4U/µL, as detailed in the following table.

Reagent Volume

(µL)

H2O 44

CutSmart Buffer

(10X)

5

DraI enzyme

(20U/µL)

1

Total volume 50

• Digest 4.4µL of the reconstituted DNA samples A+E, B, C, and D in individual tubes as

detailed in the following Table.

• Mix well and briefly centrifuge the tubes to collect samples

• Incubate the samples at 37°C for 30 minutes

• Heat inactivate the enzyme at 65°C for 5 minutes

• Briefly centrifuge the tubes to collect all samples

• Proceed to the following steps immediately or store the samples at 4oC before use within

the same day.

Digital PCR Primer Preparation:

• Dilute both the provided 100µM LV primer set and 100µM HK primer set to make 2µM

working primer solutions in H2O.

Reagent Volume

(µL)

Sample A+E, B, C or D 4.4

H2O 41.6

Diluted DraI enzyme

(0.4U/µL)

4

Total volume 50

WHO/BS/2019.2373

Digital qPCR Master Mix Preparation:

• Prepare 340µL of digital qPCR Master mix for digital PCR targeting lentivirus (LV) using

LV primer set as detailed in the following Table. The prepared 340µL solution is intended

for loading into 16 wells at 17µL per well.

Reagent For 1 well

(µL)

For 20 wells

(µL)

Final

concentration

H2O 5.2 104 -

LV Primer set (2µM) 0.8 16 0.8µM

EvaGreen Supermix (2X) 11 220 2X


Then:


(µL) 17 17



• Prepare 340µL of digital PCR Master Mix for digital PCR targeting House-keeping gene

(HK) using HK primer set as detailed in the following Table. The prepared 340µL solution

is intended for loading into 16 wells at 17 µL per well.

Reagent

For 1

well

(µL)

For 20 wells

(µL)

Final

concentration

H2O 5.2 104 -

HK Primer (2µM) 0.8 16 0.8µM

EvaGreen Supermix (2X) 11 220 1X


Then:


(µL) 17 17


Total volume per well (µL) 22µL 22

WHO/BS/2019.2373

Digital qPCR Plate Preparation:

• Vortex and briefly centrifuge the LV and HK Master Mix solutions before loading to the

plates, to collect the solutions and to ensure they are sufficient for loading to 16 wells.

• Load 17µL per well of the LV Master Mix containing LV primers to 16 wells that are

designated for assay of Lentivirus sequences and are highlighted in green (Table 3A-C in

the main IFU).

• Load 17µL per well of the HK Master Mix containing HK primers to 16 wells that are

designated for assay of HK sequences and are highlighted in blue (Table 3A-C in the main

IFU).

• Load 5µL per well of the prepared 4 testing samples, i.e. A+E, B, C and D (Table 1), in

triplicate following the digital PCR plate layout provided (Table 3A-C in the main IFU).

• Load 5µL per well of RNAse/DNAse-free H2O in the 4 corresponding wells designated

for H2O as a negative control, following the digital PCR plate layout provided (Table 3A-

C in the main IFU).

• Mix gently by pipetting up and down after individual loadings of samples or H2O. Avoid

air bubbles.


Master Mix and 5µL samples. The preparation of a total 22µL per well is to ensure

sufficient samples for subsequent droplet generation of 20µL sample per well.

• Seal the plate with a pierceable heat seal foil film.

• Centrifuge the plate at ~400g for 1 minutes to collect all samples at the bottom of the wells.

• Follow the Bio-Rad protocol to generate droplets using the droplet generator in the

QX200™ AutoDG™ Droplet Digital™ PCR System. The QX200™ AutoDG™ Droplet

Digital™ PCR System is set to automatically take 20 µL samples with equal volume of

droplet generation oil to generate a final volume of 40µL droplets for PCR amplification.

• Perform PCR on the prepared DNA droplets using a PCR machine, e.g. C1000 touch

PCR machine (BioRad) and, following the thermocycle condition below

PCR Cycling Conditions:

Steps Temp. Time Cycles

Initial Denaturation 94°C 10 min 1

Denaturation 94°C 30 Sec

40 Annealing 58°C 1 min

Extension 72°C 1 min

Final Extension 98°C 10 min 1

Hold 4°C ∞

• Read droplets using QX200™ Droplet Digital™ PCR System.

• Acquire the copies per well data point for both the LV sample and HK sample using

Quantasoft (Version 1.7) (BioRad).

• Repeat the test twice using two new sets of samples on two separate days as day 2 or day

3 assay, following the plate layout for the corresponding days (Table 3A-C).

Digital Data reporting and analysis

WHO/BS/2019.2373

Please following the main IFU (instruction for use) to complete and submit the data reporting file

for digital PCR.

Appendix IX

Participant Response Form

Dear Participant,

Please answer the following questions regarding the report:

Laboratory:

Have your details/data been correctly reported?

YES / NO

Do you agree with the proposed unitage for the candidate materials?

0 LV copies/cell for Sample A+E (18/142)

1.41 LV copies/cell for Sample B (18/126)

8.63 LV copies/cell for Sample C (18/132)

10.57 LV copies/cell for Sample D (18/144)

YES / NO

Do you agree with the proposal to establish the three materials, i.e. A/E (18/142), B (18/126)

and C (18/132), as the WHO 1st International Standard panel for lentiviral vector Integration

copy number quantitation?

YES / NO

Do you agree with the proposal for sample D (18/144) to be used as an International

Reference Material in LV integration site analysis?

YES / NO

Will you see the need to develop a WHO DNA Standard for the detection and quantitation

of Replication Competent Lentivirus?

YES / NO

WHO/BS/2019.2373

Please report additional comments, if any:

Sign: Name: Date

Please return your comments by 15th June 2019 by email to [email protected]

Note: proposed values shown on this form have now been changed following the amended

results submitted participants.

Appendix X

Instructions for Use

for the to be Established WHO Standard Panel


WHO/BS/2019.2373

WHO/BS/2019.2373

Appendix XI

NIBSC Publication on the development of Candidate Materials


Appendix XII

Relevant Publications (2019-2000) on LV Copy Quantitation

Publications (2019- 2000) on LV copy quantitation Method Standard Unitage

1 A safe and potent anti-CD19 CAR T cel therapy (2019) From <https://www.ncbi.nlm.nih.gov/pubmed/28976817>

qPCR gDNA LV/293T

mass

2 In vivo expansion and antitumor activity of coinfused CD28 and CD4-1BB-engineered CAR-T cells in patients with B cell leukemia (2018) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6079368/

qPCR ND /mass

3 Activity of mesothelin-specific chimeric antigen receptor T cells against pancreatic carcinoma metastases in a phase 1 trial (2018) https://www.ncbi.nlm.nih.gov/pubmed/29567081

qPCR ND detectable

4 Chimeric antigen receptor T cells in Refractory B cell lymphoma (2017)

https://www.ncbi.nlm.nih.gov/pubmed/29226764 qPCR ND /cell

5 Hematopoietic Stem-Cell Gene Therapy for Cerebral Adrenoleukodystrophy (2017) From <https://www.ncbi.nlm.nih.gov/pubmed/28976817> qPCR gDNA /haploid cell

genome

6 Lentiviral Vectors with Cellular Promoters Correct Anemia and Lethal Bone Marrow Failure in a Mouse Model for Diamond-Blackfan Anemia (2017)

From <https://www.sciencedirect.com/science/article/pii/S1525001617301612> qPCR NA sites

7 Efficacy of lentivirus-mediated gene therapy in an Omenn syndrome recombination-activating gene 2 mouse model is not hindered by inflammation and immune dysregulation (2017) From <http://www.jacionline.org/article/S0091-6749(17)31886-9/abstract>

qPCR

ND /cell genome

8 Clinical efficacy of gene-modified stem cells in adenosine deaminase–deficient immunodeficiency (2017) From <https://www.jci.org/articles/view/90367>

ddPCR NA /cell

9 Clinical and immunological responses after CD30-specific chimeric antigen receptor–redirected lymphocytes (2017) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5669573/

qPCR

plasmids /mass

10 Intent-to-treat leukemia remission by CD19 CAR T cells of defined formulation and dose in children and young adults (2017) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5482103/

qPCR

ND detectable

11 Autologous T Cells Expressing CD30 Chimeric Antigen Receptors for Relapsed or Refractory Hodgkin Lymphoma: An Open-Label Phase I Trial (2017) http://clincancerres.aacrjournals.org/content/23/5/1156.long#ref-9

qPCR

plasmid /mass

12 Phase I trials using Sleeping Beauty to generate CD19-specific CAR T cells. (2016). <https://www.ncbi.nlm.nih.gov/pubmed/27482888> ddPCR

qPCR NA /cell

13 CD19 CAR–T cells of defined CD4+:CD8+ composition in adult B cell ALL patients (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4887159/

qPCR

ND detectable

14 GD2-specific CAR T Cells Undergo Potent Activation and Deletion Following Antigen Encounter but can be Protected From Activation-induced Cell Death by PD-1 Blockade (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4923328/

qPCR

ND /mass


https://www.ncbi.nlm.nih.gov/pubmed/28976817





https://www.sciencedirect.com/science/article/pii/S1525001617301612

http://www.jacionline.org/article/S0091-6749(17)31886-9/abstract

https://www.jci.org/articles/view/90367



http://clincancerres.aacrjournals.org/content/23/5/1156.long#ref-9




WHO/BS/2019.2373

15 Third-generation CD28/4-1BB chimeric antigen receptor T cells for chemotherapy relapsed or refractory acute lymphoblastic leukaemia: a non-randomised, open-label phase I trial protocol (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5223707/

qPCR

ND /cell

16 Predominant cerebral cytokine release syndrome in CD19-directed chimeric antigen receptor-modified T cell therapy (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4986179/

qPCR

ND /mass

17 Outcome following Gene Therapy in Patients with Severe Wiskott-Aldrich Syndrome (2015)

From <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4942841/> qPCR

ND /cell

18 Tolerance and efficacy of autologous or donor-derived T cells expressing CD19 chimeric antigen receptors in adult B-ALL with extramedullary leukemia (2015) https://www.tandfonline.com/doi/full/10.1080/2162402X.2015.1027469

qPCR

plasmid /mass

19 Phase I Hepatic Immunotherapy for Metastases study of intra-arterial chimeric antigen receptor modified T cell therapy for CEA+ liver metastases (2015) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4506253/

qPCR

plasmid /cell genome

20 Effective response and delayed toxicities of refractory advanced diffuse large B-cell lymphoma treated by CD20-directed chimeric antigen receptor-modified T cells (2014) https://www.sciencedirect.com/science/article/pii/S1521661614002381?via%3Dihub#bb0070

qPCR

plasmid /cell

21 Closely related T-memory stem cells correlate with in vivo expansion of CAR.CD19-T cells and are preserved by IL-7 and IL-15 (2014) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4055922/

qPCR

ND /cell

22 Dual-regulated Lentiviral Vector for Gene Therapy of X-linked Chronic Granulomatosis (2013) From <https://www.sciencedirect.com/science/article/pii/S1525001616307444?via%3Dihub#cesec100> qPCR

gDNA /cell genome

23 Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy (2013) From <https://www.ncbi.nlm.nih.gov/pubmed/23845948>

qPCR

gDNA /cell genome

24 Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome (2013) From <https://www.ncbi.nlm.nih.gov/pubmed/23845947>

qPCR

ND /cell genome

25 Lentivirus-based gene therapy of hematopoietic stem cells in wiskott-Aldrich syndrome (2013)

qPCR gDNA /cell genome

26 Mesothelin-specific Chimeric Antigen Receptor mRNA-Engineered T cells Induce Anti-Tumor Activity in Solid Malignancies (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3932715/

qPCR

ND expression

27 Donor-derived CD19-targeted T cells cause regression of malignancy persisting after allogeneic hematopoietic stem cell transplantation (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3862276/

qPCR

ND detectable

28 Infusion of donor-derived CD19-redirected virus-specific T cells for B-cell malignancies relapsed after allogeneic stem cell transplant: a phase 1 study (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3811171/

qPCR

plasmid /mass

29 Preclinical safety and defficacy of human CD34+ cells transduced with lentiviral vector for the treatment of Wiskott-aldrich syndrome

qPCR gDNA /genome

30 Persistence and Efficacy of Second Generation CAR T Cell Against the LeY Antigen in Acute Myeloid Leukemia (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3831035/

qPCR

plasmid /cell

31 Treatment of Metastatic Renal Cell Carcinoma With CAIX CAR-engineered T cells: Clinical Evaluation and Management of On-target Toxicity (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5189272/

qPCR

plasmid /cell

32 CD20-specific adoptive immunotherapy for lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domains: pilot clinical trial results (2012) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3350361/

qPCR

plasmid /cell

33 A phase I clinical trial of adoptive transfer of folate receptor-alpha redirected autologous T cells for recurrent ovarian cancer (2012) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3439340/

qPCR

NA sites

34 Decade-Long Safety and Function of Retroviral-Modified Chimeric Antigen Receptor T-cells (2012) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4368443/

qPCR

ND /106cells

35 Retroviral gene therapy for X-linked chronic granulomatous disease: results from phase I/II trial. (2011)

From <https://www.ncbi.nlm.nih.gov/pubmed/21878903> qPCR

NA sites




https://www.tandfonline.com/doi/full/10.1080/2162402X.2015.1027469


https://www.sciencedirect.com/science/article/pii/S1521661614002381?via%3Dihub#bb0070


https://www.sciencedirect.com/science/article/pii/S1525001616307444?via%3Dihub#cesec100












WHO/BS/2019.2373

36 Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. (2011)

From <https://www.ncbi.nlm.nih.gov/pubmed/21243617>

qPCR ND sites

37 Antitumor activity and long-term fate of chimeric antigen receptor–positive T cells in patients with neuroblastoma (2011) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3234664/

qPCR

gDNA /cell

38 CD28 costimulateion improves expansion and persistence of chimeric antigen receptor-modified T cells in lymphoma pateients (2011 file:///C:/Users/yzhao/OneDrive%20-%20MHRA/RSS%202019/2019%20RM/RM%20Dossier/2019_WHO%20Collaborative%20study/Report%20Discussion/Ref%20LV%20intG%20analysis/z_JCI46110.pdf

qPCR plasmid /mass

38 Transfusion independence and HMGA2activation after gene therapy of human β-thalassaemia (2010) From <https://www.nature.com/articles/nature09328#methods-summary>

qPCR

qDNA /cell

40 Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. (2009) From <https://www.ncbi.nlm.nih.gov/pubmed/19892975>

qPCR

gDNA /haploid

genome

41 Virus-specific T cells engineered to coexpress tumour-specific receptors: persistence and antitumor activity in individuals with neuroblastoma

qPCR gDNA /cell

42 Parallel detection of transduced T lymphocytes after immunogene therapy of renal cell cancer by flow cytometry and real time polymerase chain reaction: implications for loss of transgene expression https://www.liebertpub.com/doi/pdf/10.1089/hum.2005.16.1452

qPCR plasmid /cell

43 Human T lymphocyte genetic modification with naked DNA (2000)

https://www.sciencedirect.com/science/article/pii/S1525001699900126?via%3Dihub qPCR plasmid /cell

Note: ND: no details given; NA: not applicable

Appendix XIII

References

1. Stepanenko A and Dmitrenko V. HEK293 in cell biology and cancer research: phenotype,

karyotype, tumorigenicity, and stress-induced genome-phenotype evolution. Gene. 2015

Sep 15;569(2):182-90. doi: 10.1016/j.gene.2015.05.065.

2. Lin Y, Boone M, Meuris L et al. Genome dynamics of the human embryonic kidney 293

lineage in response to cell biology manipulations. Nature Communications. 2014 Sep

3;5:4767. doi: 10.1038/ncomms5767.

3. Jacobs J, Jones C, Baille J. Characteristics of a human diploid cell designated MRC-5.

Nature. 1970 Jul 11;227(5254):168-70.

4. Zufferey R, Dull T, Mandel R, et al. Self-inactivating lentivirus vector for safe and efficient

in vivo gene delivery. Journal of Virology 1998;72:9873–80

5. Cavazzana-Calvo M, Payen E, Negre O, et al. Transfusion independence and HMGA2

activation after gene therapy of human [bgr]-thalassaemia. Nature 2010;467:318-322.

6. Heckl D, Schwarzer A, Haemmerle R, et al. Lentiviral vector induced insertional

haploinsufficiency of Ebf1 causes murine leukemia. Molecular Therapy 2012;20:1187-

1195.

7. Arumugam P, Higashimoto T, Urbinati F, et al. Genotoxic potential of lineage-specific

lentivirus vectors carrying the β-globin locus control region. Molecular Therapy

2009;17:1929-1937.



https://www.nature.com/articles/nature09328#methods-summary


https://www.liebertpub.com/doi/pdf/10.1089/hum.2005.16.1452

https://www.sciencedirect.com/science/article/pii/S1525001699900126?via%3Dihub

WHO/BS/2019.2373

8. Montini E, Cesana D, Schmidt M, et al. The genotoxic potential of retroviral vectors is

strongly modulated by vector design and integration site selection in a mouse model of

HSC gene therapy. The Journal of Clinical Investigation 2009;119:964-975.

9. Charrier S, Ferrand M, Zerbato M, et al. Quantification of lentiviral vector copy numbers

in individual hematopoietic colony-forming cells shows vector dose-dependent effects on

the frequency and level of transduction. Gene Therapy 2011;18:479-487.

10. Zhao Y, Stepto H, Schneider C. Development of the First World Health Organization

Lentiviral Vector Standard: Toward the Production Control and Standardization of

Lentivirus-Based Gene Therapy Products. Human Gene Therapy Methods. 2017

Aug;28(4):205-214. doi: 10.1089/hgtb.2017.078.

11. Roberts PL, Lloyd D. Virus inactivation by protein denaturants used in affinity

chromatography. Biologicals. 2007 Oct;35(4):343-7.

12. Jesen MC, Clarke P, Tan G et al. Human T lymphocyte genetic modification with naked

DNA. Molecular Therapy. 2000;1:49-55.

13. Till BG, Jensen MC, Wang J et al. CD20-specific adoptive immunotherapy for

lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domanis: pilot

clinical trial results. Blood. 2012;119:3940-3950.

14. Scholler J, Braydy TL, Binder-Scholl G et al. Decade-long safety and function of

retroviral-modificed chimeric antigen receptor T cells. Sci Transl Med. 2015; 4:1-16.

15. R Core Team (2018). R: A language and environment for statistical computing. R

Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/.

16. Mair P, Schoenbrodt F, and Wilcox R. WRS2: Wilcox Robust Estimation and Testing,

2017. 0.9-2.

17. Bustin S, Benes V, Garson JA, et al. The MIQE guidelines: minimum information for

publication of quantitative real-time PCR experiments. Clinical Chemistry. 2009;55:611–

622. doi: 10.1373/clinchem.2008.112797.

expert committee on biological ......who/bs/2019.2373 english only expert committee on biological...

Documents