exploring human identification applications for the ion torrent personal genome machine sequencing...
TRANSCRIPT
![Page 1: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/1.jpg)
Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine
(PGM™) Sequencing Instrument Human Identification Group, Life Technologies
![Page 2: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/2.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 2
07/02/12
Agenda • Overview of PGM™ instrument technology and chemistry
• Overview of PGM™ instrument workflow
• Potential applications of PGM™ instrument for human identification
• Early feasibility studies
• Future plans
![Page 3: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/3.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 3
07/02/12
Genotyping by Fragment Analysis or Sequencing
3500 Genetic Analyzer Fragment or sequence analysis by fluorescent
detection
Y-STR Haplotype
SNP Genotype
mtDNA Haplotype
Microbial ID
STR Genotype
Ion Torrent PGM™ Sequence analysis by
proton detection
![Page 4: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/4.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 4
Human Identification Applications on PGM™
STRs Mito SNPs
Short Tandem Repeats
Mitochondrial DNA
Single Nucleotide
Polymorphisms
![Page 5: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/5.jpg)
07/02/12
PGM™ Instrument Technology
![Page 6: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/6.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 6
07/02/12
PGM™
One Touch Instruments Emulsion PCR and Enrichment
Instruments Semiconductor Chip
Sequencing Chemistry • Natural nucleotides • Natural enzymes
Sample Prep • Libraries • Clonal beads
Reagents Torrent Server
Informatics
The Ion Torrent PGM™ Instrument System
![Page 7: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/7.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 7
07/02/12
Ion Technology Core Principles
• Scalability • Semiconductor technology • 40 years of Moore’s law
• Simplicity • Natural nucleotides • No lasers • No optics • No camera • No fluorescence • No enzyme cascade
• Speed • Rapid detection of sequence
extension The Chip is the Machine TM
7
![Page 8: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/8.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 8
07/03/12
Scalable Semiconductor Technology
Wafer Semiconductor Manufacturing
Chip Semiconductor Packaging
Chip Cross Section Semiconductor Design
![Page 9: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/9.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 9
Semiconductor Scalability
▲ Ion 314 >150 Mb
▲ Ion 316 >850 Mb
▲ Ion 318 >1400 Mb
![Page 10: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/10.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 10
07/03/12
Sanger Sequencing Method for CE
![Page 11: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/11.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 11
07/03/12
PGM™ Instrument uses Simple Natural Chemistry
![Page 12: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/12.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 12
07/03/12
1
2
3
4
5
1 Nucleotide bases (dNTP’s) are sequentially flowed into well one at a time
2 Upon incorporation, the nucleotide releases a hydrogen ions which creates a pH change in the well
3 Sensing layer detects the change in pH
4 Sensing plate translates the chemical signal to a digital signal
5 Voltage detected is proportional to number of bases incorporated
Electric voltage measurement
Detection Chemistry on the PGM™ Instrument
Sensor Plate
Silicon Substrate
Drain Source Bulk
∆ pH
∆ V
Sensing Layer
Schematic cross-section of a single well on a Ion Torrent sequencing chip
Bead with clonally amplified template
![Page 13: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/13.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 13
07/03/12
Demonstration of the Chemistry
![Page 14: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/14.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 14
07/02/12
Data Output is an Ionogram • An “Ionogram” is the output of the signals in flow space
• Must be read “up-and-down” along with “left-to-right”
• Height of bar indicates how many nucleotides incorporated during flow
• “Negative” or “zero” flows indicate no nucleotide incorporation • These observations are omitted when converting to nucleotide space
Key Sequence
Sequence: …AATCTTCTGAATTTCTGCAA…. (TTT)
(AA) (AA)
![Page 15: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/15.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 15
07/03/12
Summary of Technology
• Based on semiconductor technology • Simple, natural nucleotides • Nucleotides are flowed into chip one at a time • Nucleotide incorporation releases a H+ proton • Measure pH change by change in voltage • Voltage detected is proportional to number of bases
incorporated • Nucleotide sequence displayed as an Ionogram
![Page 16: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/16.jpg)
07/02/12
PGM™ Instrument Workflow
![Page 17: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/17.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 17
07/02/12
PGM™ Workflow
OneTouch™ OneTouch™ES PGM™ AutoMate Express™ Torrent Server & Torrent Browser
![Page 18: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/18.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 18
07/03/12
OneTouch™ and OneTouch ES™ Instruments
Biotinylated Template + ISP
MyOne Bead + Streptavidin
Non-Templated ISP
emPCR®
Enrichment
![Page 19: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/19.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 19
07/03/12
Sequencing the Targeted Amplicons
Loading Port
![Page 20: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/20.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 20
07/02/12
Ion Torrent™ Server for Data Analysis
Desktop Analysis
Plugin Store (Ion Community)
Plug-Ins Cloud Analysis
NextBioXfr (Plug-In)
Torrent Server Torrent Browser Run Reports Plug-Ins
HID_SNP_Genotyper variantCallerForMtDNAAlignment (TMAP) RNA-seq (IsoEM) U. Connecticut Variant Annotation (SNPeff) Edge Biosystems De novo assembly (MIRA)
![Page 21: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/21.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 21
07/03/12
Ion Torrent™ Product Workflow
Individual Step Application Specific
Multiplex Step Generic
Multiplex Step Generic
Multiplex Step Application Specific
![Page 22: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/22.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 22
07/02/12
Ion Community http://ioncommunity.iontorrent.com
PGM™ Users − Site prep − User guides − FAQs − Videos − Discussion Forum
Torrent Suite − Torrent Suite Guides − Release notes − File formats − Database schema
![Page 23: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/23.jpg)
07/02/12
Potential Human Identification Applications for PGM™ Instrument
![Page 24: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/24.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 24
Human Identification Applications on PGM™
STRs Mito SNPs
Short Tandem Repeats
Mitochondrial DNA
Single Nucleotide
Polymorphisms
![Page 25: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/25.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 25
07/03/12
Common STR Genotyping Technologies
• Capillary electrophoresis • Detection of STR loci by fragment length and fluorescence
• Mass spectroscopy • Sequence differences in STR alleles but not location
Identifiler® Kit
![Page 26: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/26.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 26
07/03/12
PGM for STR Genotyping • Allows large number of STR loci to be sequenced simultaneously
• Combine autosomal, Y, X STR markers • Increased discrimination from SNPs in repeats or flanking regions
• Allows identification of up to 96 individuals simultaneously on one chip
• Requires 10 ng of DNA input- similar to most NGS platforms • Suitable for reference type samples • Optimization of lower input needed for forensic samples
• May require updated database information • Process/criteria for uploading sequence information and/or SNPs in the profiles • Process/criteria for query of profile
• Convert to length to query existing databases
• Use SNP information for further exclusion capability • Frequency information on SNPs detected
• For the purposes of statistical calculations for inclusion
![Page 27: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/27.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 27
07/02/12
Human Identification Assays on PGM™ Mitochondrial DNA Sequencing
Missing person/verification of human remains
Genealogical research
![Page 28: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/28.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 28
07/03/12
MOST COMMON APPROACH - Sanger sequence with BDT v1.1 chemistry
Mitochondrial DNA Sequencing Methods
SNaPShot for mito coding region SNPs
![Page 29: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/29.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 29
07/02/12
PGM™ for Mitochondrial Sequencing • Able to sequence the whole 16 kb mito genome on one chip with high coverage
• CE requires 90 reactions (26 for PCR, 64 for sequencing) for whole genome sequencing using the MitoSeq protocol
• Able to sequence the control region plus targeted SNPs in the coding region on one chip
• Able to sequence up to 96 individuals on a single chip
![Page 30: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/30.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 30
07/03/12
Mitochondrial Whole Genome Sequencing
Coverage across the mtGenome Number of reads mapped
Mitochondrial genome - 16,569 bases
![Page 31: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/31.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 31
07/03/12
Mitochondrial Whole Genome Sequencing
Coverage
C T
Reference
Zoomed into Polymorphisms
![Page 32: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/32.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 32
07/03/12
Mitochondrial Haplotypes H
AP
LOG
RO
UP
A
SS
EM
BLY
![Page 33: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/33.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 33
Potential Human Identification Assays on PGM™
• SNP genotyping • Missing person identification • Paternity • DVI • Molecular “phenotype”
• Phenotypic SNPs for investigative leads
Eye color
Hair color
Facial reconstruction
![Page 34: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/34.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 34
07/02/12
Features of SNPs • Abundant in the human genome (~9 million)
• 90% of human genetic variation comes from SNPs • SNPs occur about every 300 bp; coding and non-coding regions • Most SNPs are biallelic • Low mutation rate (1 X 10-9 per locus per generation) • High heterozygosity & low population heterogeneity • Small amplicon size
![Page 35: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/35.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 35
07/03/12
Common SNP Technologies • Allele discrimination methods
• Sequencing • Primer extension • Ligation • Hybridization • Enzymatic cleavage
Limitation on number of SNPs detected simultaneously
SNaPshot® Assay
Oligo ligation assay (OLA)
Homozygote 2
Homozygote 1 Heterozygote
TaqMan® Assay
![Page 36: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/36.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 36
07/02/12
PGM™ for SNP Genotyping
• Allows combination of large number of SNPs in one multiplex • Combine autosomal, Y-, X- chromosome and phenotypic SNPs simultaneously
• Allows identification of up to 96 individuals simultaneously on one chip
• Requires 10 ng of DNA input - similar to most NGS platforms • Suitable for reference type samples • Optimization of lower input needed for forensic samples
![Page 37: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/37.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 37
PGM™ for SNP Genotyping
• 136 SNPs – 103 autosomal and 33 Y covered by amplicons < 150bp
• Based on published SNPs with high heterozygosity and low Fst
• Genotype match probabilities of 10-31 - 10-35
Human Identification SNP panel version 01
Each arrow represents one or more SNPs
![Page 38: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/38.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 38
07/03/12
Library Preparation Protocol
Prepare library 10ng DNA input
![Page 39: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/39.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 39
07/03/12
SNP Amplicon Coverage
.
Female - Individual
Y SNPs
Male - Individual
![Page 40: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/40.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 40
HID on ION Community Website
Visit ION Community Website
What’s Available: Protocols, Plug ins, and other Tools Click HID icon Register/Login
ION COMMUNITY PAGE HID PAGE
![Page 41: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/41.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 41
Genotype Calling on PGM™
![Page 42: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/42.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 42
Genotype Calling on PGM™
SNPs
![Page 43: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/43.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 43
07/02/12
Ion AmpliSeq™ Technology: Designer or Custom Panels
Single-tube ultra-high multiplex PCR, single day workflow More Info @ www.ampliseq.com
+ Up to 6,144 primer pairs per tube
10 ng gDNA
Construct Library Prepare Template Run Sequence Analyze Data Customize Panel
![Page 44: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/44.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 44
07/03/12
Summary Demonstrated Applications for HID
• Whole mitochondrial genome of five individuals sequenced on 1 chip
• Autosomal and Y SNPs from multiple individuals sequenced on 1 chip
• 314 chip mean high quality coverage was 50x for mitochondrial genome and 1000x for SNPs
• Barcodes enable sequencing multiple samples on 1 chip
![Page 45: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/45.jpg)
8/16/2012 | Life Technologies™ Proprietary and confidential 45
07/03/12
Future Plans • Investigate potential external collaborators for research applications on
the PGM
• Explore potential research protocols • for whole mitochondrial genome sequencing for reference sample • for sequencing large SNP multiplexes for reference samples
• Investigate sequencing of other human or microbial identification markers
![Page 46: Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing Instrument](https://reader033.vdocuments.net/reader033/viewer/2022052603/55d56d83bb61eb19128b460f/html5/thumbnails/46.jpg)
07/03/12
Thank You
© 2012 Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners.
Refer to product page on the Life Technologies website for Limited Use License.
The content provided herein may relate to products that have not been officially released and is subject to change without notice.