exposure of marine mussels mytilus spp. to polystyrene...

lable at ScienceDirect

Environmental Pollution xxx (2016) 1e14

Contents lists avai

Environmental Pollution

journal homepage: www.elsevier .com/locate/envpol

Exposure of marine mussels Mytilus spp. to polystyrene microplastics:Toxicity and influence on fluoranthene bioaccumulation*

Ika Paul-Pont a, *, Camille Lacroix a, b, Carmen Gonz�alez Fern�andez c, H�el�ene H�egaret a,Christophe Lambert a, Nelly Le Goïc a, Laura Fr�ere a, Anne-Laure Cassone a,Rossana Sussarellu d, Caroline Fabioux a, Julien Guyomarch b, Marina Albentosa c,Arnaud Huvet e, Philippe Soudant a

a Laboratoire des Sciences de l’Environnement Marin (LEMAR), UMR 6539 CNRS/UBO/IRD/IFREMER e Institut Universitaire Europ�een de la Mer, TechnopoleBrest-Iroise e Rue Dumont d’Urville, 29280 Plouzan�e, Franceb CEDRE, 715 rue Alain Colas, 29218 BREST Cedex 2, Francec Instituto Espa~nol de Oceanografía, IEO, Centro Oceanogr�afico de Murcia, Varadero 1, E-30740 San Pedro del Pinatar, Murcia, Spaind Ifremer, Laboratoired’Ecotoxicologie, Nantes, Francee Ifremer, Laboratoire des Sciences de l’Environnement Marin (LEMAR), UMR 6539 UBO/CNRS/IRD/Ifremer), Centre Bretagnee ZI de la Pointe du Diable e CS10070, 29280 Plouzan�e, France

a r t i c l e i n f o

Article history:Received 28 July 2015Received in revised form3 June 2016Accepted 18 June 2016Available online xxx

Keywords:MicroplasticsFluorantheneMusselDepurationOxidative system

* This paper has been recommended for acceptanc* Corresponding author.

E-mail address: [email protected] (I. Paul

http://dx.doi.org/10.1016/j.envpol.2016.06.0390269-7491/© 2016 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Paul-Poninfluence on fluoranthene bioaccumulation,

a b s t r a c t

The effects of polystyrene microbeads (micro-PS; mix of 2 and 6 mm; final concentration: 32 mg L�1) aloneor in combination with fluoranthene (30 mg L�1) on marine musselsMytilus spp. were investigated after 7days of exposure and 7 days of depuration under controlled laboratory conditions. Overall, fluoranthenewas mostly associated to algae Chaetoceros muelleri (partition coefficient Log Kp ¼ 4.8) used as a foodsource for mussels during the experiment. When micro-PS were added in the system, a fraction of FLUtransferred from the algae to the microbeads as suggested by the higher partition coefficient of micro-PS(Log Kp ¼ 6.6), which confirmed a high affinity of fluoranthene for polystyrene microparticles. However,this did not lead to a modification of fluoranthene bioaccumulation in exposed individuals, suggestingthat micro-PS had a minor role in transferring fluoranthene to mussels tissues in comparison withwaterborne and foodborne exposures. After depuration, a higher fluoranthene concentration wasdetected in mussels exposed to micro-PS and fluoranthene, as compared to mussels exposed to fluo-ranthene alone. This may be related to direct effect of micro-PS on detoxification mechanisms, as sug-gested by a down regulation of a P-glycoprotein involved in pollutant excretion, but other factors such asan impairment of the filtration activity or presence of remaining beads in the gut cannot be excluded.Micro-PS alone led to an increase in hemocyte mortality and triggered substantial modulation of cellularoxidative balance: increase in reactive oxygen species production in hemocytes and enhancement ofanti-oxidant and glutathione-related enzymes in mussel tissues. Highest histopathological damages andlevels of anti-oxidant markers were observed in mussels exposed to micro-PS together with fluo-ranthene. Overall these results suggest that under the experimental conditions of our study micro-PS ledto direct toxic effects at tissue, cellular and molecular levels, and modulated fluoranthene kinetics andtoxicity in marine mussels.

© 2016 Elsevier Ltd. All rights reserved.

1. Introduction

Pollution of the oceans by microplastics, defined as plastic

e by Baoshan Xing.

-Pont).

t, I., et al., Exposure of marEnvironmental Pollution (20

particles of size below <5 mm (NOAA, 2008), originate from theaccidental release of primary manufactured plastic particles ofmicrometric size used in many industrial and household activities(blasting, exfoliates, toothpastes, synthetic clothing), as well asfrom the fragmentation of larger plastics in the environment(Andrady, 2011). Quantitative studies on micro-debris in openoceans and in intertidal zones in the vicinity of industrial cities

ine mussels Mytilus spp. to polystyrene microplastics: Toxicity and16), http://dx.doi.org/10.1016/j.envpol.2016.06.039

mailto:[email protected]

www.sciencedirect.com/science/journal/02697491

http://www.elsevier.com/locate/envpol

http://dx.doi.org/10.1016/j.envpol.2016.06.039



I. Paul-Pont et al. / Environmental Pollution xxx (2016) 1e142

have confirmed the ubiquitous nature of microplastics (Eriksenet al., 2014). According to these authors, microplastics representmore than 92% of the total plastic debris (>0.33 mm) floating atsea, estimated at 5.25 trillion particles in worldwide marine en-vironments. Ingestion of microplastic by marine organismsleading to substantial impacts on major physiological functionssuch as respiration, nutrition, reproduction, growth and survivalhas been shown in marine vertebrates and invertebrates (for re-view see Wright et al., 2013). In addition to physical injuries, theability of microplastics to efficiently adsorb persistent organicpollutants (POP) has led to an increasing concern related to apotential role of microplastics as vector of POP into marine or-ganisms (Cole et al., 2011; Ivar do Sul and Costa, 2014; Koelmanset al., 2014). Desorption of POP from microplastics was demon-strated to be enhanced under in vitro simulated digestive condi-tions (Bakir et al., 2014). In vivo experiments conducted on fish(Oliveira et al., 2013; Rochman et al., 2013), mussels (Avio et al.,2015) and lugworms (Besseling et al., 2013) revealed the trans-fer of chemicals after ingestion of contaminated microplastics, aswell as combined effects of both contaminants on neurotrans-mission, energy production and oxidative metabolism. However,recent studies questioned the importance of such transfer innatural conditions given (i) the baseline contamination levels ofseawater and marine organisms and (ii) the low proportion ofmicroplastics in comparison with other suspended particles(organic matter, plankton, detritus, etc.) capable of transferringpollutants probably more efficiently due to their higher abun-dance in marine ecosystems (Herzke et al., 2016; Koelmans et al.,2016). Therefore, laboratory studies aiming to understand therelative sorption of POP to microplastics in comparison to otheroccurring media in marine ecosystems are needed to clarify theirrespective role as vector of organic pollutant for marineorganisms.

The present study aims to investigate experimentally (i) theaffinity of fluoranthene (FLU) for polystyrene microparticles(micro-PS) in comparison to phytoplankton by assessing itspartition among seawater, micro-PS, and marine algae Chaeto-ceros muelleri used as a food source for mussels; (ii) whether thepresence of loaded micro-PS alongside with contaminated algaeand seawater may affect FLU bioaccumulation and depuration inmarine mussels Mytilus spp., a common biological model inecotoxicological studies (Kim et al., 2008); and (iii) the effects ofmicro-PS exposure alone or in combination with FLU on variousphysiological parameters at tissue, cellular and molecular levelsto provide a comprehensive assessment of pollutant-related ef-fects (Lyons et al., 2010). Fluoranthene was selected as (i) it is amodel PAH belonging to the list of priority substances in waterpolicy of the European Commission (Directive 2008/105/EC) and(ii) it constitutes one of the most abundant PAH found in theaquatic environment and in molluscs (Baumard et al., 1998;Bouzas et al., 2011). It is noteworthy that in most of the citedstudies, as well as in our work, animals were acclimatized andthen reared in “clean water” (seawater filtered on active carbonfilters in our case) and exposures were performed in clean andcontrolled laboratory conditions. This is far from what mayhappen in natural environments where a wide range of con-founding factors is likely to occur (and influence for instance theinteraction between fluoranthene and polystyrene microplastics).However, due to the high complexity characterizing natural en-vironments, controlled laboratory experiments remain necessaryas a step by step approach for understanding processes, to assessthe weight of each factor (in this case microplastics, food andfluoranthene) and sort out complexity of environmentalpollution.

Please cite this article in press as: Paul-Pont, I., et al., Exposure of marinfluence on fluoranthene bioaccumulation, Environmental Pollution (20

2. Material and methods

2.1. Mussel collection and acclimatization

Mussels (58.6 ± 9.6 mm, mean ± SD) were collected at thePointe d’Armorique in the Bay of Brest (48�19’20.2900N, Brittany,France), a site known to exhibit low PAH concentrations (Lacroixet al., 2015). The sampling site is located within a zone of overlapbetween Mytilus edulis and Mytilus galloprovincialis (Bierne et al.,2003), the mussel population is thus considered as a “speciescomplex” (Lacroix et al., 2014a), and is referred to as Mytilus spp.Mussels were acclimatized in a flow-through aerated 100 L-tanksupplied with natural filtered seawater (20, 10, 5 and 1 mm meshsize; active carbon filter) for 6 weeks. Mussels were fed daily withdiatoms (Chaetoceros muelleri) using peristaltic pumps at a ratio of3% w/w organic matter per gram of mussel tissue (dry weight, dw)during the acclimation phase in order to maintain bivalves inhealthy conditions. The average dry weight was 0.65 g perindividual.

2.2. Mussel exposure

After the acclimation, mussels were transferred to 30 L tanks (24mussels per tank) filled with filtered seawater maintained at17.2 ± 1.3 �C (mean ± SD). Four experimental conditions were set upin triplicates: control, FLU (fluoranthene), micro-PS (polystyrenemicrobeads) and micro-PS þ FLU (fluoranthene and polystyrenemicrobeads). Control mussels were not exposed to any stressor(micro-PS or fluoranthene) and were fed daily with fresh C. muellericulture. Exposed mussels were subjected to daily doses of fluo-ranthene (FLU) set at 30 mg L�1 day�1 and/ormonodisperse yellow-green fluorescent polystyrene beads (micro-PS) (Polysciences)supplied together with the daily prepared algal culture (C. muelleri)for a period of 7 days. Micro-PS of different sizes were used in orderto reflect the spectra of food particles ingested by mussels in nat-ural environments (Ward and Shumway, 2004): 2 mm (1800microbeads mL�1 day�1) and 6 mm (200 microbeads mL�1 day�1)beads, obtaining a final concentration of 2000microbeadsmL�1 day�1. This corresponded to amass concentrationof 32 mg PS L�1 day�1. The leaching of chemicals (styrene, additiveand fluorochrome) and organic compounds from themicro-PS usedin this study was tested; plastics did not release compounds atsignificant levels above 0.1 ng L�1, the detection limit of the tech-nique (Sussarellu et al., 2016).

The stock solution of FLU (98% purity, Sigma Aldrich) was pre-pared in acetone at a concentration of 1 g L�1 before being added tothe algal culture (acetone final concentration in the algal cultureflask <0.04%v/v and in the mussel tank <0.003% v/v). Micro-PSwere added to the algal culture with a light non-ionic detergent(Tween 20 e final concentration in the algal culture flask of0.0001% v/v leading to a final concentration in the mussel tankbelow 0.00001% v/v) in order to minimize micro-PS clumping andsticking to the flask walls. Acetone and Tween 20 were consistentlyadded at the same concentrations to all algal cultures (supplyingcontrol, FLU, micro-PS and micro-PS þ FLU tanks) in order to pre-vent confounding effects due to solvents and detergents. Directimpacts of acetone, tween, FLU and micro-PS were evaluated onalgae over a 24 h period prior to the experiment. No significanteffects were observed on biochemical composition, concentrationand viability of algae (data not shown). The final concentrations ofacetone (0.003%) and Tween-20 (0.00001%) in the experimentaltanks were much lower than the toxic levels reported for marineinvertebrates (Rodrigues et al., 2013; Ostroumov, 2003; Sussarelluet al., 2016).

Once micro-PS and FLU were added to the algal cultures, the


I. Paul-Pont et al. / Environmental Pollution xxx (2016) 1e14 3

daily preparedmixtures were gently stirred for 45min before beingsupplied to the tanks containing the mussels using peristalticpumps (flow rate: 6.5 mL min-1; feeding duration: 5 h). The foodratio for control and exposed mussels was 1.5% organic matter pergram ofmussel tissue per day, corresponding to 2105 cellsmL�1 pertank per day. As the average mass per cell is 45.8 pg cell�1 forC. muelleri (Robert et al., 2004), the quantity of algae added per tankper day was 9.16 mg L�1. The relative proportions of PS/FLU/algaewas around 1/1/289 given the concentration of each component(micro-PS ¼ 32 mg/L; FLU ¼ 30 mg/L; Algae ¼ 9160 mg L�1). In orderto ascertain that themussels efficiently ingested algae andwere notoverfed, water samples were daily collected at the end of thefeeding period to assess the concentration of algae remaining in themussels tanks by flow cytometry. No algae were detected in wateror at the bottom of the tanks, suggesting adequate food con-sumption. Preliminary experiments were performed to ensure thatsorption of fluoranthene inside the peristaltic tubes remainednegligible and that no extra polymer particles were produced bythe tubing wear.

During the 7 days of exposure, mortality monitoring and waterrenewal were performed daily prior to the addition of food (withand without contaminants). At the end of the exposure period,mussels were cleaned (i.e. the shells were carefully brushed andrinsed to avoid any transfer of micro-PS or FLU) and transferred toclean 30 L tanks for 7 days of depuration with similar seawater andfood conditions as those used during the exposure phase.

2.3. Assessment of fluoranthene partition in algal cultures

The partition of fluoranthene among seawater, marine algae andmicro-PS was assessed after 45 min of contact (time for which thealgae cultures started to be supplied to the tanks containing themussels) and also after 5 h of contact (time for which the foodsupply stopped) in the “FLU” and “micro-PS þ FLU” algal cultures.For each time point, 10 ml of each algal culture were sampled andcentrifuged at 2000 rpm for 10 min at 4 �C to pellet the algae. The6 mm beads exhibited similar size and density than C. muelleri cells;therefore it was impossible to discriminate them from the algalcells using classical centrifugation or filtration methods. As aconsequence, >90% of the 6 mm beads were pelleted with the algae.Due to their lower size and density, the 2 mm beads remained insuspension. Microscopical examinations were backed up by flowcytometry analyses to confirm that >95% of the 2 mm micro-PSremained in the supernatant, and >98% of the algae alongsidewith > 90% of the 6 mm beads were pelleted after centrifugation.The supernatant was filtered on a fiberglass filter (Whatman,0.7 mmmesh) to retain the 2 mmmicro-PS. The filter and the filtratewere separately kept to assess the quantity of fluoranthene asso-ciated with the 2 mm microbeads (F2) and dissolved in seawater(Fd), respectively. The pellet (containing algae and the 6 mmmicro-PS) was re-suspended in 4 ml ethanol absolute (molecular grade)and this was used to measure the quantity of fluoranthene asso-ciated with the pellet (Fp). The fractions of FLU dissolved in water(Fd) and associated with the 2 mmmicro-PS (F2) and with the pellet(Fd) were directly measured using a Stir Bar Sorptive Extraction-Thermal Desorption-Gas Chromatography-Mass Spectrometry(SBSE-TD-GC-MS) method as described below. The fraction of FLUassociated with the 6 mm beads (F6) was estimated based on (i) theresults of the quantity of FLU associated to 2 mm beads (F2) and (ii)polymer volume ratio calculations between the 2 mm and 6 mmmicro-PS. The quantity of FLU associated to the algae (Fa) wascalculated by subtracting the estimated quantity of FLU associatedto the 6 mm beads (F6) to the quantity of FLUmeasured in the pellet(Fp). Partition coefficients Kp (L Kg�1) for algae (KpA) and micro-PS(KpMPS) were calculated by dividing the quantity of FLU in mg/kg


associated to algae or micro-PS (2 and 6 mm) by the aqueous phaseconcentration (mg/L).

2.4. Mussel sampling

Mussels were sampled at the end of each phase (exposure¼ T7;depuration ¼ T14). A total of 21 mussels were collected per con-dition: 9 mussels (3 mussels per replicate tank) were collected forhistology and histopathology analyses; 12 mussels (4 mussels perreplicate tank) were collected for hemolymph sampling, FLUquantification, gene expression and enzyme activity. Hemolymphwas withdrawn from the adductor muscle using a 1-ml hypodermicsyringe (25 G needle) before being filtered on 80 mm nylon meshand kept on ice until flow cytometric analyses. The digestive glandand gills of the same animals were dissected in RNase-free condi-tions, snap-frozen in liquid nitrogen, crushed to a fine powder at�196 �C with a mixer mill MM400 (Retsch) and stored at �80 �Cuntil RNA extraction, enzymatic assays and FLU quantification. Forhistological observations, a cross section of mussel tissues(including digestive gland, gills, mantle and gonad) was fixed inmodified Davidson’s solution (Latendresse et al., 2002) for 48 h andfurther processed as described in Fabioux et al. (2005). Microscopicobservations were performed in order to localize the micro-PS intissues. A five-level semi-quantitative scale was established toassess the intensity of histopathological conditions.

2.5. Fluoranthene quantification

FLU was quantified in digestive gland using a Stir Bar SorptiveExtraction-Thermal Desorption-Gas Chromatography-Mass Spec-trometry (SBSE-TD-GC-MS) method described in Lacroix et al.(2014b). FLU was quantified relatively to [2H10]-FLU using a cali-bration curve ranging from 1 ng to 10 mg per bar. The limit ofquantification (LOQ) was 0.2 mg g�1wet weight (WW). Results offluoranthene content in gills and digestive gland were expressed asmg FLU g�1 wet tissue weight (WW).

2.6. Flow cytometric analyses

Morphological and functional analyses of collected hemocyteswere performed on a BD FACSverse flow cytometer (BD Biosciences,France). Hemocyte mortality was assessed according to Haberkornet al. (2010) and expressed as the percentage of dead cells presentin each sample. The concentration of circulating hemocytes (allhemocytes, granulocytes and hyalinocytes) was also determined.Phagocytosis activity was calculated as the percentage of hemo-cytes that ingested three fluorescent beads or more (¼active he-mocytes), while phagocytosis capacity was estimated as theaverage number of beads engulfed by active hemocytes (H�egaretet al., 2003). ROS production was measured using a DCFH-DAassay as described in Lambert et al. (2003) and was expressed asthe mean geometric fluorescence (in arbitrary units, A.U.).

2.7. Antioxidant enzyme activities

An aliquot of 50 mg of grounded digestive gland was homoge-nized (1:4, w/v) in K-phosphate buffer 100 mM, pH 7.6 containing0.15 M KCl, 1 mM DTT and 1 mM EDTA in a sonicator UP 200S (0.5cycle and 60% of amplitude with two rounds of 5 pulses). Sampleswere then centrifuged at 10.000� g for 20min (4 �C). Supernatantswere used for all enzymatic assays as well as protein quantificationaccording to Lowry et al. (1951) by using bovine serum albumin asstandard. Superoxide-dismutase (SOD) was measured using SOD-Assay kit-WST and was expressed in U min�1 mg protein�1. Cata-lase (CAT) was measured according to Claiborne (1985) and



expressed as mmol of H2O2 consumed min�1 mg�1 protein. Gluta-thione reductase (GR) activity was measured according to Ramos-Martinez et al. (1983) and expressed as nmol of NADPH oxidizedmin�1 mg�1 protein. Glutathione S-transferase (GST) wasmeasured according to Habig et al. (1974) and was expressed asnmol min�1 mg protein�1. Lipid peroxidation (LPO) was quantifiedfollowing Buege and Aust (1978) and expressed as nmol MDAmg protein�1.

3. Gene expression analyses

3.1. Total RNA extraction and cDNA synthesis

An aliquot of 50 mg of grounded tissue was homogenized in0.5 ml of Tri Reagent (Ambion) using a Precellys®24 grindercoupled to a Cryolys® cooling system (Bertin technologies) for totalRNA extraction. An aliquot of 40 mg RNA was then treated with theRTS DNase™ Kit (1U/3 mg total RNA, Mo Bio). RNA purity andconcentration were measured using a Nanodrop spectrophotom-eter (Thermo Scientific) and RNA integrity was assessed using RNAnanochips and Agilent RNA 6000 nanoreagents (Agilent Technol-ogies). RNA Integrity Numbers (RIN) were 8.3 ± 1.0 and 6.6 ± 0.6(mean ± standard deviation) for gills and digestive gland samples,respectively. 2.5 mg RNA were reverse-transcribed using theRevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas)with random hexamers. A “reference” cDNA sample was made bypooling the same volume of 10 cDNA samples produced similarlyfrom 10 mussels sampled at the end of the acclimation.

3.2. Real-time quantitative PCR

Real-time PCR was performed using a LightCycler® 480 II(Roche) for 18 target genes and 5 potential reference genes in gillsand digestive gland of each individual. Primer pairs and ampliconcharacteristics (primer sequence, efficiency, product length andmelting temperature) are listed in Table 1. Assays were performedin triplicate according to the protocol described by Lacroix et al.(2014a). PCR efficiency (E) was determined for each primer pairby performing standard curves from serial dilutions. Each PCR runincluded positive (reference cDNA sample) and negative (MilliQwater) controls. For each sample, absence of DNA contaminationafter DNase treatment was assessed by negative reverse-transcription controls on total RNA samples. PCR analysis wasperformed following “MIQE precis guidelines” (Bustin et al., 2009).The stability of several reference genes (ef1a, ef2, rpl7, atub and28srRNA) was assessed using the excel-based Normfinder software(Andersen et al., 2004). Results indicated ef1a, rpl7 and atub werethe most stable genes in gills (lowest stability value of 0.241, 0.286and 0.239, respectively) and in digestive gland (lowest stabilityvalue of 0.174, 0.139 and 0.179, respectively) among the conditions.The geometric mean of these three genes was therefore used as anindex to normalize target gene expression. The normalization indexexhibited a stability value of 0.109 and 0.056 in gills and digestivegland, respectively. Target gene relative expression ratios (R) wereexpressed according to the Pfaffl formula (Pfaffl, 2001):

R ¼Eff ðDCqTargetðreference�sampleÞÞ

Target

Eff ðDCqIndexðreference�sampleÞÞIndex

4. Statistical analyses

All quantitative variables were analyzed using a two-way


ANOVA in order to determine possible interactive effects betweenthe two independent variables called factors (microplastics andfluoranthene) on each parameter that constitutes the dependentvariable (Sokal and Rohlf, 1981). Normality was assumed and ho-mogeneity of variance was verified with Cochran’s test (data werelog10 transformed when homogeneity of variance was not ach-ieved). Percentages of phagocytic and of dead hemocytes werearcsin transformed to meet homogeneity requirements. Intensitiesof histopathological conditions (semi-quantitative data) werecompared statistically using the ManneWhitney U-test to assessdifferences attributable to the conditions (micro-PS, FLU or thecombination of both) after exposure and depuration periods. Alltests were performed using the STATISTICA 10 software forWindows.

5. Results

5.1. Fluoranthene partition in algal cultures

No difference was observed between 45 min and 5 h in thequantity of FLU measured in each fraction (F2, Fd and Fp) sug-gesting that sorption equilibrium occurred. In the FLU condition(i.e. no micro-PS added in the algal culture), fluoranthene wasmainly associated with algae (89%) in comparisonwith the fractionof FLU dissolved in water (11%) (Table 2). Algae exhibited a Log KpAof 4.84. In micro-PSþ FLU condition, the fraction of FLU dissolved inwater was similar (12%) but the fraction of FLU associated to algaewas reduced (67%) and a significant fraction of FLU appearedassociated to the micro-PS (21%). This is reflected by a higher LogKpMPS (6.58) in comparison with Log KpA (4.77) (Table 2).

5.2. Fluoranthene quantification in mussel tissues

At T7, mussels exposed to FLU alone or micro-PS þ FLU showedsimilar concentrations of FLU in gills (12.1 ± 0.8 mg g�1 and13.5 ± 1.1 mg g�1, mean ± SE, respectively) and digestive gland(117.1 ± 10.7 mg g�1 and 89.2 ± 8.4 mg g�1, mean ± SE, respectively)(p > 0.05; Fig. 1). Negligible amounts of FLU (<2 mg g�1) weredetected in tissues of control and micro-PS exposed mussels. AtT14, FLU concentration in gills was similar in mussels exposed toFLU alone or micro-PS þ FLU (4.5 ± 0.5 mg g�1 and 6.2 ± 0.7 mg g�1,respectively) (Fig. 1). In digestive glands, the concentration of FLUwas significantly lower in mussels exposed to FLU alone(36.9 ± 6.7 mg g�1, mean ± SE) than in mussels exposed to micro-PS þ FLU (61.3 ± 4.8 mg g�1, mean ± SE) (p < 0.001; Fig. 1). No FLUwas detected in tissues of control and micro-PS exposed mussels.

5.3. Histology and histopathology

At T7, micro-PS were detected exclusively inside the digestivetract and the intestine of all mussels exposed to micro-PS, regard-less of the exposure to FLU (Fig. 2A). At T14, some microbeads werestill observed in the intestine of mussels exposed to micro-PS andmicro-PS þ FLU (<1e5 beads/histological section/animal). A fewmicro-PS were also observed stuck in the mucus on the outer sideof the gills epithelium (Fig. 2B). There was no observation of micro-PS in any other tissue.

At T7, a significant increase in total histopathological lesions/abnormalities was demonstrated in mussels exposed to FLU, micro-PS and micro-PS þ FLU, in comparison with controls (Fig. 3).Significantly higher hemocyte infiltration and ceroids (stressinduced lipofuscin-pigments) were observed in the stomach anddigestive gland of all mussels exposed to FLU in comparison tomussels exposed to micro-PS alone (Fig. 2 and 3). At T14, signifi-cantly higher histopathological lesions/abnormalities were


Table 1Name, abbreviation, primer pair, efficiency, product length, melting temperature (Tm), and Genbank accession numbers for reference and target genes analyzed in musseltissues exposed to micro-PS and FLU. G: gills, DG: digestive glands, bp: base pair.

Transcript name Abbreviation Forward (50-30) Reverse (50-30) Efficiency(G/DG)

Length(bp)

Tm(�C)

Accession number(species)

Reference

28S rRNA * 28s GGAGGTCCGTAGCGATTCTG CGTCCCCAAGGCCTCTAATC 1.96/1.94 174 81.8 AB103129 (mg) Lacroixet al.,2014a

Elongation factor 1 alpha * ef1a ACCCAAGGGAGCCAAAAGTT TGTCAACGATACCAGCATCC 1.92/1.95 212 79.2 AF063420 (me)/ABA62021 (mg)

Lacroixet al.,2014a

Elongation factor 2 * ef2 GCAGTACATCACCCAGCAAA GTCAACAAGGCCAAGTCCAT 1.89/1.88 249 80.1 FL497408 (mg) Lacroixet al.,2014a

Ribosomal protein L7 * rpl7 CAGAGACAGGCCAAGAAAGG TGGGTAGCCCCATGTAATGT 1.95/1.95 227 81.9 AJ516457 (mg) Lacroixet al.,2014a

alpha-tubuline * atub GGATTCAAGGTCGGAATCAA ACGTACCAATGGACGAAAGC 1.92/1.97 179 83.6 DQ174100 (me)/HM537081 (mg)

Lacroixet al.,2014a

Catalase cat CACCAGGTGTCCTTCCTGTT CTTCCGAGATGGCGTTGTAT 1.86/1.85 235 81.5 AY580271 (me)/AY743716 (mg)

Lacroixet al.,2014a

Cu/Zn-SuperoxideDismutase

sod CATTTCCCAGATCACCAACA GGAACAGTCGCTTTCAGTCA 1.93/1.90 214 82.2 AJ581746 (me)/FM177867 (mg)

Lacroixet al.,2014a

Se-dependant-Glutathione peroxidise

gpx ACGGTAAAGACGCTCATCCAA TCTTGTCACAGGTTCCCATATGAT 2.00/2.06 119 79.7 HQ891311 (mg) Lacroixet al.,2014a

Cytochrome P450-1-like-1 cyp11 TGGTTGCGATTTGTTATGCCCTGGA GGCGGAAAGCAATCCATCCGTGA ND/1.95 150 77.5 JX885878 (me) Zanetteet al., 2013

Cytochrome P450-3-like-2 cyp32 CAGACGCGCCAAAAGTGATA GTCCCAAGCCAAAAGGAAGG 1.87/1.85 194 80.1 AB479539 (me) Lacroixet al.,2014a

u-Glutathione-S-transferase

ugst CGACTCTATAGCATGCGATTATG AGAACCGGAACCATACCAAGAGG 1.92/2.04 152 77.5 Locus 38757 a (me) Lacroixet al.,2014a

m-Glutathione-S-transferase

mgst AGAGGCCTAGCACAGCCAGTGAG CACTCTCTGCTGAATCCTGGACC 2.05/1.95 104 78.4 Locus 42054 a (me) Lacroixet al.,2014a

s-Glutathione-S-transferase

sgst CCTGTTCGCGGAAGAGCTGAACT GTTGGCATCTGTCCTGTTGGTAT 1.92/NA 131 78.0 FL494070 (mg) Lacroixet al.,2014a

Growth arrest and DNAdamage inducible

aadd45a CCATTCCCTTCAACCTCCTC GCCGAAACAGACGTAACAGT 1.96/1.89 140 78.7 AJ623737 (mg) Ruiz et al.,2012

a-Amylase amylase CCTCGGGGTAGCTGGTTTTA TCCAAAGTTACGGGCTCCTT ND/1.91 232 79.2 EU336958 (me) e

Pyruvate kinase pk AGACTTGGAGCTGCCTTCAG GGAATGCACAGAGGGTTCAT 1.83/1.88 228 81.6 Locus22823a (me) e

Isocitrate dehydrogenase[NADP] cytoplasmic

idp GGAGGTACTGTATTTCGTGAGGC TGATCTCCATAAGCATGACGTCC 1.93/1.97 104 76.9 Locus2855a (me) e

Gyceraldehyde 3phosphatedehydrogenase

gapdh GTCTGGTGATGAGAGCTGCC GCGTCTCCCCATTTGATAGCT 1.84/1.84 220 78.7 FL496349 (mg) Lacroixet al.,2014a

Hexokinase hk CCAATATGACAATTGCCGTTGA GCAGCACCTTTACCACTACCATCA 1.91/1.91 148 78.2 JN595865 (mg) e

P-53 tumor supressor-like p53 CAACAACTTGCCCAATCCGA GGCGGCTGGTATATGGATCT 1.85/1.89 228 80.1 AY579472 (me)/DQ158079 (mg)

Lacroixet al.,2014a

ABCB/P-glycoprotein-likeprotein

pgp CACTAGTTGGAGAGCGTGGA TGTTCTTCCCTGTCTTGCCT 1.92/1.86 116 82.7 AF159717 (me)/EF057747 (mg)

Lacroixet al.,2014a

Lysosyme lys AGGGTTTGTGCATCCTCTTG TCGACTGTGGACAACCAAAA 1.94/1.92 173 81.6 AF334662 (me)/AF334665 (mg)

e

Caspase 3/7-3 casp37-3 CAATGTGTAAAAACGAGAGACATTG GTTAGTATATGCCCACTGTCCATTC 1.84/1.93 146 76.5 HQ424453 (mg) Romeroet al., 2011

*: indicates reference genes; a: indicates sequences obtained from Illumina technology sequencing (Courtesy of Sleiman Bassim and Arnaud Tanguy (Bassim et al., 2014));(me): M. edulis; (mg): M. galloprovincialis. ND: not detected; NA: not analyzed.


observed in mussels exposed to micro-PS þ FLU, in comparisonwith all other treatments (Fig. 3). This difference was mainly drivenby higher hemocyte infiltration and ceroids detected in gills, go-nads, digestive glands and intestine of micro-PS þ FLU exposed


mussels.


Table 2Concentrations of fluoranthene inwater, on micro-algae Chaetoceros muelleri and onpolystyrene microbeads (micro-PS) expressed as ng mL�1, percentage (%) or parti-tion coefficient (log Kp) in the FLU and micro-PS þ FLU algal cultures.

FLU alone Micro-PS þ FLU

(ng mL�1) % Log Kp (ng mL�1) % Log Kp

Micro-algae 325.59 89 4.84 234.66 67 4.77Water 39.30 11 / 40.19 12 /2 mm micro-PS / / / 18.35 5 6.586 mm micro-PS / / / 55.05 16 6.59


5.4. Hemocyte parameters

After seven days of exposure, the percentage of dead hemocytesincreased significantly in mussels exposed to micro-PS and FLU,alone or in combination, in comparison with controls (Fig. 4A,Table 3). ROS production was significantly higher in musselsexposed to micro-PS and FLU alone, in comparison with controlindividuals and mussels exposed to micro-PS þ FLU (Fig. 4B,Table 3). Significant interactions between both stressors weredemonstrated on percentage of dead hemocytes, phagocytosis ca-pacity and ROS production (Fig. 4, Table 3). No effect of micro-PSand FLU alone or in combination was observed on phagocytosisactivity and hemocyte concentration at that time.

At the end of the depuration, the percentage of dead hemocytesremained significantly higher in mussels exposed to micro-PS andFLU, in single or in combination, in comparison with controls(Fig. 4A, Table 3). All micro-PS exposed mussels exhibited signifi-cantly lower granulocyte concentration (1.2 ± 0.2 105 cells mL�1

and 1.1 ± 0.2 105 cells mL�1 for mussels exposed to micro-PS andmicro-PS þ FLU, respectively) in comparison with controls(3.4 ± 0.5 105 cells mL�1) and mussels exposed to FLU (2.7 ± 0.5105 cells mL�1) (Table 3). This decrease was also reflected in thetotal hemocyte count with mean cells concentrations of 5.4 ± 1.1105 cells mL�1, 4.8 ± 0.8 105 cells mL�1, 2.8 ± 0.5 105 cells mL�1 and2.3 ± 0.4 105 cells mL�1 in controls and mussels exposed to FLU,micro-PS and micro-PS þ FLU, respectively (Table 3). All micro-PSexposed mussels demonstrated significantly higher phagocytosiscapacity as compared to control individuals (Fig. 4B, Table 3). Noeffect of micro-PS and FLU alone or in combinationwas observed onphagocytosis activity, ROS production and hyalinocyte concentra-tion at that time.

Fig. 1. Concentrations (mg g�1, WW) of fluoranthene in gills and digestive gland of musselsranthene. Results are expressed as the mean concentration ± standard error (SE) (n ¼ 9).


5.5. Anti-oxidant enzyme activities and lipid peroxidation

At T7 a significant effect of micro-PS exposure was demonstratedon CAT activity with a reduced activity in mussels exposed to micro-PS andmicro-PS þ FLU (52.6 ± 3.9 and 66.6 ± 8.7 mmol min�1 mg�1,respectively) in comparison with controls and mussels exposed toFLU alone (70.4 ± 7.1 mmol min�1 mg�1 and82.9 ± 4.3 mmol min�1 mg�1, respectively) (Fig. 5, Table 4). Lipidperoxidation (LPO) was also significantly reduced in musselsexposed tomicro-PS alone or in combinationwith FLU (0.9± 0.2 and1.1 ± 0.2 TBARS mg�1, respectively) compared to controls (1.4 ± 0.2TBARS mg�1) and mussels exposed to FLU alone (1.8 ± 0.1 TBARSmg�1) (Fig. 5, Table 4). Activities of GR and SOD were significantlyhigher in mussels exposed to FLU (17.1 ± 1.7 nmol min�1 mg�1 and61.1 ± 4.8 U min�1 mg�1, mean ± SE, respectively) compared tocontrol mussels (9.6 ± 0.4 nmol min�1 mg�1 and47.0 ± 2.3 U min�1 mg�1, respectively) (Fig. 5, Table 4). At T14, sig-nificant effects ofmicro-PS and FLU exposureswere observed onGSTand SOD, with an increase in enzyme activities in all exposed mus-sels. Highest GSTand SODactivities (16.9± 1.4 nmolmin�1mg�1 and50.7 ± 3.5 Umin�1 mg�1, mean ± SE, respectively) were observed inthe micro-PS þ FLU condition in comparison with all other treat-ments (Fig. 5, Table 4). Significant effects of micro-PS were observedon LPO levels with the lowest concentration being measured inmicro-PS þ FLU exposed mussels (Fig. 5, Table 4). A significantinteraction between micro-PS and FLU was observed on the activityof the GR: FLU exposure led to a decrease in GR activity in theabsence of micro-PS (12.0 ± 0.5 nmol min�1 mg�1 vs.10.7 ± 0.9 nmol min�1 mg�1, in control and FLU exposed mussels,respectively), while a significantly higher activity was observed inmicro-PS þ FLU exposed mussels (12.8 ± 0.8 nmol min�1 mg�1) incomparison with micro-PS exposed animals (9.7 ± 0.4nmol min�1 mg�1) (Fig. 5, Table 4).

5.6. Gene expression

At T7, significant effects of micro-PS were observed in mRNAlevels only in gills. Compared to controls, mRNA level of lysincreased 2.2 and 1.2 folds, respectively in micro-PS and micro-PS þ FLU exposed mussels; the mRNA levels of catwere 0.7 and 0.8times lower, respectively in micro-PS and micro-PS þ FLU exposedmussels (Table 5). At T14 in gills, exposure to micro-PS led to asignificant increase in mRNA level for pk by 1.1 and 1.4 times inmussels exposed to micro-PS and micro-PS þ FLU, respectively,compared to controls (Table 6). The mRNA level of sod increased

after exposure (T7) and depuration (T14) phases. Micro-PS: microplastics; FLU: fluo-


Fig. 2. Histological observations in mussels after 7 days of exposure to fluoranthene and micro-PS. A: Fluorescent 6 mm and 2 mm micro-PS (arrows) in the intestine (INT), Ep:epithelium; B: Micro-PS (arrows) in gills (G); C: Ceroids (CER) in intestine (INT), Ep: epithelium; D: normal gills; E: Vacuolization in gills (G VAC); F: Alteration in intestineepithelium (AEp), normal intestine epithelium (Nep); G: Hemocyte infiltration (HI) in conjunctive tissue of digestive gland (full arrows). Hemocyte in diapedesis in intestineepithelium (empty arrows); H: Normal digestive tubules (DT); I: Hemocytes infiltration in conjunctive tissues of digestive gland.


significantly by 1.1, 1.2 and 1.5 times in mussels exposed to FLU,micro-PS and micro-PS þ FLU, respectively, compared to controls.


The mRNA levels of gpx and idp genes were significantly higher ingills of mussels exposed to FLU alone (by 2.3 and 2.4 times,


Fig. 3. Sum of histopathological observations detected in mussel tissues (gills, gonadsand digestive gland including stomach, digestive tubules and intestine) after exposure(T7) and depuration (T14). TA: tissue alterations (degeneration, sloughing, tear); INF:Hemocyte infiltration; DIA: Hemocyte in diapedesis (observed only in digestive glandincluding stomach, digestive tubules and intestine); CER: Ceroids; VAC: Vacuolation.Letters (a, b, c) indicate statistical differences (Mann-Whitney U-test, p < 0.05).


respectively) or in combination with micro-PS (by 2.7 and 2.6times, respectively) in comparison with controls (Tables 5 and 6). Asignificant interaction between both factors (micro-PS and FLU)was observed on cat mRNA level in gills: micro-PS and FLU singleexposures led to a reduction by 0.9 and 0.7 times, respectively, incomparison with controls, while exposure to micro-PS þ FLUinduced an increase of cat mRNA level by 1.2 times compared tocontrols (Table 5). The mRNA levels of pk, sod and cat genes weresystematically highest in the mussels exposed to micro-PS þ FLU,compared to the 3 other conditions. At T14 in digestive gland,micro-PS exposure induced a significant decrease of pgp mRNAlevel by 0.4 and 0.7 in mussels exposed to micro-PS and micro-PS þ FLU, respectively, compared to controls (Tables 5 and 6). Asignificant interaction between both factors was observed for catmRNA level: micro-PS and FLU single exposures led to a reductionby 0.7 and 0.8 times, respectively, in comparison with controls,while the double exposure micro-PS þ FLU induced an increase ofmRNA level by 1.7 times compared to controls (Table 5). In addition,the mRNA levels of amylase, pk and sodwere significantly higher by1.6, 1.2 and 1.5 times respectively in mussels exposed to FLU


compared to controls, with highest inductions observed in musselsexposed to micro-PS þ FLU (3.2, 1.5 and 1.7 times, respectively)(Tables 5 and 6). Exposure to FLU induced a diminution of s gstmRNA level by 0.7 times in comparison with controls. Overall theexperiment, no effects of micro-PS or FLU or their combinationwere observed on cyp11, cyp32, ugst, mgst, gadd45a, gapdh, hk, p53,casp37-3 mRNA levels.

6. Discussion

6.1. Micro-PS exhibited high sorption capacity for fluoranthene

The present study evidenced that micro-PS exhibited highersorption capacity for fluoranthene than marine algae C. muelleri asindicated by the partition coefficient log Kp values, and thisconfirmed a strong affinity of fluoranthene for polystyrene, espe-cially when considering the relative mass proportion of algae andmicro-PS fed to the mussels (289:1) in the context of our study.Polyethylene (PE) and polyvinylchloride (PVC) also demonstratedhigh sorption capacity, as expressed with Log Kp values, forphenanthrene and dichlorodiphenyltrichloroethane (DDT) (Bakiret al., 2012). Similarly, polystyrene (PS) and PE microparticlesexhibited high sorption capacity for pyrene (Avio et al., 2015), andpolypropylene (PP) pellets immersed in Tokyo Bay also showedhigh adsorption coefficients for polychlorobiphenyls (PCB) anddichlorodiphenyltrichloroethane (DDE) (Mato et al., 2001). How-ever, as some sediment and suspended particles may exhibitsimilar or even higher adsorption coefficient than microplastics(Mato et al., 2001; Velzeboer et al., 2014), it may be reasonable toquestion the respective role of each component in the contami-nation of marine organisms.

6.2. Micro-PS had negligible effect on fluoranthenebioaccumulation but altered its depuration in marine mussels

The similar fluoranthene bioaccumulation in all exposed mus-sels at T7 may be explained by the fact that all FLU fractions (onalgae, on micro-PS and dissolved in water) were available formussels. This actually shows that the Trojan horse effect of micro-PS (i.e. facilitating the uptake of organic contaminants by marineorganisms) was negligible in the context of our study as comparedto water and food exposures, especially given the low proportion ofmicro-PS relatively to microalgae. This is in agreement with arecent study that critically reviewed all available data regardingthis hypothesis (field, laboratory and modelling studies) andconcluded that given the low abundance of plastic particles relativeto other media present in the oceans (marine phytoplankton in ourcase), exposure to POP via plastic is likely to be negligible comparedto natural pathways (Koelmans et al., 2016).

At the end of the depuration phase, the highest FLU concen-trations measured in the digestive glands of micro-PS þ FLUexposed mussels may be related to (i) some loaded micro-PSremaining in mussels tissues; (ii) a time lag in the kinetics of FLUdesorption/assimilation frommicro-PS that were not assimilated asthe micro-algae were; (iii) an indirect effect of micro-PS exposureon the general metabolism of mussels resulting in a reduction inFLU depuration. Indeed, lowmetabolism and activity are associatedwith low PAH clearance rates (Lotufo, 1998; Al-Subiai et al., 2012);and (iv) a possible direct impact of micro-PS on PAH detoxificationprocesses, as suggested by a decrease in P-glycoprotein mRNAlevels in all mussels exposed to micro-PS. Indeed, P-glycoproteinsare transmembrane proteins primarily involved in the efflux of awide range of compounds including unmodified xenobiotics andPAH (Smital et al., 2003). Impacts of polyethylene microbeads ondetoxification mechanisms were previously demonstrated in


Fig. 4. Percentage of dead hemocytes (%) (A), ROS production capacity (B) and phagocytosis capacity (C) after exposure (T7) and depuration (T14) phases. micro-PS or MP:microplastics; FLU: fluoranthene. Results are expressed as mean percentage of mortality ± standard error (SE) (n ¼ 12).


common goby Pomatoschistus microps juveniles and seabassDicentrarchus labrax larvae (Mazurais et al., 2015; Oliveira et al.,2013). The high fluoranthene concentration remaining in tissuesof mussels exposed to micro-PS and FLU at the end of the depu-ration may explain the highest levels of ceroids, hemocyte


infiltration and tissue lesions, known to be associated with PAH(Kim et al., 2008; Al-Subiai et al., 2012), observed in this condition.


Table 3Results of the two-way ANOVA performed on the hemocyte parameters measured in mussels exposed to microplastics (micro-PS) and fluoranthene (FLU) alone or in com-bination after exposure (T7) and depuration (T14). Only parameters exhibiting levels significantly modulated by micro-PS and/or FLU are presented here. P-values <0.05 are inbold and italic character.

Hemocyte mortality ROS production Phagocytosis capacity Hemocyte concentration Granulocyteconcentration

Source of variation T7 p-value T14 p-value T7 p-value T14 p-value T7 p-value T14 p-value T7 p-value T14 p-value T7 p-value T14 p-value

FLU 0.013 0.001 0.048 >0.05 > 0.05 >0.05 >0.05 >0.05 >0.05 >0.05Micro-PS 0.049 0.003 0.041 >0.05 > 0.05 0.01 >0.05 0.001 >0.05 <0.0001Micro-PSxFLU 0.001 <0.0001 0.001 >0.05 0.018 >0.05 >0.05 >0.05 >0.05 >0.05


6.3. Micro-PS exposure affected mussels physiology

6.3.1. Modulation of digestion and energy metabolismThe induction of glycolysis and digestive activity upon micro-PS

exposure may sign increased energy requirements in response tothe implementation of anti-oxidant and detoxification processes(Palais et al., 2012). This mechanismwould allow the animal to copewith experimental stress and maintain homeostasis, as suggestedin a study conducted by Van Cauwenberghe et al. (2015) whodemonstrated a 25% increase in energy consumption in musselsexposed to micro-PS for 14 days in comparison with controls.Alternatively, the increase in digestive activity could be explainedby a compensatory effect on food intake and enhancement of me-chanical digestion upon particles exposure, as also hypothesized inoysters (Sussarellu et al., 2016). An increase in absorption efficiencywas for instance demonstrated in mussels exposed to moderatequantities of silt in relation to an improvement of the mechanicaldisruption in the stomach due to the presence of particles (Bayneet al., 1987). In the present study, a control condition using non-plastic inorganic particles of same size (silt, clay, silica) is lackingto discriminate whether the overall observed effects of micro-PSwere due to the plastic nature of the particles or to the particlesas such. This point should be addressed in further experiments.

6.3.2. Modulation of anti-oxidant defences and oxidative damagesMicro-PS exposure alone significantly modulated the cell

oxidative system in our study. Such perturbations were alsoobserved in mussels exposed to polystyrene (PS) and polyethylene(PE) alone or in combination with pyrene (Avio et al., 2015).Reactive oxygen species (ROS) production in hemocytes is natu-rally occurring (Galloway and Depledge, 2001) but overproductionof ROS may lead to oxidative damages (Lesser, 2006). In our study,the significant rise of ROS in hemocytes upon 7 days of micro-PSexposure seemed to have been well controlled as no anti-oxidant markers were activated and no sign of lipid peroxidation(LPO) was observed at that time. A biphasic response of thecatalase involved in the neutralization of the hydrogen peroxide(H2O2) is hypothesized with a possible activation within the firstdays of exposure and consequently followed by a decrease in geneexpression and protein activity afterwards (T7). Such compensa-tory effect was previously observed in eels and mussels (Regoliet al., 2011; Rom�eo et al., 2003). Also, implication of other en-zymes involved in H2O2 neutralization such as glutathioneperoxidase (GPX) cannot be yet clarified. After depuration, theSOD activity in micro-PS exposed mussels reflected the need for agreater capacity to rapidly convert O2

� into the less damaginghydrogen peroxide (H2O2), thus contributing to prevent hostcellular oxidative damage (Jo et al., 2008). In the micro-PS þ FLUexposed mussels, an efficient neutralization of the ROS is sug-gested by the activation of anti-oxidant and glutathione relatedmarkers and low LPO levels. Low LPO levels suggesting a suitableneutralization of ROS was previously hypothesized in the


crustacean Carcinus maenas (Rodrigues et al., 2013), and themolluscs Perna viridis (Cheung et al., 2001) and Chlamys farreri(Xiu et al., 2014) exposed to FLU.

6.3.3. Modulation of hemocytes mortality and activitiesMicro-PS exposure impairedmajor hemocyte parameters. Based

on the absence of observed translocation, direct toxicity due tocontact with micro-PS or leaching of chemicals were excluded toexplain the high percentage of dead hemocytes in micro-PSexposed mussels. Instead, this may result from a modification ofthe circulating hemocyte concentration or balance in hemolymph.For instance, the recruitment of active hemocytes for incursion intissues could explain the decrease in circulating granulocyte andtotal hemocyte concentrations observed in micro-PS exposedmussels, which would subsequently modify the balance of livecirculating hemocytes in the hemolymph (H�egaret et al., 2007).Modulation of mussel immunity was also demonstrated throughthe increase in lysmRNA levels in gills of mussels exposed tomicro-PS, related either to (i) a direct effect of micro-PS, as demonstratedfor a wide range of pollutants including metals, hydrocarbons,carbon nanoparticles, oestrogenic compounds (Renault, 2015),polyethylene beads (Von Moos et al., 2012) and styrene monomers(Mamaca et al., 2005); or to (ii) an increase in the digestive activityobserved in the present study, asmost lysozymes are known to playa dual role in bivalve immunity and digestion of microbial foodparticles (Allam and Raftos, 2015). Finally, the absence of clear ef-fects of micro-PS exposure on phagocytosis is consistent with thestudy conducted by Browne et al. (2008). However, statisticallysignificant interactions between both stressors suggest a potentialmodification of the bioavailability or toxicity of FLU by micro-PS.Indeed, intracellular distribution, and toxicity of fluoranthene car-ried by algae andmicro-PSmay have been quite different due to thenature and the assimilation or not of the carrier. Hemocytes of bi-valves are not restricted to immune processes and are involved inmany other physiological functions including nutrient transportand digestion, tissue and shell formation, detoxification andmaintenance of homeostasis (Donaghy et al., 2009). Therefore, theimpact of micro-PS on hemocyte activities should be considered ina larger context than immune responses, i.e. at the whole animalhomeostasis, and longer-term studies are needed to clarify thechronic effect of microplastics exposure in real environmentalconditions.

7. Conclusion

Despite a high sorption of fluoranthene onmicro-PS, this did notenhance fluoranthene bioaccumulation in the specific conditions ofthis experiment; i.e. when mussels were also exposed to fluo-ranthene via water and micro-algae. Micro-PS concentration usedin this study (0.032 mg L�1) was lower than those used in moststudies on marine invertebrates (range 0.8e2500 mg L�1) (Avioet al., 2015; Besseling et al., 2013; Wegner et al., 2012; Von Moos


Fig. 5. Anti-oxidant enzyme activities (CAT, SOD, GST,GR) and lipid peroxidation (LPO) measured in digestive gland of mussels after exposure (T7) and depuration (T14). MP ormicro-PS: microplastics; FLU: fluoranthene. Results are expressed as mean percentage of mortality ± standard error (SE) (n ¼ 9).


Please cite this article in press as: Paul-Pont, I., et al., Exposure of marine mussels Mytilus spp. to polystyrene microplastics: Toxicity andinfluence on fluoranthene bioaccumulation, Environmental Pollution (2016), http://dx.doi.org/10.1016/j.envpol.2016.06.039

Table 4Results of the two-way ANOVA performed on the enzyme activities measured in mussels exposed to microplastics (micro-PS) and fluoranthene (FLU) alone or in combinationafter exposure (T7) and depuration (T14). Only parameters exhibiting levels significantly modulated bymicro-PS and/or FLU are presented here. P-values <0.05 are in bold anditalic character.

Catalase Superoxide dismutase Glutathione-S-transferase

Glutathione reductase Lipid peroxidation

Source of variation T7 p-value T14 p-value T7 p-value T14 p-value T7 p-value T14 p-value T7 p-value T14 p-value T7 p-value T14 p-value

FLU >0.05 >0.05 0.021 0.016 >0.05 0.001 <0.0001 >0.05 >0.05 <0.0001Micro-PS 0.025 >0.05 >0.05 0.004 >0.05 0.041 0.003 >0.05 0.001 0.003Micro-PSxFLU >0.05 >0.05 >0.05 >0.05 >0.05 >0.05 >0.05 0.021 >0.05 0.021

Table 5Relative gene expression in gills (G) and digestive glands (DG) of mussels exposed tomicroplastics (micro-PS) and fluoranthene (FLU) alone or in combination afterexposure (T7) and depuration (T14). Only anti-oxidant genes exhibitingmRNA levelssignificantly modulated by micro-PS and/or FLU are presented here, alongside withthe results of the two-way ANOVA (p-value). P-values <0.05 are in bold and italiccharacter highlighted in grey. Arrows represent the way of induction, b: up-regulation; a: down-regulation; h: interaction.

Function Gene Time Tissue Experimentalconditions

Relative geneexpression

p-value

Mean SD SE

Anti-oxidant cat T7 G Control 1.35 0.33 0.11FLU 1.37 0.36 0.12 >0.05Micro-PS 0.97 0.26 0.09 0.006 a

Micro-PS xFLU

1.13 0.31 0.10 >0.05

cat T14 G Control 0.97 0.29 0.10FLU 0.70 0.23 0.08 >0.05Micro-PS 0.92 0.27 0.09 0.029 a

Micro-PS xFLU

1.14 0.19 0.06 0.006 h

sod T14 G Control 0.97 0.29 0.10FLU 0.70 0.23 0.08 0.002 b

Micro-PS 0.92 0.27 0.09 0.036 b

Micro-PS xFLU

1.14 0.19 0.06 >0.05

gpx T14 G Control 0.81 0.68 0.23FLU 1.87 1.76 0.62 0.042 b

Micro-PS 1.48 0.38 0.13 >0.05Micro-PS xFLU

2.22 1.49 0.50 >0.05

s-gst T14 DG Control 1.55 0.97 0.32FLU 1.05 0.70 0.23 0.014 a


0.87 0.42 0.15 >0.05

cat T14 DG Control 1.26 0.96 0.32FLU 0.90 0.38 0.13 >0.05Micro-PS 0.87 0.37 0.14 >0.05Micro-PS xFLU

2.09 1.29 0.46 0.016 h

sod T14 DG Control 0.68 0.24 0.08FLU 1.05 0.15 0.05 <0.0001 b

Micro-PS 0.77 0.28 0.11 >0.05Micro-PS x FLU 1.12 0.17 0.06 >0.05

Table 6Relative gene expression in gills (G) and digestive glands (DG) of mussels exposed tomicroplastics (micro-PS) and fluoranthene (FLU) alone or in combination afterexposure (T7) and depuration (T14). Only genes exhibiting mRNA levels significantlymodulated by micro-PS and/or FLU are presented here, alongside with the results ofthe two-way ANOVA (p-value). P-values <0.05 are in bold character highlighted ingrey. Arrows represent the way of induction, b: up-regulation; a: down-regulation; h: interaction.

Function Gene Time Tissue Experimentalconditions

Relative geneexpression

p-value

Mean SD SE

Generation ofreducingequivalents

idp T14 G Control 0.20 0.08 0.03FLU 0.48 0.20 0.07 0.008 b


0.51 0.21 0.07 >0.05

Detoxication pgp T14 DG Control 1.45 0.51 0.17FLU 1.12 0.29 0.10 >0.05Micro-PS 0.62 0.28 0.11 0.001 a

Micro-PS xFLU

0.98 0.33 0.12 0.015 h

Digestion pk T14 G Control 0.72 0.20 0.07FLU 0.75 0.27 0.09 >0.05Micro-PS 0.82 0.32 0.11 0.023 b

Micro-PS xFLU

1.07 0.24 0.08 >0.05

pk T14 DG Control 1.06 0.41 0.14FLU 1.22 0.43 0.14 0.012 b


1.54 0.48 0.17 >0.05

amylase T14 DG Control 0.31 0.23 0.08FLU 0.50 0.35 0.12 0.006 b


1.02 0.79 0.28 >0.05

Immunity lys T7 G Control 0.99 0.96 0.32FLU 1.07 0.64 0.21 >0.05Micro-PS 2.18 1.27 0.42 0.044 b

Micro-PS xFLU

1.18 0.74 0.25 >0.05


et al., 2012) and was in the range of the highest estimated fieldconcentration (most exclusively for particles > 330 mm) based onthe assumption of a steady fragmentation of plastic debris asdetailed in Sussarellu et al. (2016). This, in addition with recentpublished papers and reports (GESAMP, 2015; Herzke et al., 2016;Koelmans et al., 2016) suggest that given the current micro-plastics concentration in oceans the bioaccumulation of POP frommicroplastics is likely to be minor in regards with uptake via nat-ural pathways (waterborne and foodborne contamination).Nevertheless, marine plastic litter is expected to increase over thenext decades, leading to ever increasing microplastic pollution in


oceans, and the concentrations below which no effect can be seenon POP bioaccumulation could locally be exceeded.

Despite no effect observed on fluoranthene bioaccumulation,the ingestion of contaminated micro-PS may have modifiedbioavailability and fluoranthene kinetics in mussel tissues due tothe nature and the assimilation or not of the carrier (algae vs.plastic). This was suggested by a reduction in the fluoranthenedepuration and significant interactions between micro-PS andfluoranthene observed on some cellular and molecular biomarkers.It is noteworthy that the bioformation of fluoranthene metabolitesupon micro-PS exposure was not investigated in the present study.This aspect should be considered in further experiments as it couldpotentially have contributed to the additional and interactive ef-fects observed in micro-PS þ FLU exposed mussels. Finally, micro-PS alone triggered substantial modulation of cellular oxidative



balance, an increase in histopathological damages, percentage ofdead hemocytes and lysozyme mRNA levels, which suggested animpairment of the bivalve metabolism upon micro-PS exposure. Asthe toxic endpoints highlighted here were observed in specific andrestrictive experimental conditions, the energetic costs to the ani-mals (in terms of maintenance costs, immune responses, detoxifi-cation and oxidative balance regulation) must be further evaluatedin the context of in situ exposure and/or experimental studies thatmore closely mimic complex in situ conditions, in particular byusing different particulate matter and chemical mixtures repre-sentative of those found in the field.

Acknowledgements

This study was partly funded by the MICRO EU Interreg-fundedproject (MICRO 09-002-BE). The authors are grateful to M. Van derMeulen, L. Devriese, D. Vethaak, T. Maes, and D. Mazurais for theirvaluable support and helpful discussions and also the anonymousreviewers of the paper who greatly helped improving the scientificquality of the manuscript. We also thank Pr R. Whittington for hishelpful revision of the English and his comments on themanuscript.

References

Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quanti-tative reverse transcription-PCR data: a model-based variance estimationapproach to identify genes suited for normalization, applied to bladder andcolon cancer data sets. Cancer Res. 64, 5245e5250.

Al-Subiai, S.N., Arlt, V.M., Frickers, P.E., Readman, J.W., Stolpe, B., Lead, J.R.,Moody, A.J., Jha, A.N., 2012. Merging nano-genotoxicology with eco-genotoxicology: an integrated approach to determine interactive genotoxicand sub-lethal toxic effects of C60 fullerenes and fluoranthene in marinemussels, Mytilus sp. Mutat. Res. 745, 92e103. http://dx.doi.org/10.1016/j.mrgentox.2011.12.019.

Allam, B., Raftos, D., 2015. Immune responses to infectious diseases in bivalves. J.Invertebr. Pathol., Pathogens and Disease Processes in Marine Molluscs 131,121e136, http://dx.doi.org/10.1016/j.jip.2015.05.005.

Andrady, A.L., 2011. Microplastics in the marine environment. Mar. Pollut. Bull. 62,1596e1605. http://dx.doi.org/10.1016/j.marpolbul.2011.05.030.

Avio, C.G., Gorbi, S., Milan, M., Benedetti, M., Fattorini, D., d’ Errico, G., Pauletto, M.,Bargelloni, L., Regoli, F., 2015. Pollutants bioavailability and toxicological riskfrom microplastics to marine mussels. Environ. Pollut. 198, 211e222. http://dx.doi.org/10.1016/j.envpol.2014.12.021.

Bakir, A., Rowland, S.J., Thompson, R.C., 2012. Competitive sorption of persistentorganic pollutants onto microplastics in the marine environment. Mar. Pollut.Bull. 64, 2782e2789. http://dx.doi.org/10.1016/j.marpolbul.2012.09.010.

Bakir, A., Rowland, S.J., Thompson, R.C., 2014. Enhanced desorption of persistentorganic pollutants frommicroplastics under simulated physiological conditions.Environ. Pollut. 185, 16e23. http://dx.doi.org/10.1016/j.envpol.2013.10.007.

Bassim, S., Genard, B., Gauthier-Clerc, S., Moraga, D., Tremblay, R., 2014. Ontogeny ofbivalve immunity: assessing the potential of next-generation sequencingtechniques. Rev. Aquac. 6, 1e21.

Baumard, P., Budzinski, H., Garrigues, P., Sorbe, J.C., Burgeot, T., Bellocq, J., 1998.Concentrations of PAHs (polycyclic aromatic hydrocarbons) in various marineorganisms in relation to those in sediments and to trophic level. Mar. Pollut.Bull. 36, 951e960. http://dx.doi.org/10.1016/S0025-326X(98)00088-5.

Bayne, B.L., Hawkins, A.J.S., Navarro, E., 1987. Feeding and digestion by the musselMytilus edulis L. (Bivalvia: Mollusca) in mixtures of silt and algal cells at lowconcentrations. J. Exp. Mar. Bio. Ecol. 111, 1e22.

Besseling, E., Wegner, A., Foekema, E.M., van den Heuvel-Greve, M.J.,Koelmans, A.A., 2013. Effects of microplastic on fitness and PCB bio-accumulation by the lugworm Arenicola marina (L.). Environ. Sci. Technol. 47,593e600. http://dx.doi.org/10.1021/es302763x.

Bierne, N., Borsa, P., Daguin, C., Jollivet, D., Viard, F., Bonhomme, F., David, P., 2003.Introgression patterns in the mosaic hybrid zone between Mytilus edulis andM. galloprovincialis. Mol. Ecol. 12, 447e461. http://dx.doi.org/10.1046/j.1365-294X.2003.01730.x.

Bouzas, A., Aguado, D., Martí, N., Pastor, J.M., Herr�aez, R., Campins, P., Seco, A., 2011.Alkylphenols and polycyclic aromatic hydrocarbons in eastern MediterraneanSpanish coastal marine bivalves. Environ. Monit. Assess. 176, 169e181. http://dx.doi.org/10.1007/s10661-010-1574-5.

Browne, M.A., Dissanayake, A., Galloway, T.S., Lowe, D.M., Thompson, R.C., 2008.Ingested microscopic plastic translocates to the circulatory system of themussel, Mytilus edulis (L.). Environ. Sci. Technol. 42, 5026e5031. http://dx.doi.org/10.1021/es800249a.

Buege, J.A., Aust, S.D., 1978. Microsomal lipid peroxidation. In: Packer, S.F. (Ed.),


Methods in Enzymology, Biomembranes - Part C: Biological Oxidations. Aca-demic Press, pp. 302e310.

Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R.,Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. TheMIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611e622.

Cheung, C.C.C., Zheng, G.J., Li, A.M.Y., Richardson, B.J., Lam, P.K.S., 2001. Relation-ships between tissue concentrations of polycyclic aromatic hydrocarbons andantioxidative responses of marine mussels, Pernaviridis. Aquat. Toxicol. 52,189e203. http://dx.doi.org/10.1016/S0166-445X(00)00145-4.

Claiborne, A., 1985. Catalase activity. In: Greenwald, R.A. (Ed.), Handbook ofMethods for Oxygene Radical Research. CRC Press, Boca Raton, FL, pp. 283e284.

Cole, M., Lindeque, P., Halsband, C., Galloway, T.S., 2011. Microplastics as contami-nants in the marine environment: a review. Mar. Pollut. Bull. 62, 2588e2597.http://dx.doi.org/10.1016/j.marpolbul.2011.09.025.

Donaghy, L., Lambert, C., Choi, K.-S., Soudant, P., 2009. Hemocytes of the carpet shellclam (Ruditapesdecussatus) and the Manila clam (Ruditapesphilippinarum):current knowledge and future prospects. Aquaculture 297, 10e24. http://dx.doi.org/10.1016/j.aquaculture.2009.09.003.

Eriksen, M., Lebreton, L.C.M., Carson, H.S., Thiel, M., Moore, C.J., Borerro, J.C.,Galgani, F., Ryan, P.G., Reisser, J., 2014. Plastic pollution in the world’s oceans:more than 5 trillion plastic pieces weighing over 250,000 tons afloat at sea.PLoS One 9, e111913. http://dx.doi.org/10.1371/journal.pone.0111913.

Fabioux, C., Huvet, A., Le Souchu, P., Le Pennec, M., Pouvreau, S., 2005. Temperatureand photoperiod drive Crassostrea gigas reproductive internal clock. Aquacul-ture 250, 458e470. http://dx.doi.org/10.1016/j.aquaculture.2005.02.038.

Galloway, T.S., Depledge, M.H., 2001. Immunotoxicity in invertebrates: measure-ment and ecotoxicological relevance. Ecotoxicology 10, 5e23.

GESAMP, 2015. Sources, fate and effects of microplastics in the marine environ-ment: a global assessment. Rep. Stud.. In: Kershaw, P.J. (Ed.), IMO/FAO/UNESCO-IOC/UNIDO/WMO/IAEA/-UN/UNEP/UNDP Joint Group of Experts on the Scien-tific Aspects of Marine Environmental Protection, p. 96. GESAMP No. 90.

Haberkorn, H., Lambert, C., Le Goïc, N., Gu�eguen, M., Moal, J., Palacios, E., Lassus, P.,Soudant, P., 2010. Effects of Alexandriumminutum exposure upon physiologicaland hematological variables of diploid and triploid oysters, Crassostrea gigas.Aquat. Toxicol. 97, 96e108. http://dx.doi.org/10.1016/j.aquatox.2009.12.006.

Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases the firstenzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130e7139.

H�egaret, H., Wikfors, G.H., Soudant, P., 2003. Flow cytometric analysis of haemo-cytes from eastern oysters, Crassostrea virginica, subjected to a sudden tem-perature elevation: II. Haemocyte functions: aggregation, viability,phagocytosis, and respiratory burst. J. Exp. Mar. Biol. Ecol. 293, 249e265. http://dx.doi.org/10.1016/S0022-0981(03)00235-1.

H�egaret, H., da Silva, P.M., Wikfors, G.H., Lambert, C., De Bettignies, T.,Shumway, S.E., Soudant, P., 2007. Hemocyte responses of Manila clams, Rudi-tapesphilippinarum, with varying parasite, Perkinsusolseni, severity to toxic-algalexposures. Aquat. Toxicol. 84, 469e479. http://dx.doi.org/10.1016/j.aquatox.2007.07.007.

Herzke, D., Anker-Nilssen, T., Nøst, T.H., G€otsch, A., Christensen-Dalsgaard, S.,Langset, M., Fangel, K., Koelmans, A.A., 2016. Negligible impact of ingestedmicroplastics on tissue concentrations of persistent organic pollutants inNorthern Fulmars off Coastal Norway. Environ. Sci. Technol. 50, 1924e1933.

Ivar do Sul, J.A., Costa, M.F., 2014. The present and future of microplastic pollution inthe marine environment. Environ. Pollut. 185, 352e364. http://dx.doi.org/10.1016/j.envpol.2013.10.036.

Jo, P.G., Choi, Y.K., Choi, C.Y., 2008. Cloning and mRNA expression of antioxidantenzymes in the Pacific oyster, Crassostrea gigas in response to cadmium expo-sure. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 147, 460e469. http://dx.doi.org/10.1016/j.cbpc.2008.02.001.

Kim, Y., Powell, E.N., Wade, T.L., Presley, B.J., 2008. Relationship of parasites andpathologies to contaminant body burden in sentinel bivalves: NOAA Status andTrends “Mussel Watch” Program. Mar. Environ. Res. 65, 101e127. http://dx.doi.org/10.1016/j.marenvres.2007.09.003.

Koelmans, A.A., Besseling, E., Foekema, E.M., 2014. Leaching of plastic additives tomarine organisms. Environ. Pollut. 187, 49e54. http://dx.doi.org/10.1016/j.envpol.2013.12.013.

Koelmans, A.A., Bakir, A., Burton, G.A., Janssen, C.R., 2016. Microplastic as a vectorfor chemicals in the aquatic environment: critical review and model-supportedreinterpretation of empirical studies. Environ. Sci. Technol. 50, 3315e3326.

Lacroix, C., Coquill�e, V., Guyomarch, J., Auffret, M., Moraga, D., 2014a. A selection ofreference genes and early-warning mRNA biomarkers for environmentalmonitoring usingMytilus spp. as sentinel species. Mar. Pollut. Bull. 86, 304e313.http://dx.doi.org/10.1016/j.marpolbul.2014.06.049.

Lacroix, C., Le Cuff, N., Receveur, J., Moraga, D., Auffret, M., Guyomarch, J., 2014b.Development of an innovative and “green” stir bar sorptive extractionethermaldesorptionegas chromatographyetandem mass spectrometry method forquantification of polycyclic aromatic hydrocarbons in marine biota.J. Chromatogr. A 1349, 1e10. http://dx.doi.org/10.1016/j.chroma.2014.04.094.

Lacroix, C., Richard, G., Seguineau, C., Guyomarch, J., Moraga, D., Auffret, M., 2015.Active and passive biomonitoring suggest metabolic adaptation in blue mussels(Mytilus spp.) chronically exposed to a moderate contamination in Brest harbor(France). Aquat. Toxicol. 162, 126e137. http://dx.doi.org/10.1016/j.aquatox.2015.03.008.

Lambert, C., Soudant, P., Choquet, G., Paillard, C., 2003. Measurement of Crassostreagigas hemocyte oxidative metabolism by flow cytometry and the inhibiting


http://refhub.elsevier.com/S0269-7491(16)30527-9/sref69





http://dx.doi.org/10.1016/j.mrgentox.2011.12.019

http://dx.doi.org/10.1016/j.mrgentox.2011.12.019

http://dx.doi.org/10.1016/j.jip.2015.05.005

http://dx.doi.org/10.1016/j.marpolbul.2011.05.030









http://dx.doi.org/10.1016/S0025-326X(98)00088-5





http://dx.doi.org/10.1021/es302763x

http://dx.doi.org/10.1046/j.1365-294X.2003.01730.x

http://dx.doi.org/10.1046/j.1365-294X.2003.01730.x

http://dx.doi.org/10.1007/s10661-010-1574-5

http://dx.doi.org/10.1007/s10661-010-1574-5

http://dx.doi.org/10.1021/es800249a

http://dx.doi.org/10.1021/es800249a










http://dx.doi.org/10.1016/S0166-445X(00)00145-4





http://dx.doi.org/10.1016/j.aquaculture.2009.09.003


http://dx.doi.org/10.1371/journal.pone.0111913









http://dx.doi.org/10.1016/j.aquatox.2009.12.006




http://dx.doi.org/10.1016/S0022-0981(03)00235-1

http://dx.doi.org/10.1016/S0022-0981(03)00235-1












http://dx.doi.org/10.1016/j.cbpc.2008.02.001

http://dx.doi.org/10.1016/j.cbpc.2008.02.001

http://dx.doi.org/10.1016/j.marenvres.2007.09.003









http://dx.doi.org/10.1016/j.chroma.2014.04.094




capacity of pathogenic vibrios. Fish Shellfish Immunol. 15, 225e240. http://dx.doi.org/10.1016/S1050-4648(02)00160-2.

Latendresse, J.R., Warbrittion, A.R., Jonassen, H., Creasy, D.M., 2002. Fixation oftestes and eyes using a modified Davidson’s fluid: comparison with Bouin’sfluid and conventional Davidson’s fluid. Toxicol. Pathol 30, 524e533. http://dx.doi.org/10.1080/01926230290105721.

Lesser, M.P., 2006. Oxidative stress in marine environments: biochemistry andphysiological ecology. Annu. Rev. Physiol. 68, 253e278. http://dx.doi.org/10.1146/annurev.physiol.68.040104.110001.

Lotufo, G.R., 1998. Bioaccumulation of sediment-associated fluoranthene in benthiccopepods: uptake, elimination and biotransformation. Aquat. Toxicol. 44, 1e15.http://dx.doi.org/10.1016/S0166-445X(98)00072-1.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurementwith the folin phenol reagent. J. Biol. Chem. 193, 265e275.

Lyons, B.P., Thain, J.E., Stentiford, G.D., Hylland, K., Davies, I.M., Vethaak, A.D., 2010.Using biological effects tools to define good environmental status under theEuropean Union marine strategy framework directive. Mar. Pollut. Bull. 60,1647e1651. http://dx.doi.org/10.1016/j.marpolbul.2010.06.005.

Mamaca, E., Bechmann, R.K., Torgrimsen, S., Aas, E., Bjørnstad, A., Baussant, T.,Floch, S.L., 2005. The neutral red lysosomal retention assay and Comet assay onhaemolymph cells from mussels (Mytilus edulis) and fish (Symphodusmelops)exposed to styrene. Aquat. Toxicol. 75, 191e201. http://dx.doi.org/10.1016/j.aquatox.2005.08.001.

Mato, Y., Isobe, T., Takada, H., Kanehiro, H., Ohtake, C., Kaminuma, T., 2001. Plasticresin pellets as a transport medium for toxic chemicals in the marine envi-ronment. Environ. Sci. Technol. 35, 318e324.

Mazurais, D., Ernande, B., Quazuguel, P., Severe, A., Huelvan, C., Madec, L.,Mouchel, O., Soudant, P., Robbens, J., Huvet, A., Zambonino-Infante, J., 2015.Evaluation of the impact of polyethylene microbeads ingestion in European seabass (Dicentrarchus labrax) larvae. Mar. Environ. Res. 112 (Part A), 78e85. http://dx.doi.org/10.1016/j.marenvres.2015.09.009.

National Oceanic and Atmospheric Administration (NOAA), September 9.11. 2008.Proceedings of the International Research Workshop on the occurrence, effects,and fate of microplastic marine debris. In: Arthur, C., Baker, J., Bamford, H.(Eds.), Technical Memorandum NOS-OR&R-30. University of WashingtonTacoma, Tacoma, WA, USA.

Oliveira, M., Ribeiro, A., Hylland, K., Guilhermino, L., 2013. Single and combinedeffects of microplastics and pyrene on juveniles (0þ group) of the commongoby Pomatoschistusmicrops (Teleostei, Gobiidae). Ecol. Indic. 34, 641e647.http://dx.doi.org/10.1016/j.ecolind.2013.06.019.

Ostroumov, S.A., 2003. Studying effects of some surfactants and detergents on filter-feeding bivalves. Hydrobiologia 500, 341e344. http://dx.doi.org/10.1023/A:1024604904065.

Palais, F., Dedourge-Geffard, O., Beaudon, A., Pain-Devin, S., Trapp, J., Geffard, O.,Noury, P., Gourlay-Franc�e, C., Uher, E., Mouneyrac, C., Biagianti-Risbourg, S.,Geffard, A., 2012. One-year monitoring of core biomarker and digestive enzymeresponses in transplanted zebra mussels (Dreissena polymorpha). Ecotoxicology21, 888e905. http://dx.doi.org/10.1007/s10646-012-0851-1.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic. Acids Res. 29, e45.

Ramos-Martinez, J.I., Bartolom�e, T.R., Pernas, R.V., 1983. Purification and propertiesof glutathione reductase from hepatopancreas of Mytilus edulis L. Comp. Bio-chem.Physiol. Part B Comp. Biochem. 75, 689e692. http://dx.doi.org/10.1016/0305-0491(83)90117-7.

Regoli, F., Giuliani, M.E., Benedetti, M., Arukwe, A., 2011. Molecular and biochemicalbiomarkers in environmental monitoring: a comparison of biotransformationand antioxidant defense systems in multiple tissues. Aquat. Toxicol. 105, 56e66.http://dx.doi.org/10.1016/j.aquatox.2011.06.014. Jubileum.

Robert, R., Connan, J.P., Leroy, B., Chr�etiennot-Dinet, M.J., Le Coz, J.R., Moal, J.,Qu�er�e, C., Martin-J�ez�equel, V., Le Gourrierec, G., Nicolas, J.L., Bernard, E., Kaas, R.,Le D�ean, L., 2004. Am�elioration des productions phytoplanctoniques en�ecloserie de mollusques: caract�erisation des microalgues fourrage. Rapp.


Ifremer, 144pp. http://archimer.ifremer.fr/doc/00000/1546/.Rochman, C.M., Hoh, E., Kurobe, T., Teh, S.J., 2013. Ingested plastic transfers haz-

ardous chemicals to fish and induces hepatic stress. Sci. Rep. 3 http://dx.doi.org/10.1038/srep03263.

Rodrigues, A.P., Lehtonen, K.K., Guilhermino, L., Guimar~aes, L., 2013. Exposure ofCarcinusmaenas to waterborne fluoranthene: accumulation and multibiomarkerresponses. Sci. Total Environ. 443, 454e463. http://dx.doi.org/10.1016/j.scitotenv.2012.10.077.

Rom�eo, M., Hoarau, P., Garello, G., Gnassia-Barelli, M., Girard, J.P., 2003. Musseltransplantation and biomarkers as useful tools for assessing water quality in theNW mediterranean. Environ. Pollut. 122, 369e378. http://dx.doi.org/10.1016/S0269-7491(02)00303-2.

Romero, A., Dios, S., Poisa-Beiro, L., Costa, M.M., Posada, D., Figueras, A., Novoa, B.,2011. Individual sequence variability and functional activities of fibrinogen-related proteins (FREPs) in the Mediterranean mussel (Mytilus galloprovincia-lis) suggest ancient and complex immune recognition models in invertebrates.Dev. Comp. Immunol. 35, 334e344. http://dx.doi.org/10.1016/j.dci.2010.10.007.

Renault, T., 2015. Immunotoxicological effects of environmental contaminants onmarine bivalves. Fish Shellfish Immunol., SI: Molluscan Immunity 46, 88e93.http://dx.doi.org/10.1016/j.fsi.2015.04.011.

Ruiz, P., Ortiz-Zarragoitia, M., Orbea, A., Theron, M., Le Floch, S., Cajaraville, M.P.,2012. Responses of conventional and molecular biomarkers in turbot Scoph-thalmus maximus exposed to heavy fuel oil no. 6 and styrene. Aquat. Toxicol.116e117, 116e128. http://dx.doi.org/10.1016/j.aquatox.2012.02.004.

Smital, T., Sauerborn, R., Hackenberger, B.K., 2003. Inducibility of the P-glycoproteintransport activity in the marine mussel Mytilusgalloprovincialis and the fresh-water mussel Dreissenapolymorpha. Aquat. Toxicol. 65, 443e465. http://dx.doi.org/10.1016/S0166-445X(03)00175-9.

Sokal, R., Rohlf, F., 1981. Biometry.WH Freeman, New York.Sussarellu, R., Soudant, P., Lambert, C., Fabioux, C., Corporeau, C., Laot, C., Le Goic, N.,

Quillien, V., Boudry, P., Long, M., Mingant, C., Petton, B., Maes, T., Vethaak, D.,Robbens, J., Huvet, A., 2016. Oyster reproduction is affected by exposure topolystyrene microplastics. P. Nat. Acad. Sci. 113, 2430e2435.

Van Cauwenberghe, L., Claessens, M., Vandegehuchte, M.B., Janssen, C.R., 2015.Microplastics are taken up by mussels (Mytilus edulis) and lugworms (Arenicolamarina) living in natural habitats. Environ. Pollut. 199, 10e17. http://dx.doi.org/10.1016/j.envpol.2015.01.008.

Velzeboer, I., Kwadijk, C.J.A.F., Koelmans, A.A., 2014. Strong sorption of PCBs tonanoplastics, microplastics, carbon nanotubes, and fullerenes. Environ. Sci.Technol. 48, 4869e4876.

Von Moos, N., Burkhardt-Holm, P., K€ohler, A., 2012. Uptake and effects of micro-plastics on cells and tissue of the blue mussel Mytilus edulis L. after an exper-imental exposure. Environ. Sci. Technol. 46, 11327e11335. http://dx.doi.org/10.1021/es302332w.

Ward, J.E., Shumway, S.E., 2004. Separating the grain from the chaff: particle se-lection in suspension- and deposit-feeding bivalves. J. Exp. Mar. Biol. Ecol. 300,83e130.

Wegner, A., Besseling, E., Foekema, E.M., Kamermans, P., Koelmans, A., 2012. Effectsof nanopolystyrene on the feeding behavior of the blue mussel (Mytilus edulisL.). Environ. Toxicol.Chem. 31, 2490e2497. http://dx.doi.org/10.1002/etc.1984.

Wright, S.L., Thompson, R.C., Galloway, T.S., 2013. The physical impacts of micro-plastics on marine organisms: a review. Environ. Pollut. 178, 483e492. http://dx.doi.org/10.1016/j.envpol.2013.02.031.

Xiu, M., Pan, L., Jin, Q., 2014. Bioaccumulation and oxidative damage in juvenilescallop Chlamysfarreri exposed to benzo[a]pyrene, benzo[b]fluoranthene andchrysene. Ecotoxicol. Environ. Saf. 107, 103e110. http://dx.doi.org/10.1016/j.ecoenv.2014.05.016.

Zanette, J., Jenny, M.J., Goldstone, J.V., Parente, T., Woodin, B.R., Afonso, C.D.,Bainy, A.C.D., Stegeman, J.J., 2013. Identification and expression of multipleCYP1-like and CYP3-like genes in the bivalve mollusk mytilus edulis. Aqua.Toxicol. 128e129. http://dx.doi.org/10.1016/j.aquatox.2012.11.017, 101e112.


http://dx.doi.org/10.1016/S1050-4648(02)00160-2

http://dx.doi.org/10.1016/S1050-4648(02)00160-2

http://dx.doi.org/10.1080/01926230290105721

http://dx.doi.org/10.1080/01926230290105721

http://dx.doi.org/10.1146/annurev.physiol.68.040104.110001

http://dx.doi.org/10.1146/annurev.physiol.68.040104.110001

http://dx.doi.org/10.1016/S0166-445X(98)00072-1



















http://dx.doi.org/10.1016/j.ecolind.2013.06.019

http://dx.doi.org/10.1023/A:1024604904065

http://dx.doi.org/10.1023/A:1024604904065

http://dx.doi.org/10.1007/s10646-012-0851-1



http://dx.doi.org/10.1016/0305-0491(83)90117-7

http://dx.doi.org/10.1016/0305-0491(83)90117-7


http://archimer.ifremer.fr/doc/00000/1546/

http://dx.doi.org/10.1038/srep03263

http://dx.doi.org/10.1038/srep03263

http://dx.doi.org/10.1016/j.scitotenv.2012.10.077

http://dx.doi.org/10.1016/j.scitotenv.2012.10.077

http://dx.doi.org/10.1016/S0269-7491(02)00303-2

http://dx.doi.org/10.1016/S0269-7491(02)00303-2

http://dx.doi.org/10.1016/j.dci.2010.10.007

http://dx.doi.org/10.1016/j.fsi.2015.04.011


http://dx.doi.org/10.1016/S0166-445X(03)00175-9

http://dx.doi.org/10.1016/S0166-445X(03)00175-9













http://dx.doi.org/10.1021/es302332w

http://dx.doi.org/10.1021/es302332w





http://dx.doi.org/10.1002/etc.1984



http://dx.doi.org/10.1016/j.ecoenv.2014.05.016

http://dx.doi.org/10.1016/j.ecoenv.2014.05.016


exposure of marine mussels mytilus spp. to polystyrene...

Documents